115 lines
3.3 KiB
Markdown
115 lines
3.3 KiB
Markdown
|
|
## Minimap2 Python Binding
|
||
|
|
|
||
|
|
[Minimap2][minimap2] is a fast and accurate pairwise aligner for genomic and
|
||
|
|
transcribed nucleotide sequences. This module wraps minimap2 and provides a
|
||
|
|
convenient interface to calling minimap2 in Python.
|
||
|
|
|
||
|
|
### Installation
|
||
|
|
|
||
|
|
The minimap2 model can be installed directly with:
|
||
|
|
```sh
|
||
|
|
git clone https://github.com/lh3/minimap2
|
||
|
|
cd minimap2
|
||
|
|
python setup.py install
|
||
|
|
```
|
||
|
|
or with [pip][pip]:
|
||
|
|
```sh
|
||
|
|
pip install --user minimap2
|
||
|
|
```
|
||
|
|
|
||
|
|
### Usage
|
||
|
|
|
||
|
|
The following Python program shows the key functionality of this module:
|
||
|
|
```python
|
||
|
|
import minimap2 as mm
|
||
|
|
a = mm.Aligner("test/MT-human.fa")
|
||
|
|
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
|
||
|
|
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
|
||
|
|
```
|
||
|
|
It builds an index from `myref.fa` (or loads an index if a pre-built index is
|
||
|
|
supplied), aligns a sequence against it, traverses each hit and prints them
|
||
|
|
out.
|
||
|
|
|
||
|
|
### APIs
|
||
|
|
|
||
|
|
#### Class minimap2.Aligner
|
||
|
|
|
||
|
|
```python
|
||
|
|
Aligner(fn_idx_in, preset=None, ...)
|
||
|
|
```
|
||
|
|
Arguments:
|
||
|
|
|
||
|
|
* `fn_idx_in`: index or sequence file name. Minimap2 automatically tests the
|
||
|
|
file type. If a sequence file is provided, minimap2 builds an index. The
|
||
|
|
sequence file can be optionally gzip'd.
|
||
|
|
|
||
|
|
* `preset`: minimap2 preset. Currently, minimap2 supports the following
|
||
|
|
presets: `sr` for single-end short reads; `map-pb` for PacBio
|
||
|
|
read-to-reference mapping; `map-ont` for Oxford Nanopore read mapping;
|
||
|
|
`splice` for long-read spliced alignment; `asm5` for assembly-to-assembly
|
||
|
|
alignment; `asm10` for full genome alignment of closely related species. Note
|
||
|
|
that the Python module does not support all-vs-all read overlapping.
|
||
|
|
|
||
|
|
* `k`: k-mer length, no larger than 28
|
||
|
|
|
||
|
|
* `w`: minimizer window size, no larger than 255
|
||
|
|
|
||
|
|
* `min_cnt`: mininum number of minimizers on a chain
|
||
|
|
|
||
|
|
* `min_chain_score`: minimum chaing score
|
||
|
|
|
||
|
|
* `bw`: chaining and alignment band width
|
||
|
|
|
||
|
|
* `best_n`: max number of alignments to return
|
||
|
|
|
||
|
|
* `n_threads`: number of indexing threads; 3 by default
|
||
|
|
|
||
|
|
* `fn_idx_out`: name of file to which the index is written
|
||
|
|
|
||
|
|
```python
|
||
|
|
map(query_seq)
|
||
|
|
```
|
||
|
|
This methods maps `query_seq` against the index. It *yields* a generator,
|
||
|
|
generating a series of `Alignment` objects.
|
||
|
|
|
||
|
|
#### Class minimap2.Alignment
|
||
|
|
|
||
|
|
This class has the following properties:
|
||
|
|
|
||
|
|
* `ctg`: name of the reference sequence the query is mapped to
|
||
|
|
|
||
|
|
* `ctg_len`: total length of the reference sequence
|
||
|
|
|
||
|
|
* `r_st` and `r_en`: start and end positions on the reference
|
||
|
|
|
||
|
|
* `q_st` and `q_en`: start and end positions on the query
|
||
|
|
|
||
|
|
* `strand`: +1 if on the forward strand; -1 if on the reverse strand
|
||
|
|
|
||
|
|
* `mapq`: mapping quality
|
||
|
|
|
||
|
|
* `NM`: number of mismatches and gaps in the alignment
|
||
|
|
|
||
|
|
* `blen`: length of the alignment, including both alignment matches and gaps
|
||
|
|
|
||
|
|
* `trans_strand`: transcript strand. +1 if on the forward strand; -1 if on the
|
||
|
|
reverse strand; 0 if unknown
|
||
|
|
|
||
|
|
* `is_primary`: if the alignment is primary (typically the best and the first
|
||
|
|
to generate)
|
||
|
|
|
||
|
|
* `cigar_str`: CIGAR string
|
||
|
|
|
||
|
|
* `cigar`: CIGAR returned as an array of shape `(n_cigar,2)`. The two numbers
|
||
|
|
give the length and the operator of each CIGAR operation.
|
||
|
|
|
||
|
|
An Alignment object can be converted to a string in the following format:
|
||
|
|
```
|
||
|
|
q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str
|
||
|
|
```
|
||
|
|
|
||
|
|
|
||
|
|
|
||
|
|
[minimap2]: https://github.com/lh3/minimap2
|
||
|
|
[pip]: https://pypi.python.org/pypi/pip
|