/* * Copyright (c) 2012 The Broad Institute * * Permission is hereby granted, free of charge, to any person * obtaining a copy of this software and associated documentation * files (the "Software"), to deal in the Software without * restriction, including without limitation the rights to use, * copy, modify, merge, publish, distribute, sublicense, and/or sell * copies of the Software, and to permit persons to whom the * Software is furnished to do so, subject to the following * conditions: * * The above copyright notice and this permission notice shall be * included in all copies or substantial portions of the Software. * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.variant.utils; import org.broadinstitute.sting.utils.MathUtils; import org.testng.Assert; import org.broadinstitute.sting.BaseTest; import org.testng.annotations.Test; import org.testng.annotations.BeforeClass; public class BaseUtilsUnitTest extends BaseTest { @BeforeClass public void init() { } @Test public void testMostFrequentBaseFraction() { logger.warn("Executing testMostFrequentBaseFraction"); compareFrequentBaseFractionToExpected("AAAAA", 1.0); compareFrequentBaseFractionToExpected("ACCG", 0.5); compareFrequentBaseFractionToExpected("ACCCCTTTTG", 4.0/10.0); } private void compareFrequentBaseFractionToExpected(String sequence, double expected) { double fraction = BaseUtils.mostFrequentBaseFraction(sequence.getBytes()); Assert.assertTrue(MathUtils.compareDoubles(fraction, expected) == 0); } @Test public void testConvertIUPACtoN() { checkBytesAreEqual(BaseUtils.convertIUPACtoN(new byte[]{'A', 'A', 'A'}, false, false), new byte[]{'A', 'A', 'A'}); checkBytesAreEqual(BaseUtils.convertIUPACtoN(new byte[]{'W', 'A', 'A'}, false, false), new byte[]{'N', 'A', 'A'}); checkBytesAreEqual(BaseUtils.convertIUPACtoN(new byte[]{'A', 'M', 'A'}, false, false), new byte[]{'A', 'N', 'A'}); checkBytesAreEqual(BaseUtils.convertIUPACtoN(new byte[]{'A', 'A', 'K'}, false, false), new byte[]{'A', 'A', 'N'}); checkBytesAreEqual(BaseUtils.convertIUPACtoN(new byte[]{'M', 'M', 'M'}, false, false), new byte[]{'N', 'N', 'N'}); } private void checkBytesAreEqual(final byte[] b1, final byte[] b2) { for ( int i = 0; i < b1.length; i++ ) Assert.assertEquals(b1[i], b2[i]); } @Test public void testTransitionTransversion() { logger.warn("Executing testTransitionTransversion"); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'T' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'C' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'G' ) == BaseUtils.BaseSubstitutionType.TRANSITION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'C', (byte)'A' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'C', (byte)'T' ) == BaseUtils.BaseSubstitutionType.TRANSITION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'C', (byte)'G' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'T', (byte)'A' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'T', (byte)'C' ) == BaseUtils.BaseSubstitutionType.TRANSITION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'T', (byte)'G' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'G', (byte)'A' ) == BaseUtils.BaseSubstitutionType.TRANSITION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'G', (byte)'T' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'G', (byte)'C' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'a', (byte)'T' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'a', (byte)'C' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'T' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'C' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'t' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'c' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'a', (byte)'t' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'a', (byte)'c' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); } @Test public void testReverseComplementString() { logger.warn("Executing testReverseComplementString"); compareRCStringToExpected("ACGGT", "ACCGT"); compareRCStringToExpected("TCGTATATCTCGCTATATATATATAGCTCTAGTATA", "TATACTAGAGCTATATATATATAGCGAGATATACGA"); compareRCStringToExpected("AAAN", "NTTT"); } private void compareRCStringToExpected(String fw, String rcExp) { String rcObs = BaseUtils.simpleReverseComplement(fw); Assert.assertTrue(rcObs.equals(rcExp)); } }