/* * Copyright (c) 2010, The Broad Institute * * Permission is hereby granted, free of charge, to any person * obtaining a copy of this software and associated documentation * files (the "Software"), to deal in the Software without * restriction, including without limitation the rights to use, * copy, modify, merge, publish, distribute, sublicense, and/or sell * copies of the Software, and to permit persons to whom the * Software is furnished to do so, subject to the following * conditions: * * The above copyright notice and this permission notice shall be * included in all copies or substantial portions of the Software. * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR * OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.utils; import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; import net.sf.samtools.Cigar; import java.util.*; import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.exceptions.StingException; /** * Created by IntelliJ IDEA. * User: asivache * Date: Mar 23, 2009 * Time: 1:54:54 PM * To change this template use File | Settings | File Templates. */ public class SWPairwiseAlignment { private int alignment_offset; // offset of s2 w/respect to s1 private Cigar alignmentCigar; private final double w_match; private final double w_mismatch; private final double w_open; private final double w_extend; private static final int MSTATE = 0; private static final int ISTATE = 1; private static final int DSTATE = 2; private static boolean cutoff = false; double[] SW; // private double [] best_gap_v ; // private int [] gap_size_v ; // private double [] best_gap_h ; // private int [] gap_size_h ; // private static double [][] sw = new double[500][500]; // private static int [][] btrack = new int[500][500]; // ************************************************************************ // **** IMPORTANT NOTE: **** // **** This class assumes that all bytes come from UPPERCASED chars! **** // ************************************************************************ public SWPairwiseAlignment(byte[] seq1, byte[] seq2, double match, double mismatch, double open, double extend ) { w_match = match; w_mismatch = mismatch; w_open = open; w_extend = extend; align(seq1,seq2); } public SWPairwiseAlignment(byte[] seq1, byte[] seq2) { this(seq1,seq2,1.0,-1.0/3.0,-1.0-1.0/3.0,-1.0/3.0); // match=1, mismatch = -1/3, gap=-(1+k/3) } public Cigar getCigar() { return alignmentCigar ; } public int getAlignmentStart2wrt1() { return alignment_offset; } public void align(final byte[] a, final byte[] b) { final int n = a.length; final int m = b.length; double [] sw = new double[(n+1)*(m+1)]; SW = sw; int [] btrack = new int[(n+1)*(m+1)]; // best_gap_v = new double[m+1]; // Arrays.fill(best_gap_v,-1.0e40); // gap_size_v = new int[m+1]; // best_gap_h = new double[n+1]; // Arrays.fill(best_gap_h,-1.0e40); // gap_size_h = new int[n+1]; calculateMatrix(a, b, sw, btrack); calculateCigar(n, m, sw, btrack); // length of the segment (continuous matches, insertions or deletions) } private void calculateMatrix(final byte[] a, final byte[] b, double [] sw, int [] btrack ) { final int n = a.length+1; final int m = b.length+1; //final double MATRIX_MIN_CUTOFF=-1e100; // never let matrix elements drop below this cutoff final double MATRIX_MIN_CUTOFF; // never let matrix elements drop below this cutoff if ( cutoff ) MATRIX_MIN_CUTOFF = 0.0; else MATRIX_MIN_CUTOFF = -1e100; double [] best_gap_v = new double[m+1]; Arrays.fill(best_gap_v,-1.0e40); int [] gap_size_v = new int[m+1]; double [] best_gap_h = new double[n+1]; Arrays.fill(best_gap_h,-1.0e40); int [] gap_size_h = new int[n+1]; // build smith-waterman matrix and keep backtrack info: for ( int i = 1, row_offset_1 = 0 ; i < n ; i++ ) { // we do NOT update row_offset_1 here, see comment at the end of this outer loop byte a_base = a[i-1]; // letter in a at the current pos final int row_offset = row_offset_1 + m; // On the entrance into the loop, row_offset_1 