Commit Graph

4741 Commits (e8b42c4dfd7b2ebbdceafd28b0e5af420c77219e)

Author SHA1 Message Date
Joel Thibault ef87b051b0 Rev Picard to 1.107.1683 (4 jars) 2014-02-12 15:25:50 -05:00
David Roazen 6f12c8b0dc Exclude all transitive dependencies in maven package-tests
This change should allow us to test that the GATK jar has been
correctly packaged at release time, by ensuring that only the
packaged jar + a few test-related dependencies are on the classpath
when tests are run.

Note that we still need to actually test that this works as intended
before we can make this live in the Bamboo release plan.
2014-02-12 14:59:05 -05:00
David Roazen 95e1402d21 Add ability to run *KnowledgeBaseTests to maven
Run with: mvn verify -Dsting.knowledgebasetests.skipped=false
2014-02-11 14:08:24 -05:00
Khalid Shakir 1666bb7e3a Patched PluginManager to ignore null classes, that will allow gatkdocs to build successfully when running from the source root directory, due to its hardcoded paths. 2014-02-12 00:48:58 +08:00
Karthik Gururaj 316501b32e Fixed denominator in profiling 2014-02-10 10:11:03 -08:00
Karthik Gururaj d081c19178 Minor: added support in C++ sandbox to choose implementation and check
from command line
2014-02-09 18:05:35 -08:00
Ryan Poplin b81494b704 Merge pull request #499 from broadinstitute/eb_fix_ad_updates
Fixed bug in generating AD values when new alleles are present for genot...
2014-02-09 17:55:00 -05:00
Eric Banks abb67cfa5e Fixed bug in generating AD values when new alleles are present for genotpying GVCFs.
This was a dumb mistake that wasn't well tested (but is now).
2014-02-09 15:15:19 -05:00
Khalid Shakir 12bb6fd361 Removed use of picard private.
Updated picard-maven script to tag locally modified builds with -SNAPSHOT.
Removed old picard jars.
2014-02-09 17:08:52 +08:00
Khalid Shakir 4e0f7521f2 Made scala.maxmemory an argument, and defaulted it to 1g. 2014-02-09 09:24:44 +08:00
Karthik Gururaj a03d83579b Matrices in baseline C++ (no vector) implementation of PairHMM are now
allocated on heap using "new". Stack allocation led to program crashes
for large matrix sizes.
2014-02-07 23:22:05 -08:00
Karthik Gururaj 20a46e4098 Check only for SSE 4.1 (rather than SSE 4.2) when trying to use the SSE
implementation of PairHMM
2014-02-07 15:19:55 -08:00
Eric Banks d689f61005 Fixed up some of the genotype-level annotations being propogated in the single sample HC pipeline.
1. AD values now propogate up (they weren't before).
2. MIN_DP gets transferred over to DP and removed.
3. SB gets removed after FS is calculated.

Also, added a bunch of new integration tests for GenotypeGVCFs.
2014-02-07 12:47:54 -05:00
Eric Banks db68d3fa10 Fixing failing unit tests 2014-02-07 12:24:14 -05:00
Eric Banks 2648219c42 Implementation of a hierarchical merger for gVCFs, called CombineGVCFs.
This tool will take any number of gVCFs and create a merged gVCF (as opposed to
GenotypeGVCFs which produces a standard VCF).

Added unit/integration tests and fixed up GATK docs.
2014-02-07 08:49:18 -05:00
mghodrat 7815c30df8 Adding comments to pairhmm-template-kernel 2014-02-06 20:13:06 -08:00
Karthik Gururaj b729fc0136 1. Split main JNI function into initializeTestcases, compute_testcases
and releaseReads
2. FTZ enabled
3. Cleaner profiling code
2014-02-06 14:35:32 -08:00
Karthik Gururaj 166f91d698 Merge branch 'test_branch'
Conflicts:
	public/c++/VectorPairHMM/LoadTimeInitializer.cc
	public/c++/VectorPairHMM/pairhmm-1-base.cc
	public/c++/VectorPairHMM/utils.cc
	public/c++/VectorPairHMM/utils.h

