minimap2/python
Heng Li cb7fb77bb9 python documentation 2017-09-16 19:50:52 -04:00
..
README.md python documentation 2017-09-16 19:50:52 -04:00
cminimap2.h improvement to the python binding 2017-09-16 11:14:01 -04:00
cminimap2.pxd fixed a bug on rev strand; added example 2017-09-16 17:51:13 -04:00
minimap2.pyx minor tweaks to python 2017-09-16 18:11:43 -04:00
mm2-lite.py fixed a bug on rev strand; added example 2017-09-16 17:51:13 -04:00

README.md

Minimap2 Python Binding

Minimap2 is a fast and accurate pairwise aligner for genomic and transcribed nucleotide sequences. This module wraps minimap2 and provides a convenient interface to calling minimap2 in Python.

Installation

The minimap2 model can be installed directly with:

git clone https://github.com/lh3/minimap2
cd minimap2
python setup.py install

or with pip:

pip install --user minimap2

Usage

The following Python program shows the key functionality of this module:

import minimap2 as mm
a = mm.Aligner("test/MT-human.fa")
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
	print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))

It builds an index from myref.fa (or loads an index if a pre-built index is supplied), aligns a sequence against it, traverses each hit and prints them out.

APIs

Class minimap2.Aligner

Aligner(fn_idx_in, preset=None, ...)

Arguments:

  • fn_idx_in: index or sequence file name. Minimap2 automatically tests the file type. If a sequence file is provided, minimap2 builds an index. The sequence file can be optionally gzip'd.

  • preset: minimap2 preset. Currently, minimap2 supports the following presets: sr for single-end short reads; map-pb for PacBio read-to-reference mapping; map-ont for Oxford Nanopore read mapping; splice for long-read spliced alignment; asm5 for assembly-to-assembly alignment; asm10 for full genome alignment of closely related species. Note that the Python module does not support all-vs-all read overlapping.

  • k: k-mer length, no larger than 28

  • w: minimizer window size, no larger than 255

  • min_cnt: mininum number of minimizers on a chain

  • min_chain_score: minimum chaing score

  • bw: chaining and alignment band width

  • best_n: max number of alignments to return

  • n_threads: number of indexing threads; 3 by default

  • fn_idx_out: name of file to which the index is written

map(query_seq)

This methods maps query_seq against the index. It yields a generator, generating a series of Alignment objects.

Class minimap2.Alignment

This class has the following properties:

  • ctg: name of the reference sequence the query is mapped to

  • ctg_len: total length of the reference sequence

  • r_st and r_en: start and end positions on the reference

  • q_st and q_en: start and end positions on the query

  • strand: +1 if on the forward strand; -1 if on the reverse strand

  • mapq: mapping quality

  • NM: number of mismatches and gaps in the alignment

  • blen: length of the alignment, including both alignment matches and gaps

  • trans_strand: transcript strand. +1 if on the forward strand; -1 if on the reverse strand; 0 if unknown

  • is_primary: if the alignment is primary (typically the best and the first to generate)

  • cigar_str: CIGAR string

  • cigar: CIGAR returned as an array of shape (n_cigar,2). The two numbers give the length and the operator of each CIGAR operation.

An Alignment object can be converted to a string in the following format:

q_st  q_en  strand  ctg  ctg_len  r_st  r_en  blen-NM  blen  mapq  cg:Z:cigar_str