is the (linear) offset // of the first element of row (i-1) and row_offset is the linear offset of the // start of row i for ( int j = 1, data_offset_1 = row_offset_1 ; j < m ; j++, data_offset_1++ ) { // data_offset_1 is linearized offset of element [i-1][j-1] final byte b_base = b[j-1]; // letter in b at the current pos // in other words, step_diag = sw[i-1][j-1] + wd(a_base,b_base); double step_diag = sw[data_offset_1] + wd(a_base,b_base); // optimized "traversal" of all the matrix cells above the current one (i.e. traversing // all 'step down' events that would end in the current cell. The optimized code // does exactly the same thing as the commented out loop below. IMPORTANT: // the optimization works ONLY for linear w(k)=wopen+(k-1)*wextend!!!! // if a gap (length 1) was just opened above, this is the cost of arriving to the current cell: double prev_gap = sw[data_offset_1+1]+w_open; best_gap_v[j] += w_extend; // for the gaps that were already opened earlier, extending them by 1 costs w_extend if ( prev_gap > best_gap_v[j] ) { // opening a gap just before the current cell results in better score than extending by one // the best previously opened gap. This will hold for ALL cells below: since any gap // once opened always costs w_extend to extend by another base, we will always get a better score // by arriving to any cell below from the gap we just opened (prev_gap) rather than from the previous best gap best_gap_v[j] = prev_gap; gap_size_v[j] = 1; // remember that the best step-down gap from above has length 1 (we just opened it) } else { // previous best gap is still the best, even after extension by another base, so we just record that extension: gap_size_v[j]++; } final double step_down = best_gap_v[j] ; final int kd = gap_size_v[j]; /* for ( int k = 1, data_offset_k = data_offset_1+1 ; k < i ; k++, data_offset_k -= m ) { // data_offset_k is linearized offset of element [i-k][j] // in other words, trial = sw[i-k][j]+gap_penalty: final double trial = sw[data_offset_k]+wk(k); if ( step_down < trial ) { step_down=trial; kd = k; } } */ // optimized "traversal" of all the matrix cells to the left of the current one (i.e. traversing // all 'step right' events that would end in the current cell. The optimized code // does exactly the same thing as the commented out loop below. IMPORTANT: // the optimization works ONLY for linear w(k)=wopen+(k-1)*wextend!!!! final int data_offset = row_offset + j; // linearized offset of element [i][j] prev_gap = sw[data_offset-1]+w_open; // what would it cost us to open length 1 gap just to the left from current cell best_gap_h[i] += w_extend; // previous best gap would cost us that much if extended by another base if ( prev_gap > best_gap_h[i] ) { // newly opened gap is better (score-wise) than any previous gap with the same row index i; since // gap penalty is linear with k, this new gap location is going to remain better than any previous ones best_gap_h[i] = prev_gap; gap_size_h[i] = 1; } else { gap_size_h[i]++; } final double step_right = best_gap_h[i]; final int ki = gap_size_h[i]; /* for ( int k = 1, data_offset = row_offset+j-1 ; k < j ; k++, data_offset-- ) { // data_offset is linearized offset of element [i][j-k] // in other words, step_right=sw[i][j-k]+gap_penalty; final double trial = sw[data_offset]+wk(k); if ( step_right < trial ) { step_right=trial; ki = k; } } final int data_offset = row_offset + j; // linearized offset of element [i][j] */ if ( step_down > step_right ) { if ( step_down > step_diag ) { sw[data_offset] = Math.max(MATRIX_MIN_CUTOFF,step_down); btrack[data_offset] = kd ; // positive=vertical } else { sw[data_offset] = Math.max(MATRIX_MIN_CUTOFF,step_diag); btrack[data_offset] = 0; // 0 = diagonal } } else { // step_down <= step_right if ( step_right > step_diag ) { sw[data_offset] = Math.max(MATRIX_MIN_CUTOFF,step_right); btrack[data_offset] = -ki; // negative = horizontal } else { sw[data_offset] = Math.max(MATRIX_MIN_CUTOFF,step_diag); btrack[data_offset] = 0; // 0 = diagonal } } // sw[data_offset] = Math.max(0, Math.max(step_diag,Math.max(step_down,step_right))); } // IMPORTANT, IMPORTANT, IMPORTANT: // note that we update this (secondary) outer loop variable here, // so that we DO NOT need to update it // in the for() statement itself. row_offset_1 = row_offset; } // print(sw,a,b); } private void calculateCigar(int n, int m, double [] sw, int [] btrack) { // p holds the position we start backtracking from; we will be assembling a cigar in the backwards order //PrimitivePair.Int p = new PrimitivePair.Int(); int p1 = 0, p2 = 0; double maxscore = 0.0; int segment_length = 0; // length of the segment (continuous matches, insertions or deletions) // look for largest score. we use >= combined with the traversal direction // to ensure that if two scores are equal, the one closer to diagonal gets picked for ( int i = 1, data_offset = m+1+m ; i < n+1 ; i++, data_offset += (m+1) ) { // data_offset is the offset of [i][m] if ( sw[data_offset] >= maxscore ) { p1 = i; p2 = m ; maxscore = sw[data_offset]; } } for ( int j = 1, data_offset = n*(m+1)+1 ; j < m+1 ; j++, data_offset++ ) { // data_offset is the offset of [n][j] if ( sw[data_offset] > maxscore || sw[data_offset] == maxscore && Math.abs(n-j) < Math.abs(p1 - p2)) { p1 = n; p2 = j ; // maxscore = sw[n][j]; maxscore = sw[data_offset]; segment_length = m - j ; // end of sequence 2 is overhanging; we will just record it as 'M' segment } } // System.out.println(" Found max score="+maxscore+" at p1="+p1+ " p2="+p2); // we will be placing all insertions and deletions into sequence b, so the states are named w/regard // to that sequence int state = MSTATE; List lce = new ArrayList(5); int data_offset = p1*(m+1)+p2; // offset of element [p1][p2] // System.out.println("Backtracking: starts at "+p1+":"+p2+" ("+sw[data_offset]+")"); do { // int btr = btrack[p1][p2]; int btr = btrack[data_offset]; int new_state; int step_length = 1; // System.out.print(" backtrack value: "+btr); if ( btr > 0 ) { new_state = DSTATE; step_length = btr; } else if ( btr < 0 ) { new_state = ISTATE; step_length = (-btr); } else new_state = MSTATE; // and step_length =1, already set above // move to next best location in the sw matrix: switch( new_state ) { case MSTATE: data_offset -= (m+2); p1--; p2--; break; // move back along the diag in th esw matrix case ISTATE: data_offset -= step_length; p2 -= step_length; break; // move left case DSTATE: data_offset -= (m+1)*step_length; p1 -= step_length; break; // move up } // System.out.println("; backtracked to p1="+p1+" p2="+p2); /* switch( new_state ) { case MSTATE: System.out.println(" diag (match) to "+ sw[data_offset]); break; // equivalent to p1--; p2-- case ISTATE: System.out.println(" left (insertion, "+step_length+") to "+ sw[data_offset]); break; // equivalent to p2-=step_length; case DSTATE: System.out.println(" up (deletion, "+step_length+") to "+ sw[data_offset]); break; // equivalent to p1 -= step_up } */ // now let's see if the state actually changed: if ( new_state == state ) segment_length+=step_length; else { // System.out.println(" emitting "+segment_length+makeElement(state,segment_length).getOperator().toString()); // state changed, lets emit previous segment, whatever it was (Insertion Deletion, or (Mis)Match). lce.add(makeElement(state, segment_length)); segment_length = step_length; state = new_state; } // next condition is equivalent to while ( sw[p1][p2] != 0 ) (with modified p1 and/or p2: } while ( p1 > 0 && p2 > 0 ); // post-process the last segment we are still keeping; // NOTE: if reads "overhangs" the ref on the left (i.e. if p2>0) we are counting // those extra bases sticking out of the ref into the first cigar element. For instance, // if read length is 5 and alignment starts at offset -2 (i.e. read starts before the ref, and only // last 3 bases of the read overlap with/align to the