Merged test_branch with intel_pairhmm
2014-02-06 11:18:18 -08:00
Karthik Gururaj fab6f57e97 1. Enabled FTZ in LoadTimeInitializer.cc
2. Added Sandbox.java for testing
3. Moved compute to utils.cc (inside library)
4. Added flag for disabling FTZ in Makefile
2014-02-06 11:01:33 -08:00
Karthik Gururaj 78642944c0 1. Moved break statement in utils.cc to correct position
2. Tested sandbox with regions
3. Lots of profiling code from previous commit exists
2014-02-06 09:32:56 -08:00
Khalid Shakir b21c35482e Packages link private/testdata, so that mvn test -Dsting.serialunittests.skipped=false works. 2014-02-06 08:25:38 -05:00
Khalid Shakir 3848159086 Added a set of serial tests to gatk/queue packages, which runs all tests under their package in one TestNG execution.
New properties to disable regenerating example resources artifact when each parallel test runs under packagetest.
Moved collection of packagetest parameters from shell scripts into maven profiles.
Fixed necessity of test-utils jar by removing incorrect dependenciesToScan element during packagetests.
When building picard libraries, run clean first.
Fixed tools jar dependency in picard pom.
Integration tests properly use the ant-bridge.sh test.debug.port variable, like unit tests.
2014-02-06 08:25:38 -05:00
Valentin Ruano Rubio 988e3b4890 Merge pull request #487 from broadinstitute/vrr_reference_model_with_trimming
Get gVCF to work without --dontTrimActiveRegions
2014-02-05 22:52:17 -05:00
Valentin Ruano-Rubio 98ffcf6833 Get gVCF to work without --dontTrimActiveRegions
Story:

https://www.pivotaltracker.com/story/show/65048706
https://www.pivotaltracker.com/story/show/65116908

Changes:

ActiveRegionTrimmer in now an argument collection and it returns not only the trimmed down active region but also the non-variant containing flanking regions
HaplotypeCaller code has been simplified significantly pushing some functionality two other classes like ActiveRegion and AssemblyResultSet.

