===============================
Mmappy: Minimap2 Python Binding
===============================
`Minimap2 <https://github.com/lh3/minimap2>`_ is a fast and accurate pairwise
aligner for genomic and transcribed nucleotide sequences. This module wraps
minimap2 and provides a convenient interface to calling minimap2 in Python.
Installation
------------
The mmappy module can be installed directly with:
.. code:: shell
git clone https://github.com/lh3/minimap2
cd minimap2
python setup.py install
or with `pip <https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
.. code:: shell
pip install --user mmappy
Usage
-----
The following Python program shows the key functionality of this module:
.. code:: python
import mmappy as mm
a = mm.Aligner("test/MT-human.fa") # load or build index
if not a: raise Exception("ERROR: failed to load/build index")
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
It builds an index from the specified sequence file (or loads an index if a
pre-built index is specified), aligns a sequence against it, traverses each hit
and prints them out.
APIs
----
Class mmappy.Aligner
~~~~~~~~~~~~~~~~~~~~~~
.. code:: python
Aligner(fn_idx_in, preset=None, ...)
Arguments:
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
file type. If a sequence file is provided, minimap2 builds an index. The
sequence file can be optionally gzip'd.
* **preset**: minimap2 preset. Currently, minimap2 supports the following
presets: **sr** for single-end short reads; **map-pb** for PacBio
read-to-reference mapping; **map-ont** for Oxford Nanopore read mapping;
**splice** for long-read spliced alignment; **asm5** for assembly-to-assembly
alignment; **asm10** for full genome alignment of closely related species. Note
that the Python module does not support all-vs-all read overlapping.
* **k**: k-mer length, no larger than 28
* **w**: minimizer window size, no larger than 255
* **min_cnt**: mininum number of minimizers on a chain
* **min_chain_score**: minimum chaing score
* **bw**: chaining and alignment band width
* **best_n**: max number of alignments to return
* **n_threads**: number of indexing threads; 3 by default
* **fn_idx_out**: name of file to which the index is written
.. code:: python
map(seq)
This method maps :code:`seq` against the index. It *yields* a generator,
generating a series of :code:`Alignment` objects.
Class mmappy.Alignment
~~~~~~~~~~~~~~~~~~~~~~~~
This class has the following properties:
* **ctg**: name of the reference sequence the query is mapped to
* **ctg_len**: total length of the reference sequence
* **r_st** and **r_en**: start and end positions on the reference
* **q_st** and **q_en**: start and end positions on the query
* **strand**: +1 if on the forward strand; -1 if on the reverse strand
* **mapq**: mapping quality
* **NM**: number of mismatches and gaps in the alignment
* **blen**: length of the alignment, including both alignment matches and gaps
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
reverse strand; 0 if unknown
* **is_primary**: if the alignment is primary (typically the best and the first
to generate)
* **cigar_str**: CIGAR string
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
numbers give the length and the operator of each CIGAR operation.
An :code:`Alignment` object can be converted to a string in the following format:
::
q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str
ef46a8aed4