This commit is contained in:
Heng Li 2017-09-16 19:55:33 -04:00
parent cb7fb77bb9
commit 6b66ec6167
2 changed files with 4 additions and 4 deletions

View File

@ -26,9 +26,9 @@ a = mm.Aligner("test/MT-human.fa")
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
```
It builds an index from `myref.fa` (or loads an index if a pre-built index is
supplied), aligns a sequence against it, traverses each hit and prints them
out.
It builds an index from the specified sequence file (or loads an index if a
pre-built index is supplied), aligns a sequence against it, traverses each hit
and prints them out.
### APIs

View File

@ -35,7 +35,7 @@ cdef class Alignment:
def strand(self): return self.strand
@property
def trans_strand(self): return self.trans_strand
def trans_strand(self): return self._trans_strand
@property
def NM(self): return self._NM