=============================== Mmappy: Minimap2 Python Binding =============================== `Minimap2 `_ is a fast and accurate pairwise aligner for genomic and transcribed nucleotide sequences. This module wraps minimap2 and provides a convenient interface to calling minimap2 in Python. Installation ------------ The mmappy module can be installed directly with: .. code:: shell git clone https://github.com/lh3/minimap2 cd minimap2 python setup.py install or with `pip `_: .. code:: shell pip install --user mmappy Usage ----- The following Python program shows the key functionality of this module: .. code:: python import mmappy as mm a = mm.Aligner("test/MT-human.fa") # load or build index if not a: raise Exception("ERROR: failed to load/build index") for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"): print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str)) It builds an index from the specified sequence file (or loads an index if a pre-built index is specified), aligns a sequence against it, traverses each hit and prints them out. APIs ---- Class mmappy.Aligner ~~~~~~~~~~~~~~~~~~~~~~ .. code:: python Aligner(fn_idx_in, preset=None, ...) Arguments: * **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the file type. If a sequence file is provided, minimap2 builds an index. The sequence file can be optionally gzip'd. * **preset**: minimap2 preset. Currently, minimap2 supports the following presets: **sr** for single-end short reads; **map-pb** for PacBio read-to-reference mapping; **map-ont** for Oxford Nanopore read mapping; **splice** for long-read spliced alignment; **asm5** for assembly-to-assembly alignment; **asm10** for full genome alignment of closely related species. Note that the Python module does not support all-vs-all read overlapping. * **k**: k-mer length, no larger than 28 * **w**: minimizer window size, no larger than 255 * **min_cnt**: mininum number of minimizers on a chain * **min_chain_score**: minimum chaing score * **bw**: chaining and alignment band width * **best_n**: max number of alignments to return * **n_threads**: number of indexing threads; 3 by default * **fn_idx_out**: name of file to which the index is written .. code:: python map(seq) This method maps :code:`seq` against the index. It *yields* a generator, generating a series of :code:`Alignment` objects. Class mmappy.Alignment ~~~~~~~~~~~~~~~~~~~~~~~~ This class has the following properties: * **ctg**: name of the reference sequence the query is mapped to * **ctg_len**: total length of the reference sequence * **r_st** and **r_en**: start and end positions on the reference * **q_st** and **q_en**: start and end positions on the query * **strand**: +1 if on the forward strand; -1 if on the reverse strand * **mapq**: mapping quality * **NM**: number of mismatches and gaps in the alignment * **blen**: length of the alignment, including both alignment matches and gaps * **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the reverse strand; 0 if unknown * **is_primary**: if the alignment is primary (typically the best and the first to generate) * **cigar_str**: CIGAR string * **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two numbers give the length and the operator of each CIGAR operation. An :code:`Alignment` object can be converted to a string in the following format: :: q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str