126 lines
3.6 KiB
ReStructuredText
126 lines
3.6 KiB
ReStructuredText
===============================
|
|
Mmappy: Minimap2 Python Binding
|
|
===============================
|
|
|
|
`Minimap2 <https://github.com/lh3/minimap2>`_ is a fast and accurate pairwise
|
|
aligner for genomic and transcribed nucleotide sequences. This module wraps
|
|
minimap2 and provides a convenient interface to calling minimap2 in Python.
|
|
|
|
Installation
|
|
------------
|
|
|
|
The mmappy module can be installed directly with:
|
|
|
|
.. code:: shell
|
|
|
|
git clone https://github.com/lh3/minimap2
|
|
cd minimap2
|
|
python setup.py install
|
|
|
|
or with `pip <https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
|
|
|
|
.. code:: shell
|
|
|
|
pip install --user mmappy
|
|
|
|
Usage
|
|
-----
|
|
|
|
The following Python program shows the key functionality of this module:
|
|
|
|
.. code:: python
|
|
|
|
import mmappy as mm
|
|
a = mm.Aligner("test/MT-human.fa") # load or build index
|
|
if not a: raise Exception("ERROR: failed to load/build index")
|
|
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
|
|
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
|
|
|
|
It builds an index from the specified sequence file (or loads an index if a
|
|
pre-built index is specified), aligns a sequence against it, traverses each hit
|
|
and prints them out.
|
|
|
|
APIs
|
|
----
|
|
|
|
Class mmappy.Aligner
|
|
~~~~~~~~~~~~~~~~~~~~~~
|
|
|
|
.. code:: python
|
|
|
|
Aligner(fn_idx_in, preset=None, ...)
|
|
|
|
Arguments:
|
|
|
|
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
|
|
file type. If a sequence file is provided, minimap2 builds an index. The
|
|
sequence file can be optionally gzip'd.
|
|
|
|
* **preset**: minimap2 preset. Currently, minimap2 supports the following
|
|
presets: **sr** for single-end short reads; **map-pb** for PacBio
|
|
read-to-reference mapping; **map-ont** for Oxford Nanopore read mapping;
|
|
**splice** for long-read spliced alignment; **asm5** for assembly-to-assembly
|
|
alignment; **asm10** for full genome alignment of closely related species. Note
|
|
that the Python module does not support all-vs-all read overlapping.
|
|
|
|
* **k**: k-mer length, no larger than 28
|
|
|
|
* **w**: minimizer window size, no larger than 255
|
|
|
|
* **min_cnt**: mininum number of minimizers on a chain
|
|
|
|
* **min_chain_score**: minimum chaing score
|
|
|
|
* **bw**: chaining and alignment band width
|
|
|
|
* **best_n**: max number of alignments to return
|
|
|
|
* **n_threads**: number of indexing threads; 3 by default
|
|
|
|
* **fn_idx_out**: name of file to which the index is written
|
|
|
|
.. code:: python
|
|
|
|
map(seq)
|
|
|
|
This method maps :code:`seq` against the index. It *yields* a generator,
|
|
generating a series of :code:`Alignment` objects.
|
|
|
|
Class mmappy.Alignment
|
|
~~~~~~~~~~~~~~~~~~~~~~~~
|
|
|
|
This class has the following properties:
|
|
|
|
* **ctg**: name of the reference sequence the query is mapped to
|
|
|
|
* **ctg_len**: total length of the reference sequence
|
|
|
|
* **r_st** and **r_en**: start and end positions on the reference
|
|
|
|
* **q_st** and **q_en**: start and end positions on the query
|
|
|
|
* **strand**: +1 if on the forward strand; -1 if on the reverse strand
|
|
|
|
* **mapq**: mapping quality
|
|
|
|
* **NM**: number of mismatches and gaps in the alignment
|
|
|
|
* **blen**: length of the alignment, including both alignment matches and gaps
|
|
|
|
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
|
|
reverse strand; 0 if unknown
|
|
|
|
* **is_primary**: if the alignment is primary (typically the best and the first
|
|
to generate)
|
|
|
|
* **cigar_str**: CIGAR string
|
|
|
|
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
|
|
numbers give the length and the operator of each CIGAR operation.
|
|
|
|
An :code:`Alignment` object can be converted to a string in the following format:
|
|
|
|
::
|
|
|
|
q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str
|