Fixed a problem with the way the trimming was done causing some gVCF non-variant records no have conservative 0,0,0 PLs
2014-02-05 22:50:45 -05:00
Karthik Gururaj acda6ca27b 1. Whew, finally debugged the source of performance issues with PairHMM
JNI. See copied text from email below.
2. This commit contains all the code used in profiling, detecting FP
exceptions, dumping intermediate results. All flagged off using ifdefs,
but it's there.
--------------Text from email
As we discussed before, it's the denormal numbers that are causing the
slowdown - the core executes some microcode uops (called FP assists)
when denormal numbers are detected for FP operations (even un-vectorized
code).
The C++ compiler by default enables flush to zero (FTZ) - when set, the
hardware simply converts denormal numbers to 0. The Java binary
(executable provided by Oracle, not the native library) seems to be
compiled without FTZ (sensible choice, they want to be conservative).
Hence, the JNI invocation sees a large slowdown. Disabling FTZ in C++
slows down the C++ sandbox performance to the JNI version (fortunately,
the reverse also holds :)).
Not sure how to show the overhead for these FP assists easily - measured
a couple of counters.
FP_ASSISTS:ANY - shows number of uops executed as part of the FP
assists. When FTZ is enabled, this is 0 (both C++ and JNI), when FTZ is
disabled this value is around 203540557 (both C++ and JNI)
IDQ:MS_UOPS_CYCLES - shows the number of cycles the decoder was issuing
uops when the microcode sequencing engine was busy. When FTZ is enabled,
this is around 1.77M cycles (both C++ and JNI), when FTZ is disabled
this value is around 4.31B cycles (both C++ and JNI). This number is
still small with respect to total cycles (~40B), but it only reflects
the cycles in the decode stage. The total overhead of the microcode
assist ops could be larger.
As suggested by Mustafa, I compared intermediate values (matrices M,X,Y)
and final output of compute_full_prob. The values produced by C++ and
Java are identical to the last bit (as long as both use FTZ or no-FTZ).
Comparing the outputs of compute_full_prob for the cases no-FTZ and FTZ,
there are differences for very small values (denormal numbers).
Examples:
Diff values 1.952970E-33 1.952967E-33
Diff values 1.135071E-32 1.135070E-32
Diff values 1.135071E-32 1.135070E-32
Diff values 1.135071E-32 1.135070E-32
For this test case (low coverage NA12878), all these values would be
recomputed using the double precision version. Enabling FTZ should be
fine.
-------------------End text from email
2014-02-05 17:09:57 -08:00
Ryan Poplin 693bfac341 Bug fix for missing annotations in CombineReferenceCalculationVariants. They were being dropped in the handoff between engines in a couple of places.
-- Updated single sample pipeline test data using Valentin's files and re-enabled CRCV tests
2014-02-05 12:58:48 -05:00
Eric Banks 740b33acbb We were never validating the sequence dictionary of tabix indexed VCFs for some reason. Fixed.
These changes happened in Tribble, but Joel clobbered them with his commit.
We can now change the logging priority on failures to validate the sequence dictionary to WARN.
Thanks to Tim F for indirectly pointing this out.
2014-02-05 10:12:38 -05:00
Eric Banks 9cac24d1e6 Moving logging status of VCF indexing to DEBUG instead of INFO, otherwise it's painful when reading in lots of files 2014-02-05 10:12:37 -05:00
Eric Banks 91bdf069d3 Some updates to CRCV.
1. Throw a user error when the input data for a given genotype does not contain PLs.
2. Add VCF header line for --dbsnp input
3. Need to check that the UG result is not null
4. Don't error out at positions with no gVCFs (which is possible when using a dbSNP rod)
2014-02-05 10:12:37 -05:00
Joel Thibault 7923e786e9 Rev Picard (public) to 1.107.1676
- Rename snappy to snappy-java
- Add maven-metadata-local.xml to .gitignore
2014-02-04 22:04:28 -05:00
Joel Thibault 0025fe190d Exclude sam's older TestNG 2014-02-04 22:04:27 -05:00
Karthik Gururaj 24f8aef344 Contains profiling, exception tracking, PAPI code
Contains Sandbox Java
2014-02-04 16:27:29 -08:00
David Roazen 76086f30b7 Temporarily disable tests that started failing post-maven
Joel is working on these failures in a separate branch. Since
maven (currently! we're working on this..) won't run the whole
test suite to completion if there's a failure early on, we need
to temporarily disable these tests in order to allow group members
to run tests on their branches again.
2014-02-04 15:31:24 -05:00
David Roazen 3b2f07990d Re-break the MWUnitTest for Joel to debug 2014-02-04 15:19:09 -05:00
David Roazen c9032f0b5c Fix failing unit tests 2014-02-04 03:05:30 -05:00
Khalid Shakir a4289711e2 Distinct failsafe summary reports, just like invoker report directories. 2014-02-03 13:50:47 -05:00
Khalid Shakir 857e6e0d6f Bumped version to 2.8-SNAPSHOT, using new update_pom_versions.sh script. 2014-02-03 13:50:46 -05:00
Khalid Shakir 9ca3004fc3 Setting the test-utils' type to test-jar, such that the multi-module build uses testClasses instead of classes as a directory dependency. 2014-02-03 13:50:46 -05:00
Khalid Shakir de13f41fc3 One step closer to a proper test-utils artifact. Using the maven-jar-plugin to create a test classifer, excluding actual tests, until we can properly separate the classes into separate artifacts/modules. 2014-02-03 13:50:46 -05:00
Khalid Shakir 25aee7164e Fixed missing "mvn" command execution in ant-bridge.
Added pom.xml workarounds for duplicate classpath error, due to gatk-framework dependency containing required BaseTest, and jarred *UnitTest/*IntegrationTest classes that also exist as files under target/test-classes.
2014-02-03 13:50:46 -05:00
Khalid Shakir caa76cdac4 Added maven pom.xmls for various artifacts. 2014-02-03 13:50:46 -05:00
Khalid Shakir d1a689af33 Added new utility files used by maven build, including the ant-bridge script. 2014-02-03 13:50:46 -05:00
Khalid Shakir 88150e0166 Switched commited dependency repository from ivy to maven. 2014-02-03 13:50:46 -05:00
Khalid Shakir 1e25a758f5 Moved files to maven directories.
Here are the git moved directories in case other files need to be moved during a merge:
  git-mv private/java/src/        private/gatk-private/src/main/java/
  git-mv private/R/scripts/       private/gatk-private/src/main/resources/
  git-mv private/java/test/       private/gatk-private/src/test/java/
  git-mv private/testdata/        private/gatk-private/src/test/resources/
  git-mv private/scala/qscript/   private/queue-private/src/main/qscripts/
  git-mv private/scala/src/       private/queue-private/src/main/scala/
  git-mv protected/java/src/      protected/gatk-protected/src/main/java/
  git-mv protected/java/test/     protected/gatk-protected/src/test/java/
  git-mv public/java/src/         public/gatk-framework/src/main/java/
  git-mv public/java/test/        public/gatk-framework/src/test/java/
  git-mv public/testdata/         public/gatk-framework/src/test/resources/
  git-mv public/scala/qscript/    public/queue-framework/src/main/qscripts/
  git-mv public/scala/src/        public/queue-framework/src/main/scala/
  git-mv public/scala/test/       public/queue-framework/src/test/scala/
2014-02-03 13:50:44 -05:00
Khalid Shakir faaef236ea Moved gsalib, R and other resources, Queue GATK extensions generator, Queue version java files. 2014-02-03 13:49:21 -05:00
Khalid Shakir eb52dc6a9b Moved build.xml, ivy.xml, ivysettings.xml, ivy properties, public/packages/*.xml into private/archive/ant 2014-02-03 13:49:20 -05:00
Karthik Gururaj 6d4d776633 Includes code for all debug code for obtaining profiling info 2014-01-30 12:08:06 -08:00
Valentin Ruano-Rubio 89c4e57478 gVCF <NON_REF> in all vcf lines including variant ones when –ERC gVCF is requested.
Changes:
-------

