diff --git a/MANIFEST.in b/MANIFEST.in new file mode 100644 index 0000000..f6bc8d0 --- /dev/null +++ b/MANIFEST.in @@ -0,0 +1,11 @@ +include *.h +include Makefile +include ksw2_dispatch.c +include getopt.c +include main.c +include README.md +include python/minimap2.c +include python/cminimap2.h +include python/cminimap2.pxd +include python/minimap2.pyx +include python/README.md diff --git a/python/README.md b/python/README.rst similarity index 69% rename from python/README.md rename to python/README.rst index fa08b06..fb48393 100644 --- a/python/README.md +++ b/python/README.rst @@ -1,43 +1,55 @@ -## Minimap2 Python Binding +======================= +Minimap2 Python Binding +======================= -[Minimap2][minimap2] is a fast and accurate pairwise aligner for genomic and -transcribed nucleotide sequences. This module wraps minimap2 and provides a -convenient interface to calling minimap2 in Python. +`Minimap2 ` is a fast and accurate pairwise +aligner for genomic and transcribed nucleotide sequences. This module wraps +minimap2 and provides a convenient interface to calling minimap2 in Python. -### Installation +Installation +------------ The minimap2 model can be installed directly with: -```sh -git clone https://github.com/lh3/minimap2 -cd minimap2 -python setup.py install -``` -or with [pip][pip]: -```sh -pip install --user minimap2 -``` -### Usage +.. code:: shell + + git clone https://github.com/lh3/minimap2 + cd minimap2 + python setup.py install + +or with pip: + +.. code:: shell + + pip install --user minimap2 + +Usage +----- The following Python program shows the key functionality of this module: -```python -import minimap2 as mm -a = mm.Aligner("test/MT-human.fa") -if not a: raise Exception("ERROR: failed to load/build index") -for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"): - print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str)) -``` + +.. code:: python + + import minimap2 as mm + a = mm.Aligner("test/MT-human.fa") + if not a: raise Exception("ERROR: failed to load/build index") + for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"): + print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str)) + It builds an index from the specified sequence file (or loads an index if a pre-built index is supplied), aligns a sequence against it, traverses each hit and prints them out. -### APIs +APIs +---- -#### Class minimap2.Aligner +Class minimap2.Aligner +~~~~~~~~~~~~~~~~~~~~~~ + +.. code:: python + + Aligner(fn_idx_in, preset=None, ...) -```python -Aligner(fn_idx_in, preset=None, ...) -``` Arguments: * `fn_idx_in`: index or sequence file name. Minimap2 automatically tests the @@ -67,13 +79,15 @@ Arguments: * `fn_idx_out`: name of file to which the index is written -```python -map(query_seq) -``` +.. code:: python + + map(query_seq) + This methods maps `query_seq` against the index. It *yields* a generator, generating a series of `Alignment` objects. -#### Class minimap2.Alignment +Class minimap2.Alignment +~~~~~~~~~~~~~~~~~~~~~~~~ This class has the following properties: @@ -105,11 +119,7 @@ This class has the following properties: give the length and the operator of each CIGAR operation. An Alignment object can be converted to a string in the following format: -``` -q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str -``` +:: - -[minimap2]: https://github.com/lh3/minimap2 -[pip]: https://pypi.python.org/pypi/pip + q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str diff --git a/setup.py b/setup.py index 395d137..d041d9e 100644 --- a/setup.py +++ b/setup.py @@ -4,9 +4,17 @@ except ImportError: from distutils.core import setup from distutils.extension import Extension -from Cython.Build import cythonize -import sys +cmdclass = {} +try: + from Cython.Build import build_ext +except ImportError: # without Cython + module_src = 'python/minimap2.c' +else: # with Cython + module_src = 'python/minimap2.pyx' + cmdclass['build_ext'] = build_ext + +import sys sys.path.append('python') setup( @@ -16,12 +24,16 @@ setup( description = 'Minimap2 python binding', author = 'Heng Li', author_email = 'lh3@me.com', + license = 'MIT', keywords = ['bioinformatics', 'sequence-alignment'], - ext_modules = cythonize([Extension('minimap2', - ['python/minimap2.pyx', 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'kalloc.c', - 'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c', 'kthread.c', 'map.c', - 'misc.c', 'sdust.c', 'sketch.c'], + ext_modules = [Extension('minimap2', + sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', + 'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c', + 'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c'], + depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h', + 'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h', + 'python/cminimap2.h', 'python/cminimap2.pxd'], extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4 include_dirs = ['.'], - libraries = ['z', 'm', 'pthread'])]) -) + libraries = ['z', 'm', 'pthread'])], + cmdclass = cmdclass)