## Minimap2 Python Binding [Minimap2][minimap2] is a fast and accurate pairwise aligner for genomic and transcribed nucleotide sequences. This module wraps minimap2 and provides a convenient interface to calling minimap2 in Python. ### Installation The minimap2 model can be installed directly with: ```sh git clone https://github.com/lh3/minimap2 cd minimap2 python setup.py install ``` or with [pip][pip]: ```sh pip install --user minimap2 ``` ### Usage The following Python program shows the key functionality of this module: ```python import minimap2 as mm a = mm.Aligner("test/MT-human.fa") if not a: raise Exception("ERROR: failed to load/build index") for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"): print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str)) ``` It builds an index from the specified sequence file (or loads an index if a pre-built index is supplied), aligns a sequence against it, traverses each hit and prints them out. ### APIs #### Class minimap2.Aligner ```python Aligner(fn_idx_in, preset=None, ...) ``` Arguments: * `fn_idx_in`: index or sequence file name. Minimap2 automatically tests the file type. If a sequence file is provided, minimap2 builds an index. The sequence file can be optionally gzip'd. * `preset`: minimap2 preset. Currently, minimap2 supports the following presets: `sr` for single-end short reads; `map-pb` for PacBio read-to-reference mapping; `map-ont` for Oxford Nanopore read mapping; `splice` for long-read spliced alignment; `asm5` for assembly-to-assembly alignment; `asm10` for full genome alignment of closely related species. Note that the Python module does not support all-vs-all read overlapping. * `k`: k-mer length, no larger than 28 * `w`: minimizer window size, no larger than 255 * `min_cnt`: mininum number of minimizers on a chain * `min_chain_score`: minimum chaing score * `bw`: chaining and alignment band width * `best_n`: max number of alignments to return * `n_threads`: number of indexing threads; 3 by default * `fn_idx_out`: name of file to which the index is written ```python map(query_seq) ``` This methods maps `query_seq` against the index. It *yields* a generator, generating a series of `Alignment` objects. #### Class minimap2.Alignment This class has the following properties: * `ctg`: name of the reference sequence the query is mapped to * `ctg_len`: total length of the reference sequence * `r_st` and `r_en`: start and end positions on the reference * `q_st` and `q_en`: start and end positions on the query * `strand`: +1 if on the forward strand; -1 if on the reverse strand * `mapq`: mapping quality * `NM`: number of mismatches and gaps in the alignment * `blen`: length of the alignment, including both alignment matches and gaps * `trans_strand`: transcript strand. +1 if on the forward strand; -1 if on the reverse strand; 0 if unknown * `is_primary`: if the alignment is primary (typically the best and the first to generate) * `cigar_str`: CIGAR string * `cigar`: CIGAR returned as an array of shape `(n_cigar,2)`. The two numbers give the length and the operator of each CIGAR operation. An Alignment object can be converted to a string in the following format: ``` q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str ``` [minimap2]: https://github.com/lh3/minimap2 [pip]: https://pypi.python.org/pypi/pip