|
|
||
|---|---|---|
| .. | ||
| README.md | ||
| cminimap2.h | ||
| cminimap2.pxd | ||
| minimap2.pyx | ||
| mm2-lite.py | ||
README.md
Minimap2 Python Binding
Minimap2 is a fast and accurate pairwise aligner for genomic and transcribed nucleotide sequences. This module wraps minimap2 and provides a convenient interface to calling minimap2 in Python.
Installation
The minimap2 model can be installed directly with:
git clone https://github.com/lh3/minimap2
cd minimap2
python setup.py install
or with pip:
pip install --user minimap2
Usage
The following Python program shows the key functionality of this module:
import minimap2 as mm
a = mm.Aligner("test/MT-human.fa")
if not a: raise Exception("ERROR: failed to load/build index")
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
It builds an index from the specified sequence file (or loads an index if a pre-built index is supplied), aligns a sequence against it, traverses each hit and prints them out.
APIs
Class minimap2.Aligner
Aligner(fn_idx_in, preset=None, ...)
Arguments:
-
fn_idx_in: index or sequence file name. Minimap2 automatically tests the file type. If a sequence file is provided, minimap2 builds an index. The sequence file can be optionally gzip'd. -
preset: minimap2 preset. Currently, minimap2 supports the following presets:srfor single-end short reads;map-pbfor PacBio read-to-reference mapping;map-ontfor Oxford Nanopore read mapping;splicefor long-read spliced alignment;asm5for assembly-to-assembly alignment;asm10for full genome alignment of closely related species. Note that the Python module does not support all-vs-all read overlapping. -
k: k-mer length, no larger than 28 -
w: minimizer window size, no larger than 255 -
min_cnt: mininum number of minimizers on a chain -
min_chain_score: minimum chaing score -
bw: chaining and alignment band width -
best_n: max number of alignments to return -
n_threads: number of indexing threads; 3 by default -
fn_idx_out: name of file to which the index is written
map(query_seq)
This methods maps query_seq against the index. It yields a generator,
generating a series of Alignment objects.
Class minimap2.Alignment
This class has the following properties:
-
ctg: name of the reference sequence the query is mapped to -
ctg_len: total length of the reference sequence -
r_standr_en: start and end positions on the reference -
q_standq_en: start and end positions on the query -
strand: +1 if on the forward strand; -1 if on the reverse strand -
mapq: mapping quality -
NM: number of mismatches and gaps in the alignment -
blen: length of the alignment, including both alignment matches and gaps -
trans_strand: transcript strand. +1 if on the forward strand; -1 if on the reverse strand; 0 if unknown -
is_primary: if the alignment is primary (typically the best and the first to generate) -
cigar_str: CIGAR string -
cigar: CIGAR returned as an array of shape(n_cigar,2). The two numbers give the length and the operator of each CIGAR operation.
An Alignment object can be converted to a string in the following format:
q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str