  <NON_REF> likelihood in variant sites is calculated as the maximum possible likelihood for an unseen alternative allele: for reach read is calculated as the second best likelihood amongst the reported alleles.

  When –ERC gVCF, stand_conf_emit and stand_conf_call are forcefully set to 0. Also dontGenotype is set to false for consistency sake.

  Integration test MD5 have been changed accordingly.

Additional fix:
--------------

  Specially after adding the <NON_REF> allele, but also happened without that, QUAL values tend to go to 0 (very large integer number in log 10) due to underflow when combining GLs (GenotypingEngine.combineGLs). To fix that combineGLs has been substituted by combineGLsPrecise that uses the log-sum-exp trick.

  In just a few cases this change results in genotype changes in integration tests but after double-checking using unit-test and difference between combineGLs and combineGLsPrecise in the affected integration test, the previous GT calls were either border-line cases and or due to the underflow.
2014-01-30 11:23:33 -05:00
Karthik Gururaj 5c7427e48c Temporary commit containing debug profiling code - commented out 2014-01-29 12:10:29 -08:00
Karthik Gururaj 0c63d6264f 1. Added synchronization block around loadLibrary in
VectorLoglessPairHMM
2. Edited Makefile to use static libraries where possible
2014-01-27 15:34:58 -08:00
Karthik Gururaj a15137a667 Modified run.sh 2014-01-27 14:56:46 -08:00
Karthik Gururaj 2c0d70c863 Moved vector JNI code to public/c++/VectorPairHMM 2014-01-27 14:52:59 -08:00
Karthik Gururaj 85a748860e 1. Added more profiling code
2. Modified JNI_README
2014-01-27 14:32:44 -08:00
Valentin Ruano-Rubio 748d2fdf92 Added Integration test to verify the bugs are not there anymore as reported in pivotracker 2014-01-26 23:29:31 -05:00
Karthik Gururaj 018e9e2c5f 1. Cleaned up code
2. Split into DebugJNILoglessPairHMM and VectorLoglessPairHMM with base
class JNILoglessPairHMM. DebugJNILoglessPairHMM can, in principle,
invoke any other child class of JNILoglessPairHMM.
3. Added more profiling code for Java parts of LoglessPairHMM
2014-01-26 19:18:12 -08:00
Valentin Ruano-Rubio 9e7bf75e89 Fix for the PairHMM transition probability miscalculation.
Problem:

matchToMatch transition calculation was wrong resulting in transition probabilites coming out of the Match state that added more than 1.

Reports:

https://www.pivotaltracker.com/s/projects/793457/stories/62471780
https://www.pivotaltracker.com/s/projects/793457/stories/61082450

Changes:

The transition matrix update code has been moved to a common place in PairHMMModel to dry out its multiple copies.

MatchToMatch transtion calculation has been fixed and implemented in PairHMMModel.

