package org.broadinstitute.sting.playground.indels; import net.sf.samtools.*; import java.util.*; import org.broadinstitute.sting.utils.PrimitivePair; import org.broadinstitute.sting.playground.utils.CountedObject; import org.broadinstitute.sting.playground.utils.CountedObjectComparatorAdapter; public class PileBuilder implements RecordPileReceiver { private SymmetricMatrix distances ; private Matrix alignments ; private static final int KmerSize = 8; private MultipleAlignment alignments1; private MultipleAlignment alignments2; private String referenceSequence; private int reference_start; private static class SelectedPair { private int i_; private int j_; private double d_; private SelectedPair(int i, int j, double d) { set(i,j,d); } private SelectedPair() { set(-1,-1,1e100); } private double d() { return d_; } private int i() { return i_; } private int j() { return j_; } private void set(int i, int j, double d) { i_ = i; j_ = j; d_ = d; } /** Returns true if any of the two indices kept by this pair is equal to i. * * @param i * @return */ private boolean contains(int i) { return ( ( i_ == i ) || ( j_ == i ) ); } } public class SelectedSequence { private int id_; private double d_; private SelectedSequence(int i, double d) { set(i,d); } private SelectedSequence() { this(-1,1e100) ; } private void set(int i, double d) { id_ = i; d_ = d; } public double d() { return d_;} public int i() { return id_; } } public PileBuilder() { referenceSequence = null; reference_start = -1; } public void setReferenceSequence(String seq, int start) { referenceSequence = seq; reference_start = start; } public void setReferenceSequence(String seq) { referenceSequence = seq; reference_start = -1; } public void receive(Collection c) { IndexedSequence[] seqs = new IndexedSequence[c.size()]; int i = 0; int startOnRef = 1000000000; // absolute start (leftmost) position of the pile of reads on the ref int stopOnRef = 0; // absolute stop (rightmost) position of the pile of reads on the ref (rightmost alignment end) for ( SAMRecord r : c ) { seqs[i++] = new IndexedSequence(r.getReadString(),KmerSize); startOnRef = Math.min(startOnRef, r.getAlignmentStart() ); stopOnRef = Math.max(stopOnRef,r.getAlignmentEnd()); } // part of the reference covered by original alignments: String pileRef = referenceSequence.substring(startOnRef-1,stopOnRef); int totalMismatches = 0; // total mismatches across all reads TreeSet< CountedObject > all_indels = new TreeSet< CountedObject >( new CountedObjectComparatorAdapter(new IntervalComparator())); SequencePile originalAligns = new SequencePile(pileRef); for ( SAMRecord r : c ) { originalAligns.addAlignedSequence(r.getReadString(), r.getReadNegativeStrandFlag(), r.getCigar(), r.getAlignmentStart() - startOnRef ); totalMismatches += AlignmentUtils.numMismatches(r,referenceSequence); AlignmentUtils.collectAndCountIndels(r,all_indels); } System.out.println("\n#############################################################################"); System.out.println("ORIGINAL ALIGNMENT: \n"); originalAligns.dotprint(true); System.out.println("\n+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++") ; List piles = doMultipleAlignment2(seqs); // System.out.print("Distance between final piles: "+distance(alignments1, alignments2)); // System.out.print("; diameter of PILE1: "+ diameter(alignments1)); // System.out.println("; diameter of PILE2: "+ diameter(alignments2)); SymmetricMatrix d = new SymmetricMatrix(piles.size()); for ( int n = 0 ; n < piles.size() ; n++ ) { d.set(n,n,diameter(piles.get(n))); for ( int m = n+1 ; m < piles.size() ; m++ ) { d.set(n,m,distance(piles.get(n), piles.get(m))); } } int new_mismatches = 0 ; // number