ref), the cigar will be still 5M (and not, e.g. // 2I3M). The consumers need to check for the alignment offset and deal with it properly. lce.add(makeElement(state, segment_length + p2)); alignment_offset = p1 - p2; Collections.reverse(lce); alignmentCigar = new Cigar(lce); } private CigarElement makeElement(int state, int segment_length) { CigarOperator o = null; switch(state) { case MSTATE: o = CigarOperator.M; break; case ISTATE: o = CigarOperator.I; break; case DSTATE: o = CigarOperator.D; break; } return new CigarElement(segment_length,o); } private double wd(byte x, byte y) { return (x == y ? w_match : w_mismatch); } private double wk(int k) { return w_open+(k-1)*w_extend; // gap } private void print(int[][] s) { for ( int i = 0 ; i < s.length ; i++) { for ( int j = 0; j < s[i].length ; j++ ) { System.out.printf(" %4d",s[i][j]); } System.out.println(); } } private void print(double[][] s) { for ( int i = 0 ; i < s.length ; i++) { for ( int j = 0; j < s[i].length ; j++ ) { System.out.printf(" %4g",s[i][j]); } System.out.println(); } } private void print(int[][] s, String a, String b) { System.out.print(" "); for ( int j = 1 ; j < s[0].length ; j++) System.out.printf(" %4c",b.charAt(j-1)) ; System.out.println(); for ( int i = 0 ; i < s.length ; i++) { if ( i > 0 ) System.out.print(a.charAt(i-1)); else System.out.print(' '); System.out.print(" "); for ( int j = 0; j < s[i].length ; j++ ) { System.out.printf(" %4d",s[i][j]); } System.out.println(); } } private void print(double[][] s, String a, String b) { System.out.print(""); for ( int j = 1 ; j < s[0].length ; j++) System.out.printf(" %4c",b.charAt(j-1)) ; System.out.println(); for ( int i = 0 ; i < s.length ; i++) { if ( i > 0 ) System.out.print(a.charAt(i-1)); else System.out.print(' '); System.out.print(" "); for ( int j = 0; j < s[i].length ; j++ ) { System.out.printf(" %2.1f",s[i][j]); } System.out.println(); } } private void print(double[] s, byte[] a, byte[] b) { int n = a.length+1; int m = b.length+1; System.out.print(" "); for ( int j = 1 ; j < m ; j++) System.out.printf(" %5c",(char)b[j-1]) ; System.out.println(); for ( int i = 0, row_offset = 0 ; i < n ; i++, row_offset+=m) { if ( i > 0 ) System.out.print((char)a[i-1]); else System.out.print(' '); System.out.print(" "); for ( int j = 0; j < m ; j++ ) { System.out.printf(" %5.1f",s[row_offset+j]); } System.out.println(); } } static void printAlignment(SWPairwiseAlignment a, byte[] ref, byte[] read) { printAlignment(a,ref,read,100); } static void printAlignment(SWPairwiseAlignment a, byte[] ref, byte[] read, int width) { StringBuilder bread = new StringBuilder(); StringBuilder bref = new StringBuilder(); StringBuilder match = new StringBuilder(); int i = 0; int j = 0; final int offset = a.getAlignmentStart2wrt1(); Cigar cigar = a.getCigar(); if ( offset < 0 ) { for ( ; j < (-offset) ; j++ ) { bread.append((char)read[j]); bref.append(' '); match.append(' '); } // at negative offsets, our cigar's first element carries overhanging bases // that we have just printed above. Tweak the first element to // exclude those bases. Here we create a new list of cigar elements, so the original // list/original cigar are unchanged (they are unmodifiable anyway!) List tweaked = new ArrayList(); tweaked.addAll(cigar.getCigarElements()); tweaked.set(0,new CigarElement(cigar.getCigarElement(0).getLength()+offset, cigar.getCigarElement(0).getOperator())); cigar = new Cigar(tweaked); } else { for ( ; i < a.getAlignmentStart2wrt1() ; i++ ) { bref.append((char)ref[i]); bread.append(' '); match.append(' '); } } for ( CigarElement e : cigar.getCigarElements() ) { switch (e.getOperator()) { case M : for ( int z = 0 ; z < e.getLength() ; z++, i++, j++ ) { bref.append((i= s.length() ) { System.out.println(); return; } int end = Math.min(start+width,s.length()); System.out.println(s.substring(start,end)); } // BELOW: main() method for testing; old implementations of the core methods are commented out