diff --git a/python/README.md b/python/README.md
new file mode 100644
index 0000000..0cde21f
--- /dev/null
+++ b/python/README.md
@@ -0,0 +1,114 @@
+## Minimap2 Python Binding
+
+[Minimap2][minimap2] is a fast and accurate pairwise aligner for genomic and
+transcribed nucleotide sequences. This module wraps minimap2 and provides a
+convenient interface to calling minimap2 in Python.
+
+### Installation
+
+The minimap2 model can be installed directly with:
+```sh
+git clone https://github.com/lh3/minimap2
+cd minimap2
+python setup.py install
+```
+or with [pip][pip]:
+```sh
+pip install --user minimap2
+```
+
+### Usage
+
+The following Python program shows the key functionality of this module:
+```python
+import minimap2 as mm
+a = mm.Aligner("test/MT-human.fa")
+for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
+	print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
+```
+It builds an index from `myref.fa` (or loads an index if a pre-built index is
+supplied), aligns a sequence against it, traverses each hit and prints them
+out.
+
+### APIs
+
+#### Class minimap2.Aligner
+
+```python
+Aligner(fn_idx_in, preset=None, ...)
+```
+Arguments:
+
+* `fn_idx_in`: index or sequence file name. Minimap2 automatically tests the
+  file type. If a sequence file is provided, minimap2 builds an index. The
+  sequence file can be optionally gzip'd.
+
+* `preset`: minimap2 preset. Currently, minimap2 supports the following
+  presets: `sr` for single-end short reads; `map-pb` for PacBio
+  read-to-reference mapping; `map-ont` for Oxford Nanopore read mapping;
+  `splice` for long-read spliced alignment; `asm5` for assembly-to-assembly
+  alignment; `asm10` for full genome alignment of closely related species. Note
+  that the Python module does not support all-vs-all read overlapping.
+
+* `k`: k-mer length, no larger than 28
+
+* `w`: minimizer window size, no larger than 255
+
+* `min_cnt`: mininum number of minimizers on a chain
+
+* `min_chain_score`: minimum chaing score
+
+* `bw`: chaining and alignment band width
+
+* `best_n`: max number of alignments to return
+
+* `n_threads`: number of indexing threads; 3 by default
+
+* `fn_idx_out`: name of file to which the index is written
+
+```python
+map(query_seq)
+```
+This methods maps `query_seq` against the index. It *yields* a generator,
+generating a series of `Alignment` objects.
+
+#### Class minimap2.Alignment
+
+This class has the following properties:
+
+* `ctg`: name of the reference sequence the query is mapped to
+
+* `ctg_len`: total length of the reference sequence
+
+* `r_st` and `r_en`: start and end positions on the reference
+
+* `q_st` and `q_en`: start and end positions on the query
+
+* `strand`: +1 if on the forward strand; -1 if on the reverse strand
+
+* `mapq`: mapping quality
+
+* `NM`: number of mismatches and gaps in the alignment
+
+* `blen`: length of the alignment, including both alignment matches and gaps
+
+* `trans_strand`: transcript strand. +1 if on the forward strand; -1 if on the
+  reverse strand; 0 if unknown
+
+* `is_primary`: if the alignment is primary (typically the best and the first
+  to generate)
+
+* `cigar_str`: CIGAR string
+
+* `cigar`: CIGAR returned as an array of shape `(n_cigar,2)`. The two numbers
+  give the length and the operator of each CIGAR operation.
+
+An Alignment object can be converted to a string in the following format:
+```
+q_st  q_en  strand  ctg  ctg_len  r_st  r_en  blen-NM  blen  mapq  cg:Z:cigar_str
+```
+
+
+
+[minimap2]: https://github.com/lh3/minimap2
+[pip]: https://pypi.python.org/pypi/pip