of mismatches after re-alignment: TreeSet< CountedObject > new_indels = new TreeSet< CountedObject >( new CountedObjectComparatorAdapter(new IntervalComparator()) ); // new indels after realignment int shifted_reads = 0; int smashed_reads = 0; List as_list = (List)c; // ugly hack; need this to access records by ids System.out.println(d.format("%8.4g")); for ( int n = 0 ; n < piles.size() ; n++ ) { // SWPairwiseAlignment consToRef = new SWPairwiseAlignment(pileRef,piles.get(n).getConsensus(),2.0,-10.0,-2.0,-1.0); SWPairwiseAlignment consToRef = new SWPairwiseAlignment(pileRef,piles.get(n).getConsensus(),3.0,-1.0,-4.0,-0.5); System.out.println("PILE " + n + " to REF ("+ (consToRef.getCigar().numCigarElements()-1)/2 +" indels):"); System.out.println(consToRef.toString()); System.out.println("PILE " + n +" (READS):\n" +piles.get(n).toString()); MultipleAlignment ma = piles.get(n); for ( Integer id : ma ) { SAMRecord r = as_list.get(id); int cons_offset = ma.getOffsetWrtConsensus(id); // offset of the read 'id' wrt multiple alignment's full consensus seq int ref_offset = cons_offset + startOnRef + consToRef.getAlignmentStart2wrt1(); if ( ref_offset != r.getAlignmentStart()) shifted_reads++; Cigar cig = buildCigar(cons_offset, r.getReadLength(), consToRef.getCigar()); if ( cig.numCigarElements() != r.getCigar().numCigarElements() ) smashed_reads++; SAMRecord rtest = new SAMRecord(r.getHeader()); rtest.setAlignmentStart(ref_offset); rtest.setReadString(r.getReadString()); rtest.setReadUmappedFlag(r.getReadUnmappedFlag()); rtest.setCigar(cig); AlignmentUtils.collectAndCountIndels(rtest,new_indels); new_mismatches += AlignmentUtils.numMismatches(rtest,referenceSequence); } } int discovered_indels = 0; int discovered_support = 0; int existing_indels = 0; int existing_support = 0; int existing_support_new = 0; int discarded_indels = 0; for ( CountedObject ind : new_indels ) { if ( ! all_indels.contains(ind) ) { discovered_indels++; discovered_support += ind.getCount(); } else { existing_indels++; existing_support_new += ind.getCount(); } } for ( CountedObject ind : all_indels ) { if ( ! new_indels.contains(ind )) { discarded_indels++; } else { existing_support += ind.getCount(); } } System.out.print("TOTAL MISMATCHES: "+totalMismatches +" --> "+new_mismatches); if ( totalMismatches > new_mismatches ) System.out.print("(-"); else System.out.print("(+"); System.out.println(Math.abs((new_mismatches - totalMismatches)*100.0/totalMismatches)+"%)"); System.out.println("CONFIRMED INDELS: "+existing_indels); System.out.print("CONFIRMED INDEL SUPPORT: "+existing_support + " --> " + existing_support_new ); if ( existing_support > existing_support_new ) System.out.print("(-"); else System.out.print("(+"); System.out.println(Math.abs((existing_support- existing_support_new)*100.0/existing_support)+"%)"); System.out.println("DROPPED INDELS: " + discarded_indels); System.out.println("DISCOVERED INDELS: " + discovered_indels) ; System.out.println("DISCOVERED INDELS SUPPORT: "+discovered_support); System.out.println("ALIGNMENTS SHIFTED: "+shifted_reads); System.out.println("ALIGNMENTS WITH GAPS CHANGED: "+smashed_reads); } /** Assuming that a read of length l has a gapless, fully consumed align starting at s (ZERO-based) to some sequence X, * and that sequence's alignment to some reference Y is described by baseCigar, builds a cigar for the direct * alignment of the read to Y (i.e. if the alignment of X to Y contains indel(s) and the read spans them, the * indels will be inserted into the new cigar for read-Y alignment). * @param s * @param l * @param baseCigar * @return */ private Cigar buildCigar(int s, int l, Cigar baseCigar) { int refpos = 0; List