below; // uncomment everything through the end of the file if benchmarking of new vs old implementations is needed. public static void main(String argv[]) { // String ref="CACGAGCATATGTGTACATGAATTTGTATTGCACATGTGTTTAATGCGAACACGTGTCATGTGTATGTGTTCACATGCATGTGTGTCT"; // String read = "GCATATGTTTACATGAATTTGTATTGCACATGTGTTTAATGCGAACACGTGTCATGTGTGTGTTCACATGCATGTG"; String ref = null; String read = null; Map> args = processArgs(argv); List l = args.get("SEQ"); args.remove("SEQ"); if ( l == null ) { System.err.println("SEQ argument is missing. Two input sequences must be provided"); System.exit(1); } if ( l.size() != 2 ) { System.err.println("Two input sequences (SEQ arguments) must be provided. Found "+l.size()+" instead"); System.exit(1); } ref = l.get(0); read = l.get(1); Double m = extractSingleDoubleArg("MATCH",args); Double mm = extractSingleDoubleArg("MISMATCH",args); Double open = extractSingleDoubleArg("OPEN",args); Double ext = extractSingleDoubleArg("EXTEND",args); Boolean reverse = extractSingleBooleanArg("REVERSE",args); if ( reverse != null && reverse.booleanValue() == true ) { ref = Utils.reverse(ref); read = Utils.reverse(read); } Boolean print_mat = extractSingleBooleanArg("PRINT_MATRIX",args); Boolean cut = extractSingleBooleanArg("CUTOFF",args); if ( cut != null ) SWPairwiseAlignment.cutoff = cut; if ( args.size() != 0 ) { System.err.println("Unknown argument on the command line: "+args.keySet().iterator().next()); System.exit(1); } double w_match; double w_mismatch; double w_open; double w_extend; w_match = (m == null ? 30.0 : m.doubleValue()); w_mismatch = (mm == null ? -10.0 : mm.doubleValue()); w_open = (open == null ? -10.0 : open.doubleValue()); w_extend = (ext == null ? -2.0 : ext.doubleValue()); SWPairwiseAlignment a = new SWPairwiseAlignment(ref.getBytes(),read.getBytes(),w_match,w_mismatch,w_open,w_extend); System.out.println("start="+a.getAlignmentStart2wrt1()+", cigar="+a.getCigar()+ " length1="+ref.length()+" length2="+read.length()); System.out.println(); printAlignment(a,ref.getBytes(),read.getBytes()); System.out.println(); if ( print_mat != null && print_mat == true ) { a.print(a.SW,ref.getBytes(),read.getBytes()); } } static Pair getArg(String prefix, String argv[], int i) { String arg = null; if ( argv[i].startsWith(prefix) ) { arg = argv[i].substring(prefix.length()); if( arg.length() == 0 ) { i++; if ( i < argv.length ) arg = argv[i]; else { System.err.println("No value found after " + prefix + " argument tag"); System.exit(1); } } i++; } return new Pair(arg,i); } static Map> processArgs(String argv[]) { Map> args = new HashMap>(); for ( int i = 0; i < argv.length ; i++ ) { String arg = argv[i]; int pos = arg.indexOf('='); if ( pos < 0 ) { System.err.println("Argument "+arg+" is not of the form ="); System.exit(1); } String val = arg.substring(pos+1); if ( val.length() == 0 ) { // there was a space between '=' and the value i++; if ( i < argv.length ) val = argv[i]; else { System.err.println("No value found after " + arg + " argument tag"); System.exit(1); } } arg = arg.substring(0,pos); List l = args.get(arg); if ( l == null ) { l = new ArrayList(); args.put(arg,l); } l.add(val); } return args; } static Double extractSingleDoubleArg(String argname, Map> args) { List l = args.get(argname); args.remove(argname); if ( l == null ) return null; if ( l.size() > 1 ) { System.err.println("Only one "+argname+" argument is allowed"); System.exit(1); } double d=0; try { d = Double.parseDouble(l.get(0)); } catch ( NumberFormatException e) { System.err.println("Can not parse value provided for "+argname+" argument ("+l.get(0)+")"); System.exit(1); } System.out.println("Argument "+argname+" set to "+d); return new Double(d); } static Boolean extractSingleBooleanArg(String argname, Map> args) { List l = args.get(argname); args.remove(argname); if ( l == null ) return null; if ( l.size() > 1 ) { System.err.println("Only one "+argname+" argument is