Affected integration test md5 have been updated, there were no differences in GT fields and example differences always implied
small changes in likelihoods that is what is expected.
2014-01-26 16:30:36 -05:00
Karthik Gururaj 81bdfbd00d Temporary commit before moving to new native library 2014-01-24 16:29:35 -08:00
Karthik Gururaj 733a84e4f9 Added support to transfer haplotypes once per region to the JNI
Re-use transferred haplotypes (stored in GlobalRef) across calls to
computeLikelihoods
2014-01-22 10:52:41 -08:00
Karthik Gururaj 88c08e78e7 1. Inserted #define in sandbox pairhmm-template-main.cc
2. Wrapped _mm_empty() with ifdef SIMD_TYPE_SSE
3. OpenMP disabled
4. Added code for initializing PairHMM's data inside initializePairHMM -
not used yet
2014-01-21 09:57:14 -08:00
Karthik Gururaj 7180c392af 1. Integrated Mohammad's SSE4.2 code, Mustafa's bug fix and code to fix the
SSE compilation warning.
2. Added code to dynamically select between AVX, SSE4.2 and normal C++ (in
that order)
3. Created multiple files to compile with different compilation flags:
avx_function_prototypes.cc is compiled with -xAVX while
sse_function_instantiations.cc is compiled with -xSSE4.2 flag.
4. Added jniClose() and support in Java (HaplotypeCaller,
PairHMMLikelihoodCalculationEngine) to call this function at the end of
the program.
5. Removed debug code, kept assertions and profiling in C++
6. Disabled OpenMP for now.
2014-01-20 08:03:42 -08:00
Yossi Farjoun c79e8ca53e Added an info log containing the SAM/BAM files that were eventually found from the commandline (useful for when there are files hiding inside bam.lists which may or may not have been constructed correctly...)
Added a @hidden option controling the appearance of the full BamList in the log
2014-01-17 11:25:21 -05:00
Karthik Gururaj f1c772ceea Same log message as before - forgot -a option
1. Moved computeLikelihoods from PairHMM to native implementation
2. Disabled debug - debug code still left (hopefully, not part of
    bytecode)
3. Added directory PairHMM_JNI in the root which holds the C++
library that contains the PairHMM AVX implementation. See
PairHMM_JNI/JNI_README first
2014-01-16 21:40:04 -08:00
Eric Banks de56134579 Fixed up and refactored what seems to be a useful private tool to create simulated reads around a VCF.
It didn't completely work before (it was hard-coded for a particular long-lost data set) but it should work now.
Since I thought that it might prove useful to others, I moved it to protected and added integration tests.

GERALDINE: NEW TOOL ALERT!
2014-01-15 13:49:31 -05:00
Geraldine Van der Auwera edf5880022 Updated SAMPileup codec and pileup-related docs
Problem: the codec was written to take in consensus pileups produced with pileup -c option (which consists of 10 or 13 fields per line depending on the variant type) but errored out on the basic pileup format (which only has 6 fields per line). This was inconsistent and confusing to users.

	Solution: I added a switch in the parsing to recognize and handle both cases more appropriately, and updated related docs. While I was at it I also improved error messages in CheckPileup, which now emits User Error: Bad Input exceptions when reporting mismatches. Which may not be the best thing to do (ultimately they're not really errors, they're just reporting unwelcome results) but it beats emitting Runtime Exceptions.

	Tested by CheckPileupIntegrationTest which tests both format cases.
2014-01-14 09:14:16 -05:00
Eric Banks 16ecc53749 Merge pull request #469 from broadinstitute/gg_gatkdoc_fixes
Assorted fixes and improvements to gatkdocs
2014-01-14 05:56:07 -08:00
droazen 347fab4717 Merge pull request #471 from broadinstitute/eb_output_log_info_for_tim
Adding more meta information about the user to the GATK logging output, per Tim F's request.
2014-01-13 17:48:40 -08:00
Geraldine Van der Auwera bdb3954eb3 removed maxRuntime minValue 2014-01-13 20:45:43 -05:00
Geraldine Van der Auwera 8fcad6680b Assorted fixes and improvements to gatkdocs
-Added docs for ERC mode in HC
 -Move RecalibrationPerformance walker since to private since it is experimental and unsupported
 -Updated VR docs and restored percentBad/numBad (but @Hidden) to enable deprecation alert if users try to use them
 -Improved error msg for conflict between per-interval aggregation and -nt
 -Minor clean up in exception docs
 -Added Toy Walkers category for devs and dev supercat (to build out docs for developers)
 -Added more detailed info to GenotypeConcordance doc based on Chris forum post
 -Added system to include min/max argument values in gatkdocs (build gatkdocs with 'ant gatkdocs' to test it, see engine and DoC args for in situ examples)
 -Added tentative min/max argument annotations to DepthOfCoverage and CommandLineGATK arguments (and improved docs while at it)
 -Added gotoDev annotation to GATKDocumentedFeature to track who is the go-to person in GSA for questions & issues about specific walkers/tools (now discreetly indicated in each gatkdoc)
2014-01-13 17:46:22 -05:00
Eric Banks 851ec67bdc Adding more meta information about the user to the GATK logging output, per Tim F's request. 2014-01-13 14:36:02 -05:00
droazen 7cd304fb41 Merge pull request #470 from broadinstitute/mf_new_RBP
Mf new rbp
2014-01-13 08:46:27 -08:00
Eric Banks 0323caefc8 Added some bug fixes to the gVCF merging code after finally getting some real data to play with.
Still under construction, awaiting more test data from Valentin.
2014-01-08 08:34:35 -05:00
Eric Banks f172c349f6 Adding the functionality to enable users to input a file of VCFs for -V.
To do this I have added a RodBindingCollection which can represent either a VCF or a
file of VCFs.  Note that e.g. SelectVariants allows a list of RodBindingCollections so
that one can intermix VCFs and VCF lists.