lce = new ArrayList(5); // enough to keep 2 indels. should cover 99.999% of cases... CigarElement celem = null; int i = 0; while ( refpos <= s ) { celem = baseCigar.getCigarElement(i); refpos+=celem.getLength(); i++; } // we now sit on cigar element that contains start s, and refpos points to the end of that element; i points to next element lce.add( new CigarElement(Math.min(refpos-s,l),celem.getOperator()) ); while ( refpos < s+l ) { celem = baseCigar.getCigarElement(i); // System.out.print("ref="+refpos+",s+l="+(s+l)+"len="+celem.getLength()+":"); lce.add( new CigarElement(Math.min(celem.getLength(),l + s - refpos), celem.getOperator()) ); if ( celem.getOperator() != CigarOperator.D ) refpos += celem.getLength(); i++; } return new Cigar(lce); } public void initPairwiseAlignments( IndexedSequence [] seqs ) { distances = new SymmetricMatrix( seqs.length ); alignments = new Matrix( seqs.length ); for( int i = 0; i < seqs.length ; i++ ) { for ( int j = i+1 ; j < seqs.length ; j++ ) { PairwiseAlignment a = new PairwiseAlignment(seqs[i],seqs[j],i,j); // compute pairwise alignment alignments.set(i, j, a); // save it alignments.set(j, i, a); // save it distances.set(i,j,a.distance()); } } } /** Finds the best pairwise alignment across all available ones. The object must be initialized first, * so that the alignments are pre-computed. * @return id's of the two sequences and the distance between them in a compound object. */ public SelectedPair findClosestPair() { SelectedPair p = new SelectedPair(-1,-1,1e100); for( int i = 0; i < distances.size() ; i++ ) { for ( int j = i+1 ; j < distances.size() ; j++ ) { double d = distances.get(i,j); if ( d < p.d() ) p.set(i,j,d); } } return p; } /** Finds the worst pairwise alignment across all available ones. The object must be initialized first, * so that the alignments are pre-computed. * @return id's of the two sequences and the distance between them in a compound object. */ public SelectedPair findWorst() { SelectedPair p = new SelectedPair(-1,-1,-1.0); for( int i = 0; i < distances.size() ; i++ ) { for ( int j = i+1 ; j < distances.size() ; j++ ) { double d = distances.get(i,j); if ( d > p.d() ) p.set(i,j,d); } } return p; } /** Finds the best pairwise alignment across all available ones, subject to the constraint that neither * of the two sequences found can be listed (by its id) in the supplied SelectedPair object. If the best pair is passed * as an argument, this method will find the next best pair. * * @param pexclude neither of the two sequences in the returned pair can have its id listed in pexclude pair. * @return Best pairwise alignment excluding alignments between pairs involving at least one sequence from pexclude */ public SelectedPair findNextClosestPairAfter(SelectedPair pexclude) { SelectedPair p = new SelectedPair(-1,-1,1e100); for( int i = 0; i < distances.size() ; i++ ) { if ( pexclude.contains(i) ) continue; for ( int j = i+1 ; j < distances.size() ; j++ ) { if ( pexclude.contains(j)) continue; double d = distances.get(i,j); if ( d < p.d() ) p.set(i,j,d); } } return p; } /** Finds the closest sequence to the specified pile among all sequences, which are not yet in that pile. Being * the 'closest' is defined in terms of minimum distance. * * @param a alignment pile to find the closest sequence for * @return a compound SelectedPair object that contains the index of the closest sequence found (is guaranteed to * be not in the pile), the index of the sequence in the pile it is closest to, and the actual distance between the two. */ public SelectedPair findClosestToPile(MultipleAlignment a) { SelectedPair p = new SelectedPair(-1,-1,1e100); for ( Integer id : a ) { for (int