allowed"); System.exit(1); } if ( l.get(0).equals("true") ) return new Boolean(true); if ( l.get(0).equals("false") ) return new Boolean(false); System.err.println("Can not parse value provided for "+argname+" argument ("+l.get(0)+"); true/false are allowed"); System.exit(1); return null; } /* ############################################## public SWPairwiseAlignment(byte[] seq1, byte[] seq2, double match, double mismatch, double open, double extend, boolean runOld ) { w_match = match; w_mismatch = mismatch; w_open = open; w_extend = extend; if ( runOld ) align_old(seq1,seq2); else align(seq1,seq2); } public SWPairwiseAlignment(byte[] seq1, byte[] seq2, boolean runOld) { this(seq1,seq2,1.0,-1.0/3.0,-1.0-1.0/3.0,-1.0/3.0,runOld); // match=1, mismatch = -1/3, gap=-(1+k/3) } public void align_old(final byte[] a, final byte[] b) { final int n = a.length; final int m = b.length; double [] sw = new double[(n+1)*(m+1)]; int [] btrack = new int[(n+1)*(m+1)]; calculateMatrix_old(a, b, sw, btrack); calculateCigar(n, m, sw, btrack); // length of the segment (continuous matches, insertions or deletions) } private void calculateMatrix_old(final byte[] a, final byte[] b, double [] sw, int [] btrack ) { final int n = a.length+1; final int m = b.length+1; // build smith-waterman matrix and keep backtrack info: for ( int i = 1, row_offset_1 = 0 ; i < n ; i++ ) { // we do NOT update row_offset_1 here, see comment at the end of this outer loop byte a_base = a[i-1]; // letter in a at the current pos final int row_offset = row_offset_1 + m; // On the entrance into the loop, row_offset_1 is the (linear) offset // of the first element of row (i-1) and row_offset is the linear offset of the // start of row i for ( int j = 1, data_offset_1 = row_offset_1 ; j < m ; j++, data_offset_1++ ) { // data_offset_1 is linearized offset of element [i-1][j-1] final byte b_base = b[j-1]; // letter in b at the current pos // in other words, step_diag = sw[i-1][j-1] + wd(a_base,b_base); double step_diag = sw[data_offset_1] + wd(a_base,b_base); int kd = 0; double step_down = 0; for ( int k = 1, data_offset_k = data_offset_1+1 ; k < i ; k++, data_offset_k -= m ) { // data_offset_k is linearized offset of element [i-k][j] // in other words, trial = sw[i-k][j]+gap_penalty: final double trial = sw[data_offset_k]+wk(k); if ( step_down < trial ) { step_down=trial; kd = k; } } int ki = 0; // optimized "traversal" of all the matrix cells to the left of the current one (i.e. traversing // all 'step right' events that would end in the current cell. The optimized code // does exactly the same thing as the commented out loop below. IMPORTANT: // the optimization works ONLY for linear w(k)=wopen+(k-1)*wextend!!!! double step_right = 0; for ( int k = 1, data_offset = row_offset+j-1 ; k < j ; k++, data_offset-- ) { // data_offset is linearized offset of element [i][j-k] // in other words, step_right=sw[i][j-k]+gap_penalty; final double trial = sw[data_offset]+wk(k); if ( step_right < trial ) { step_right=trial; ki = k; } } final int data_offset = row_offset + j; // linearized offset of element [i][j] if ( step_down > step_right ) { if ( step_down > step_diag ) { sw[data_offset] = Math.max(0,step_down); btrack[data_offset] = kd ; // positive=vertical } else { sw[data_offset] = Math.max(0,step_diag); btrack[data_offset] = 0; // 0 = diagonal } } else { // step_down <= step_right if ( step_right > step_diag ) { sw[data_offset] = Math.max(0,step_right); btrack[data_offset] = -ki; // negative = horizontal } else { sw[data_offset] = Math.max(0,step_diag); btrack[data_offset] = 0; // 0 = diagonal } } // sw[data_offset] = Math.max(0, Math.max(step_diag,Math.max(step_down,step_right))); } // IMPORTANT, IMPORTANT, IMPORTANT: // note that we update this (secondary) outer loop variable here, // so that we DO NOT need to update it // in the for() statement itself. row_offset_1 = row_offset; } // print(sw,a,b); } ##################### END COMMENTED OUT SECTION */ }