For VariantContext tags with a list, by default the tags for the -V argument are applied
unless overridden by the individual line.  In other words, any given line can have either
one token (the file path) or two tokens (the new tags and the file path).  For example:
foo.vcf
VCF,name=bar bar.vcf

Note that a VCF list file name must end with '.list'.

Added this functionality to CombineVariants, CombineReferenceCalculationVariants, and VariantRecalibrator.
2014-01-08 00:45:00 -05:00
Menachem Fromer d1275651ae Merge remote-tracking branch 'origin/master' into mf_new_RBP 2014-01-03 01:13:40 -05:00
Ami Levy-Moonshine 6da53aea09 Write a new tool for spliting reads that have N cigar string.
For example, this tool can be used for processing bowtie RNA-seq data.
Each read with k N-cigar elemments is plit to k+1 reads. The split is done by hard clipping the bases rest of the bases.

In order to do it, few changes were introduced to some other clipping methods:
- make a segnificant change in ClippingOp.hardClip() that prevent the spliting of read with cigar: 1M2I1N1M3I.
- change getReadCoordinateForReferenceCoordinate in ReadUtil to recognize Ns

create unitTests for that walker:
- change ReadClipperTestUtils to be more general in order to use its code and avoid code duplication
- move some useful methods from ReadClipperTestUtils to CigarUtils

create integration test for that class

small change in a comment in FullProcessingPipeline

last commit:

Address review comments:
- move to protected under walkers/rnaseq
- change the read splitting methods to be more readable and more efficiant
- change (minor changes) some methods in ReadClipper to allow the changes in split reads
- add (minor change) one method to CigarUtils to allow the changes in split reads
- change ReadUtils.getReadCoordinateForReferenceCoordinate to include possible N in the cigar
- address the rest of the review comments (minor changes)

- fix ReadUtilsUnitTest.testReadWithNs acoording to the defult behaviour of getReadCoordinateForReferenceCoordinate (in case of refernce index that fall into deletion, return the read index of the base before the deletion).
- add another test to ReadUtilsUnitTest.testReadWithNs

- Allow the user to print the split positions (not working proparly currently)
2014-01-01 22:21:36 -05:00
Mauricio Carneiro d1febb89c8 Better documentation for ReadClippingStats walker
* add overall walker GATKDocs
* add explanation for skip parameter and make it advanced
* reverse the logic on exculding unmapped reads for clarity
* fix read length  calculation to no longer include indels

ps: I am not sure how useful this walker is (I didn't write it) but the skip logic is poor and
calculates the entire statistic for the reads it is eventually going to skip. This would be an easy
fix, but only worth our time if people actually use this.
2014-01-01 14:26:26 -05:00
Eric Banks f82a7c3f4c Updating variant jar.
The update contains:
1. documentation changes for VariantContext and Allele (which used to discuss the now obsolete null allele)
2. better error messages for VCFs containing complex rearrangements with breakends
3. instead of failing badly on format field lists with '.'s, just ignore them
Also, there is a trivial change to use a more efficient method to remove a bunch of attributes from a VC.

Delivers PT#s 59675378, 59496612, and 60524016.
2013-12-31 22:48:29 -05:00
Eric Banks 5a1564d1f2 Merge pull request #456 from broadinstitute/eb_unify_hc_combination_steps
Created a new walker to do the full combination of N gVCFs from the HC single-sample ref calc pipeline.
2013-12-31 18:57:27 -08:00
Eric Banks 83e09b1f64 Created a new walker to do the full combination of N gVCFs from the HC single-sample ref calc pipeline.
Basically, it does 3 things (as opposed to having to call into 3 separate walkers):
1. merge the records at any given position into a single one with all alleles and appropriate PLs
2. re-genotype the record using the exact AF calculation model
3. re-annotate the record using the VariantAnnotatorEngine

In the course of this work it became clear that we couldn't just use the simpleMerge() method used
by CombineVariants; combining HC-based gVCFs is really a complicated process.  So I added a new
utility method to handle this merging and pulled any related code out of CombineVariants.  I tried
to clean up a lot of that code, but ultimately that's out of the scope of this project.