i = 0; i < distances.size(); i++) { if (a.contains(i)) continue; // a already contains both sequences (i,id) double d = distances.get(i, id); if (d < p.d() ) p.set(i,id,d); } } return p; } public SelectedPair findClosestToPileAverage(MultipleAlignment a) { SelectedPair p = new SelectedPair(-1,-1,1e100); // currently, we compute the average distance from each sequence to the pile, but if the average // distance is small enough, we will try to stitch that sequence to the pile based on the *best* // available pairwise alignment, best_id will keep the id of that sequence from the pile that // has the best alignment with the sequence that is the closest on average int best_id=-1; Set offsets = new HashSet(); // all putative offsets suggested by different p-wise alignments for ( int i = 0 ; i < distances.size() ; i++ ) { // for each sequence i if ( a.contains(i) ) continue; // sequence i is already in the pile, ignore it offsets.clear(); for ( Integer id : a ) { // for all sequences from the msa pile PairwiseAlignment pa = alignments.get(i,id); if ( pa.getOverlap() <= 0 ) continue; // at this step we do not take into account sequences with no overlap // alignment pa suggests this offset of i wrt the first sequence in the msa offsets.add( pa.getBestOffset2wrt1(id,i)+a.getOffsetById(id)); } // we got all suggested offsets; now lets recompute distances: for( Integer off : offsets ) { SelectedPair spo = averageDistanceForOffset(a,i,off); if ( spo.d() < p.d() ) p.set(spo.i(),spo.j(),spo.d()); } } return p; } public Matrix averageClosestDistanceMatrix(List la, int n) { Matrix mp = new Matrix(n); for ( int i = 0 ; i < n ; i++ ) { for ( int j = i + 1 ; j < n ; j++ ) { mp.set(i,j, findBestAlignment(la.get(i),la.get(j)) ); mp.set(j,i, mp.get(i,j) ); } } return mp; } public SelectedPair findBestAlignment(MultipleAlignment a1, MultipleAlignment a2) { Map all_offsets = new HashMap(); SelectedPair p = new SelectedPair(-1,-1,1e100); for ( Integer id1 : a1 ) { for ( Integer id2 : a2 ) { PairwiseAlignment pa = alignments.get(id1,id2); if ( pa.getOverlap() <= 0 ) continue; // id1 and id2 do not overlap and/or we don't have p-wise alignment // record suggested offset of a2 wrt a1 (defined by their first sequences), and remember the // pairwise alignment that suggested it int suggested_offset = a1.getOffsetById(id1) + pa.getBestOffset2wrt1(id1,id2) - a2.getOffsetById(id2); if ( ! all_offsets.containsKey(suggested_offset) ) { all_offsets.put( suggested_offset , new PrimitivePair.Int(id1,id2)) ; } } } for ( Map.Entry offset_record : all_offsets.entrySet() ) { double d = averageDistanceForOffset(a1,a2,offset_record.getKey()); if ( d < p.d() ) p.set(offset_record.getValue().first,offset_record.getValue().second,d); } return p; } public double averageDistanceForOffset(MultipleAlignment a1, MultipleAlignment a2, int offset) { SelectedPair p = new SelectedPair(); double d_av = 0; int nseq = 0; int i1 = -1; int i2 = -1; for ( Integer id2 : a2 ) { SelectedPair spo = averageDistanceForOffset(a1,id2,offset+a2.getOffsetById(id2)); if ( spo.d() > 1e99 ) continue; nseq++; d_av += spo.d(); } if ( nseq == 0 ) return 1e100; d_av /= nseq; return d_av; } /** Computes average distance from sequence i to multiple alignment a for the specified offset of 'i' wrt 'a' * and returns that distance and pair of sequence indices, on which the specified offset is realized * @param a * @param i * @param offset * @return */ public SelectedPair averageDistanceForOffset(MultipleAlignment a, int i, int offset) { SelectedPair p = new SelectedPair(-1,-1,1e100); double d = 0; // will hold average distance double dmin = 1e100; // used to find the nearest individual sequence in the pile