zzh
/
minimap2
1
0
Fork 0
Code Issues Pull Requests Packages Projects Releases Wiki Activity

fixed a few typos 

eh... a missing fix
This commit is contained in:
Heng Li 2017-09-16 22:52:26 -04:00
parent 1d90742b35
commit 8cdaae0935
1 changed files with 6 additions and 6 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

12
python/README.rst
View File

@ -9,7 +9,7 @@ minimap2 and provides a convenient interface to calling minimap2 in Python.
Installation Installation
------------ ------------
The minimap2 model can be installed directly with: The minimap2 module can be installed directly with:
.. code:: shell .. code:: shell
@ -31,13 +31,13 @@ The following Python program shows the key functionality of this module:
.. code:: python .. code:: python
import minimap2 as mm import minimap2 as mm
a = mm.Aligner("test/MT-human.fa") a = mm.Aligner("test/MT-human.fa") # load or build index
if not a: raise Exception("ERROR: failed to load/build index") if not a: raise Exception("ERROR: failed to load/build index")
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"): for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str)) print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
It builds an index from the specified sequence file (or loads an index if a It builds an index from the specified sequence file (or loads an index if a
pre-built index is supplied), aligns a sequence against it, traverses each hit pre-built index is specified), aligns a sequence against it, traverses each hit
and prints them out. and prints them out.
APIs APIs
@ -81,9 +81,9 @@ Arguments:
.. code:: python .. code:: python
map(query_seq) map(seq)
This methods maps :code:`query_seq` against the index. It *yields* a generator, This method maps :code:`seq` against the index. It *yields* a generator,
generating a series of :code:`Alignment` objects. generating a series of :code:`Alignment` objects.
Class minimap2.Alignment Class minimap2.Alignment
@ -118,7 +118,7 @@ This class has the following properties:
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two * **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
numbers give the length and the operator of each CIGAR operation. numbers give the length and the operator of each CIGAR operation.
An Alignment object can be converted to a string in the following format: An :code:`Alignment` object can be converted to a string in the following format:
:: ::