Added unit tests for correctness testing.
Integration tests cannot be used yet because the HC doesn't output correct gVCFs.
2013-12-31 12:07:56 -05:00
Menachem Fromer 48ef7a1a2f Merge remote-tracking branch 'origin/master' into mf_new_RBP 2013-12-19 10:42:20 -05:00
David Roazen 4a79831adc Add ability to specify min/max required/recommended values for numeric arguments in the @Argument annotation
-You can now add "minValue", "maxValue", "minRecommendedValue", and "maxRecommendedValue" attributes
 to @Argument annotations for command-line arguments

-"minValue" and "maxValue" specify hard limits that generate an exception if violated

-"minRecommendedValue" and "maxRecommendedValue" specify soft limits that generate a warning if violated

-Works only for numeric arguments (int, double, etc.) with @Argument annotations

-Only considers values actually specified by the user on the command line, not default values
 assigned in the code

As requested by Geraldine
2013-12-18 18:09:08 -05:00
Eric Banks 400e7c1404 Fixed bug in the filtering of lifted over variants where a deletion at the end of a contig could cause it to error out.
Added a unit test.
2013-12-11 14:07:18 -05:00
Eric Banks 418fbdfbab Added HC trio calls and NA12878 KB snapshot to resource bundle.
Also, don't touch the current link until the resources are finished being produced.
2013-12-07 22:08:34 -05:00
David Roazen 932cd3ada7 Fix 3rd-party library dependency issues in the HC/PairHMM tests
In general, test classes cannot use 3rd-party libraries that are not
also dependencies of the GATK proper without causing problems when,
at release time, we test that the GATK jar has been packaged correctly
with all required dependencies.

If a test class needs to use a 3rd-party library that is not a GATK
dependency, write wrapper methods in the GATK utils/* classes, and
invoke those wrapper methods from the test class.
2013-12-06 13:16:55 -05:00
David Roazen 0e65296efb Rev picard, sam-jdk, tribble, and variant jars to 1.104.1628
-update VariantFiltration to work with new Lazy wrapper around the
 JexlEngine in VariantContextUtils
2013-12-05 12:45:32 -05:00
Joel Thibault 5fe0531b4d Throw a GVCFIndexException when the user doesn't specify the optimal indexing strategy 2013-12-03 23:12:14 -05:00
Joel Thibault 8571a641bf Add @Advanced to variant_index_type and variant_index_parameter 2013-12-03 23:12:14 -05:00
Joel Thibault fd0a02e52e New VCF engine arguments to specify an alternate IndexCreator
- CatVariants updates to use custom VCF indices
- Scala scripts for VCF index testing
2013-12-03 13:31:02 -05:00
Joel Thibault 42f78bdb3a Add a class-based DataProvider 2013-12-03 13:31:01 -05:00
Joel Thibault cd3ee2ae7e whitespace 2013-12-03 13:31:01 -05:00
Eric Banks 6bee6a1b53 Change the behavior of SelectVariants for PL/AD when it encounters a record that has lost one or more alternate alleles.
Previously, we would strip out the PLs and AD values since they were no longer accurate.  However, this is not ideal because
then that information is just lost and 1) users complain on the forum and post it as a bug and 2) it gives us problems in both
the current and future (single sample) calling pipelines because we subset samples/alleles all the time and lose info.

Now the PLs and AD get correctly selected down.

While I was in there I also refactored some related code in subsetDiploidAlleles().  There were no real changes there - I just
broke it out into smaller chunks as per our best practices.

Added unit tests and updated integration tests.
Addressed reviews.
2013-12-03 09:23:03 -05:00
Valentin Ruano-Rubio 0f99778a59 Adding Graph-based likelihood ratio calculation to HC
To active this feature add '--likelihoodCalculationEngine GraphBased' to the HC command line.

New HC Options (both Advanced and Hidden):
==========================================

  --likelihoodCalculationEngine PairHMM/GraphBased/Random (default PairHMM)

Specifies what engine should be used to generate read vs haplotype likelihoods.

  PairHMM : standard full-PairHMM approach.
  GraphBased : using the assembly graph to accelarate the process.
  Random : generate random likelihoods - used for benchmarking purposes only.