int nseq = 0; // number of sequences in the pile that have distance to sequence i defined int best_id = -1; for ( Integer id : a ) { // for all sequences from the msa pile PairwiseAlignment pa = alignments.get(i,id); int new_off = offset - a.getOffsetById(id); // offset of i wrt id as suggested by double dist_for_off; // distance between i and id for the given offset off // check if p-wise alignment has data for the specified offset: boolean canuse = false; if ( pa.alignmentExists() && pa.getBestOffset2wrt1(id,i) == new_off ) { dist_for_off = distances.get(i,id); canuse = true; // can use this alignment to stitch i to a } else { // offset is different from what the pwise alignment suggests; recompute! dist_for_off = PairwiseAlignment.distance(pa.getSequenceById(id),pa.getSequenceById(i),new_off); } if ( dist_for_off > 1e99 ) continue; // at this offset, i and id do not overlap, go check next id d += dist_for_off; nseq++; if ( dist_for_off < dmin && canuse ) { dmin = dist_for_off; best_id = id; } } if ( nseq == 0 ) return p; d /= (double)nseq; p.set(i,best_id,d); return p; } /** Finds, among all sequences, the one farthest from the specified pile. Being * the 'farthest' is defined as having the largest lower bound of the distances to all sequences in the pile. * * @param a alignment pile to find the closest sequence for * @return index of the farthest sequence */ public int findFarthestFromPile(MultipleAlignment a) { double dmaxmin = 0; int i_out = -1; for ( int i = 0 ; i < distances.size() ; i++ ) { if ( a.contains(i) ) continue; double d_min = 1e100; // smallest distance from sequence i to the pile for ( Integer id : a ) { double d = distances.get(i, id) ; if (d < d_min ) d_min = d; } // d_min is the smallest distance from sequence i to pile a if ( d_min > dmaxmin ) { // sequence i is so far the farthest... dmaxmin = d_min; i_out = i; } } return i_out; } public double distance(MultipleAlignment a1, MultipleAlignment a2) { double d = 1e100; for ( Integer id1 : a1 ) { for ( Integer id2 : a2 ) { if ( distances.get(id1,id2) < d ) d = distances.get(id1,id2); } } return d; } /** Computes the distances from each sequence in the pile to its closest * neighbor (within the same pile), and returns the greatest among these distances. * In other words, no sequence in the pile is farther than diameter() from its closest neighbor. * @param a alignment pile to compute diameter for * @return the greatest distance from a sequence to its closest neighbor within the pile */ public double diameter(MultipleAlignment a) { double dmaxmin = 0.0; System.out.print("\n["); Iterator ids1 = a.sequenceIdByOffsetIterator(); while ( ids1.hasNext() ) { Integer id1 = ids1.next(); double d = 1e100; // will hold distance from id1 to its closest neighbor for ( Integer id2 : a ) { if ( id2 == id1 ) continue; double dpair = distances.get(id1,id2) ; d = Math.min(d,dpair); } // d = distance from id1 to its closest neighbor within the pile if ( d < 1e99 ) System.out.printf("%8.4g",d); if ( d < 1e99 && d > dmaxmin ) dmaxmin = d; } System.out.println(" ]"); // dmaxmin = the largest distance from a sequence in this pile to its closest neighbor // System.out.println(); return dmaxmin; } public static void main(String argv[]) { int K=8; // IndexedSequence [] seqs = testSet1(K); // initialize test set data // IndexedSequence [] seqs = testSet2(K); // initialize test set data // IndexedSequence [] seqs = testSet3(K); // initialize test set data IndexedSequence [] seqs = testSet4(K); // initialize test set data PileBuilder pb = new PileBuilder(); //pb.doMultipleAlignment(seqs); pb.doMultipleAlignment2(seqs); System.out.print("Distance between final piles: "+pb.distance(pb.alignments1, pb.alignments2)); System.out.print("; diameter of PILE1: "+ pb.diameter(pb.alignments1)); System.out.println("; diameter of PILE2: "+ pb.diameter(pb.alignments2)); System.out.println("PILE 1: \n"+pb.alignments1.toString()); System.out.println("PILE 2: \n"+pb.alignments2.toString()); } public void doMultipleAlignment(IndexedSequence[] seqs) { // two piles we are going to grow until all sequences are assigned to one of them. // we intend to keep the piles disjoint, e.g. no sequence should be placed in both MultipleAlignment pile1 = new MultipleAlignment(); MultipleAlignment pile2 = new MultipleAlignment(); initPairwiseAlignments(seqs); // all the pairwise alignments are computed and disjoint best and next-best pairs are found // System.out.println( distances.format("%8.4g ")); SelectedPair pworst = findWorst(); pile1.add(seqs[pworst.i()].getSequence(), pworst.i()); pile2.add(seqs[pworst.j()].getSequence(), pworst.j()); // initialize piles with best and next-best pairs /* SelectedPair p_best = findClosestPair(); SelectedPair p_nextbest = findNextClosestPairAfter(p_best); pile1.add( alignments.get(p_best.i(), p_best.j())); pile2.add( alignments.get(p_nextbest.i(), p_nextbest.j())); */ /* System.out.println("Best pair ("+p_best.i() + "," + p_best.j()+", d="+p_best.d()+"):"); System.out.println(pile1.toString()); System.out.println("Next best pair ("+p_nextbest.i() + "," + p_nextbest.j()+", d="+p_nextbest.d()+ "):"); System.out.println(pile2.toString()); */ SelectedPair p1 = null; SelectedPair p2 = null; // grow piles hierarchical clustering-style while ( pile1.size() + pile2.size() < seqs.length ) { // find candidate sequences closest to each of the two piles // p1 = findClosestToPileAverage(pile1); // findClosestToPile(pile1); // p2 = findClosestToPileAverage(pile2); //findClosestToPile(pile2); p1 = findClosestToPile(pile1); // findClosestToPile(pile1); p2 = findClosestToPile(pile2); //findClosestToPile(pile2); int id1_cand = pile1.selectExternal(p1.i(), p1.j()); // id of the sequence closest to the pile 1 int id2_cand = pile2.selectExternal(p2.i(), p2.j()); // id of the sequence closest to the pile 2 if ( pile2.contains(id1_cand) && pile1.contains(id2_cand)) { // pile1 and pile 2 are mutually the closest, so we need to merge them. // if piles are mutually the closest, then p1 and p2 are the same pair (id1, id2), // so we just merge on one of the (redundant) instances: pile1.add(pile2, alignments.get( p1.i(), p1.j())); pile2.clear(); // need to reset pile 2 to something else int z = findFarthestFromPile(pile1); // get sequence farthest from merged pile 1 pile2.add(seqs[z].getSequence(), z); // and reinitialize pile 2 with that sequence } else { if ( p1.d() < p2.d() ) { if ( pile2.contains(id1_cand) ) { pile1.add(pile2, alignments.get( p1.i(), p1.j())); pile2.clear(); // need to reset pile 2 to something else int z = findFarthestFromPile(pile1); // get sequence farthest from merged pile 1 pile2.add(seqs[z].getSequence(), z); // and reinitialize pile 2 with that sequence } else pile1.add( alignments.get(p1.i(), p1.j()) ); } else { if ( pile1.contains(id2_cand) ) { pile2.add(pile1, alignments.get( p2.i(), p2.j())); pile1.clear(); // need to reset pile 2 to something else int z = findFarthestFromPile(pile2); // get sequence farthest from merged pile 1 pile1.add(seqs[z].getSequence(), z); // and reinitialize pile 2 with that sequence } else pile2.add( alignments.get(p2.i(), p2.j()) ); } } System.out.println("PILE 1: \n"+pile1.toString()); System.out.println("PILE 2: \n"+pile2.toString()); } // end WHILE alignments1 = pile1; alignments2 = pile2; /* * System.out.println("Closest distance to the pile: " + best_d + "(adding: " + best_i + "," + best_j + "):"); System.out.println(pile.toString()); } */ } public List doMultipleAlignment2(IndexedSequence[] seqs) { initPairwiseAlignments(seqs); List piles = new LinkedList(); int npiles = seqs.length; for ( int i = 0 ; i < seqs.length ; i++ ) { MultipleAlignment m = new MultipleAlignment(); m.add(seqs[i].getSequence(),i); piles.add(m); } while ( npiles > 2 ) { Matrix dist = averageClosestDistanceMatrix(piles,npiles); int best_i = -1; int best_j = -1; int pile_i = -1; int pile_j = -1; double d = 1e100; for ( int i = 0 ; i < npiles ; i++ ) { for ( int j = i+1 ; j < npiles ; j++ ) { SelectedPair p = dist.get(i,j); if ( p.d() < d ) { d = p.d(); pile_i = i; pile_j = j; best_i = p.i(); best_j = p.j(); } } } // System.out.println("joining pile "+pile_i +" and pile " + pile_j +" on seqs " + best_i +" and " + best_j ); // got the closest pair piles.get(pile_i).add(piles.get(pile_j),alignments.get(best_i,best_j)); // System.out.println("JOINED PILE: \n"+piles.get(pile_i).toString()); piles.remove(pile_j); npiles--; } alignments1 = piles.get(0); alignments2 = piles.get(1); // System.out.println("PILE 1: \n"+piles.get(0).toString()); // System.out.println("PILE 2: \n"+piles.get(1).toString()); return piles; } public static IndexedSequence[] testSet1(int K) { IndexedSequence [] seqs = new IndexedSequence[9]; seqs[0] = new IndexedSequence("CAAAAAAAGCAAAACTCTGAAGAAAGAGAGAGAGAGGGAGAGAGGGAGAGAGAAAGGGAGAGACGATGAGAGACAG",K); seqs[1] = new IndexedSequence("GCAAAACTCTGAAGAAAGAGAGAGAGAGGGAGAGAGGGAGAGAGAAAGGAAGAGACGAT",K); seqs[2] = new IndexedSequence("AACTCTGAAGAAAGAGAGAGAGAGGGAGAGAGGGAGAGAGAAAGGAAGAGACGATGAGA",K); seqs[3] = new IndexedSequence("GAGAGGGAGAGAGAAAGGAAGAGACGATGAGAGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAAC",K); seqs[4] = new IndexedSequence("ACGATGAGAGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATCGAGCAGGAAAA",K); seqs[5] = new IndexedSequence("GAGAGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATCGAGCAGGAACCTTGGA",K); seqs[6] = new IndexedSequence("TGAGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATC",K); seqs[7] = new IndexedSequence("AGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATCGAGCAGGAACCTTGGAGGA",K); seqs[8] = new IndexedSequence("AGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATCGAGCAGGAACCTTGGAGGA",K); return seqs; } public static IndexedSequence[] testSet2(int K) { IndexedSequence [] seqs = new IndexedSequence[11]; seqs[0] = new IndexedSequence("TGCAATGAGATGAGATCGTGCCTCTGCACTCCAGCCTGGGCGACAGAGTGAGAGACCCTGTCTCAAAAACACAAAA",K); seqs[1] = new IndexedSequence("AATGAGATGAGATCGTGCCTCTGCACTCCAGCCTGGGCGACAGAGTGAGAGACCCTGTCTCAAAAACACAAAAACA",K); seqs[2] = new IndexedSequence("CCTCTGCACTCCAGCCTGGGCGACAGAGTGAGAGACCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACA",K); seqs[3] = new IndexedSequence("CAGAGTGAGAGACCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCT",K); seqs[4] = new IndexedSequence("CAGAGTGAGAGACCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCT",K); seqs[5] = new IndexedSequence("GAGACCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAG",K); seqs[6] = new IndexedSequence("CCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTGTT",K); seqs[7] = new IndexedSequence("CCAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTG",K); seqs[8] = new IndexedSequence("CAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTGTTGTTATCTCTGGGGAGT",K); seqs[9] = new IndexedSequence("AACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTGTTGTTATCTCTGGGTAGTTTGG",K); seqs[10] = new IndexedSequence("ACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTGTTGTTATCTCTGGGTAGCTTGGA",K); return seqs; } public static