From 6b66ec616796185730f8121a5e100c997b6d02b5 Mon Sep 17 00:00:00 2001
From: Heng Li <lh3@me.com>
Date: Sat, 16 Sep 2017 19:55:33 -0400
Subject: [PATCH] minor

---
 python/README.md    | 6 +++---
 python/minimap2.pyx | 2 +-
 2 files changed, 4 insertions(+), 4 deletions(-)

diff --git a/python/README.md b/python/README.md
index 0cde21f..5868f04 100644
--- a/python/README.md
+++ b/python/README.md
@@ -26,9 +26,9 @@ a = mm.Aligner("test/MT-human.fa")
 for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
 	print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
 ```
-It builds an index from `myref.fa` (or loads an index if a pre-built index is
-supplied), aligns a sequence against it, traverses each hit and prints them
-out.
+It builds an index from the specified sequence file (or loads an index if a
+pre-built index is supplied), aligns a sequence against it, traverses each hit
+and prints them out.
 
 ### APIs
 
diff --git a/python/minimap2.pyx b/python/minimap2.pyx
index 9c72d4a..a6dbf1f 100644
--- a/python/minimap2.pyx
+++ b/python/minimap2.pyx
@@ -35,7 +35,7 @@ cdef class Alignment:
 	def strand(self): return self.strand
 
 	@property
-	def trans_strand(self): return self.trans_strand
+	def trans_strand(self): return self._trans_strand
 
 	@property
 	def NM(self): return self._NM