minimap2/misc

Getting Started

curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8    # assuming $HOME/bin in your $PATH
gff2bed.js anno.gtf | less -S             # convert GTF/GFF3 to BED12 (if k8 installed to $PATH)
k8 gff2bed.js anno.gtf | less -S          # convert GTF/GFF3 to BED12 (if k8 not installed)
sam2paf.js aln.sam.gz | less -S           # convert SAM to PAF
minimap2 --cs test/MT-*.fa | paf2aln.js - | less          # pretty print base alignment
minimap2 -cx splice ref.fa rna-seq.fq | splice2bed.js -   # convert splice aln to BED12

Table of Contents

• Getting Started
• Introduction
• Format Conversion
  • Convert PAF to MAF or BLAST-like format
  • Convert SAM to PAF
  • Convert GTF/GFF3 to BED12
  • Convert spliced alignment to BED12
• Evaluation
  • Evaluating mapping accuracy with simulated reads
  • Evaluating read overlap sensitivity
• Calling Variants from Assemblies

Introduction

This directory contains auxiliary scripts for format conversion, mapping accuracy evaluation and miscellaneous purposes. These scripts require the k8 Javascript shell to run. On Linux or Mac, you can download the precompiled k8 binary with:

curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8  # assuming $HOME/bin in your $PATH

It is highly recommended to copy the executable k8 to a directory on your $PATH such as /usr/bin/env can find it. Like python or perl scripts, once you install k8, you can launch these k8 scripts either with

path/to/gff2bed.js anno.gtf.gz

or with

k8 path/to/gff2bed.js anno.gtf

All k8 scripts seamlessly work with both plain text files and gzip'd text files.

Format Conversion

• Script paf2aln.js converts PAF with the cs tag to MAF or BLAST-like output. It only works with minimap2 output generated using the --cs tag.

• Script sam2paf.js converts alignments in the SAM format to PAF.

• Script gff2bed.js converts GFF format to 12-column BED format. It seamlessly works with both GTF and GFF3.

• Script splice2bed.js converts spliced alignment in SAM or PAF to 12-column BED format.

Evaluation

Evaluating mapping accuracy with simulated reads

Script sim-pbsim.js converts the MAF output of pbsim to FASTQ and encodes the true mapping position in the read name in a format like S1_33!chr1!225258409!225267761!-. Similarly, script sim-mason2.js converts mason2 simulated SAM to FASTQ.

Script sim-eval.js evaluates mapped SAM/PAF. Here is example output:

Q       60      32478   0       0.000000000     32478
Q       22      16      1       0.000030775     32494
Q       21      43      1       0.000061468     32537
Q       19      73      1       0.000091996     32610
Q       14      66      1       0.000122414     32676
Q       10      27      3       0.000214048     32703
Q       8       14      1       0.000244521     32717
Q       7       13      2       0.000305530     32730
Q       6       46      1       0.000335611     32776
Q       3       10      1       0.000366010     32786
Q       2       20      2       0.000426751     32806
Q       1       248     94      0.003267381     33054
Q       0       31      17      0.003778147     33085
U       3

where each Q-line gives the quality threshold, the number of reads mapped with mapping quality equal to or greater than the threshold, number of wrong mappings, accumulative mapping error rate and the accumulative number of mapped reads. The U-line gives the number of unmapped reads if they are present in the SAM file.

Suppose the reported mapping coordinate overlap with the true coordinate like the following:

truth:   --------------------
mapper:           ----------------------
         |<- l1 ->|<-- o -->|<-- l2 -->|

Let r=o/(l1+o+l2). The reported mapping is considered correct if r>0.1 by default.

Evaluating read overlap sensitivity

Script ov-eval.js takes sorted read-to-reference alignment and read overlaps in PAF as input, and evaluates the sensitivity. For example:

minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
k8 ov-eval.js reads-to-ref.paf ovlp.paf

Calling Variants from Haploid Assemblies

Script paf2diff.js calls variants from coordinate-sorted assembly-to-reference alignment. It calls variants from the cs tag and identifies confident/callable regions as those covered by exactly one contig. Here are example command lines:

minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf  # keeping this file is recommended; --cs required!
sort -k6,6 -k8,8n asm.paf > asm.srt.paf             # sort by reference start coordinate
k8 paf2diff.js asm.srt.paf > asm.var.txt

Here is sample output:

V       chr1    3181702 3181703 1       60      c       t
V       chr1    3181730 3181768 1       60      gtcttacacacggagtcttacacacggtcttacacaca  -
R       chr1    3181796 3260557
V       chr1    3181818 3181822 1       60      tgcg    -
V       chr1    3181831 3181832 1       60      a       g
V       chr1    3181832 3181833 1       60      t       c
V       chr1    3181833 3181834 1       60      t       g
V       chr1    3181874 3181874 1       60      -       ca
V       chr1    3181879 3181880 1       60      g       a
V       chr1    3181886 3181887 1       60      c       g
V       chr1    3181911 3181911 1       60      -       agtcttacacatgcagtcttacacat
V       chr1    3181924 3181925 1       60      t       c
V       chr1    3182079 3182080 1       60      g       a
V       chr1    3182150 3182151 1       60      t       c
V       chr1    3182336 3182337 1       60      t       c

where a line starting with R gives regions covered by one contig, and a V-line encodes a variant in the following format: chr, start, end, contig depth, mapping quality, REF allele and ALT allele.

By default, when calling variants, this script ignores alignments 50kb or shorter; when deriving callable regions, it ignores alignments 10kb or shorter. It uses two thresholds to avoid edge effects. These defaults are designed for long-read assemblies. For short reads, both should be reduced.