IndexedSequence[] testSet3(int K) { IndexedSequence [] seqs = new IndexedSequence[11]; seqs[0] = new IndexedSequence("TGGAAATTTATTTCTCAGAGTACTGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGG",K); seqs[1] = new IndexedSequence("TGGAAATTTATTTCTCAAAGTACTGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGG",K); seqs[2] = new IndexedSequence("GGAAATTTATTTCTCAGAGTACTGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGG",K); seqs[3] = new IndexedSequence("GGAAATTTATTTCACAGAGTAATGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGCTTCTAAGTCTGCTGAGGG",K); seqs[4] = new IndexedSequence("ATTTCTCAGAGTACTGGAAGCTGGGAATCCAAGATCGAAATGCCAGCAGATTCTAAGTC",K); seqs[5] = new IndexedSequence("ATTTCTCAGAGTACTGGAAGCTGGGACTCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGTGC",K); seqs[6] = new IndexedSequence("GTACTGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGTGCACTCTCTGCT",K); seqs[7] = new IndexedSequence("AATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGTGCACTCTCTGCTTCATAAATGGGTCTC",K); seqs[8] = new IndexedSequence("CAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGCGCACTCTCTGCTTCATAAATGGGTCTCTTGC",K); seqs[9] = new IndexedSequence("ATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGTGCACTCTCTGCTTCATAAATGGGTCTCTTGCCGCA",K); seqs[10] = new IndexedSequence("GTCTGGTGAGGGTAGGGTGCACTCTCTGCTTCATAAATGGGTCTCTTGCCGCAAAAAAATCTGTTTGCTCCTCCAG",K); return seqs; } public static IndexedSequence[] testSet4(int K) { IndexedSequence [] seqs = new IndexedSequence[19]; seqs[0] = new IndexedSequence("CGTGTGTGTGTGTGCAGTGCGTGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTTTGTGAGATC",K); seqs[1] = new IndexedSequence("ATGTGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCAT",K); seqs[2] = new IndexedSequence("GTGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGC",K); seqs[3] = new IndexedSequence("TGTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCA",K); seqs[4] = new IndexedSequence("GTGTGTGTGCAGTGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCAT",K); seqs[5] = new IndexedSequence("GTGTGTGTGCCGTGCTTTGTGCTGTGAGATCTGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCTGCAT",K); seqs[6] = new IndexedSequence("GTGTGTGCAGTGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCATGT",K); seqs[7] = new IndexedSequence("GTGCAGTGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCATGTGTGT",K); seqs[8] = new IndexedSequence("TGCAGTGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCATGTGTGTG",K); seqs[9] = new IndexedSequence("AGTGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCATGTGTGTGTGT",K); seqs[10] = new IndexedSequence("TGGGCATGGTGCTGTGAGATCAGCGTGTGTGTGTGCAGCGCATGGTGCTGTGTGAGATCAGCGTGTGTGTGTGCAG",K); seqs[11] = new IndexedSequence("GCTGTGAGATCAGCGTGTGTGTGTGAGCAGTGCATGGGGATGTGTGAGATCAGCATGTGTGTGTGTGTGCAGCGCG",K); seqs[12] = new IndexedSequence("GCTGTGAGATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCATGTGTGTGTGTGTGCAGTGCA",K); seqs[13] = new IndexedSequence("AGATCAGCATGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCATGTGTGTGTGTGTGCAGTGCATGGTGC",K); seqs[14] = new IndexedSequence("AGATCAGCGTGTGTGTGTGCAGCGCATGGCGCTGTGTGAGATCAGCATGTGTGTGTGTGTGCGGCGCATGGGGGTG",K); seqs[15] = new IndexedSequence("GATCAGCGTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGAATGTGTGTGTGTGTGCAGTGCATGGTGCT",K); seqs[16] = new IndexedSequence("ATCAGCATGGGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCATGTGTGGGTGTGTGGGGTGGGTGGTGGTG",K); seqs[17] = new IndexedSequence("ATCAGCATGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCATGTGTGTGTGTGTGCAGTGCATGGGGCTG",K); seqs[18] = new IndexedSequence("GTGTGTGTGTGTGCAGTGCATGGTGCTGTGTGAGATCAGCATGTGTGTGTGTGTGCAGTGCATGGTGCTGAGTGTG",K); return seqs; } }