  --heterogeneousKmerSizeResolution COMBO_MIN/COMBO_MAX/MAX_ONLY/MIN_ONLY (default COMBO_MIN)

It idicates how to merge haplotypes produced using different kmerSizes.
Only has effect when used in combination with (--likelihooCalculationEngine GraphBased)

  COMBO_MIN : use the smallest kmerSize with all haplotypes.
  COMBO_MAX : use the larger kmerSize with all haplotypes.
  MIN_ONLY : use the smallest kmerSize with haplotypes assembled using it.
  MAX_ONLY : use the larger kmerSize with haplotypes asembled using it.

Major code changes:
===================

 * Introduce multiple likelihood calculation engines (before there was just one).

 * Assembly results from different kmerSies are now packed together using the AssemblyResultSet class.

 * Added yet another PairHMM implementation with a different API in order to spport
   local PairHMM calculations, (e.g. a segment of the read vs a segment of the haplotype).

Major components:
================

 * FastLoglessPairHMM: New pair-hmm implemtation using some heuristic to speed up partial PairHMM calculations

 * GraphBasedLikelihoodCalculationEngine: delegates onto GraphBasedLikelihoodCalculationEngineInstance the exectution
     of the graph-based likelihood approach.

 * GraphBasedLikelihoodCalculationEngineInstance: one instance per active-region, implements the graph traversals
     to calcualte the likelihoods using the graph as an scafold.

 * HaplotypeGraph: haplotype threading graph where build from the assembly haplotypes. This structure is the one
     used by GraphBasedLikelihoodCalculationEngineInstance to do its work.

 * ReadAnchoring and KmerSequenceGraphMap: contain information as how a read map on the HaplotypeGraph that is
     used by GraphBasedLikelihoodCalcuationEngineInstance to do its work.

Remove mergeCommonChains from HaplotypeGraph creation

Fixed bamboo issues with HaplotypeGraphUnitTest

Fixed probrems with HaplotypeCallerIntegrationTest

Fixed issue with GraphLikelihoodVsLoglessAccuracyIntegrationTest

Fixed ReadThreadingLikelihoodCalculationEngine issues

Moved event-block iteration outside GraphBased*EngineInstance

Removed unecessary parameter from ReadAnchoring constructor.
Fixed test problem

Added a bit more documentation to EventBlockSearchEngine

Fixing some private - protected dependency issues

Further refactoring making GraphBased*Instance and HaplotypeGraph slimmer. Addressed last pull request commit comments

Fixed FastLoglessPairHMM public -> protected dependency

Fixed probrem with HaplotypeGraph unit test

Adding Graph-based likelihood ratio calculation to HC

  To active this feature add '--likelihoodCalculationEngine GraphBased' to the HC command line.

New HC Options (both Advanced and Hidden):
==========================================

  --likelihoodCalculationEngine PairHMM/GraphBased/Random (default PairHMM)

Specifies what engine should be used to generate read vs haplotype likelihoods.

  PairHMM : standard full-PairHMM approach.
  GraphBased : using the assembly graph to accelarate the process.
  Random : generate random likelihoods - used for benchmarking purposes only.

  --heterogeneousKmerSizeResolution COMBO_MIN/COMBO_MAX/MAX_ONLY/MIN_ONLY (default COMBO_MIN)

It idicates how to merge haplotypes produced using different kmerSizes.
Only has effect when used in combination with (--likelihooCalculationEngine GraphBased)

  COMBO_MIN : use the smallest kmerSize with all haplotypes.
  COMBO_MAX : use the larger kmerSize with all haplotypes.
  MIN_ONLY : use the smallest kmerSize with haplotypes assembled using it.
  MAX_ONLY : use the larger kmerSize with haplotypes asembled using it.

Major code changes:
===================

 * Introduce multiple likelihood calculation engines (before there was just one).

 * Assembly results from different kmerSies are now packed together using the AssemblyResultSet class.

 * Added yet another PairHMM implementation with a different API in order to spport
   local PairHMM calculations, (e.g. a segment of the read vs a segment of the haplotype).

Major components:
================

 * FastLoglessPairHMM: New pair-hmm implemtation using some heuristic to speed up partial PairHMM calculations

 * GraphBasedLikelihoodCalculationEngine: delegates onto GraphBasedLikelihoodCalculationEngineInstance the exectution
     of the graph-based likelihood approach.

 * GraphBasedLikelihoodCalculationEngineInstance: one instance per active-region, implements the graph traversals
     to calcualte the likelihoods using the graph as an scafold.

 * HaplotypeGraph: haplotype threading graph where build from the assembly haplotypes. This structure is the one
     used by GraphBasedLikelihoodCalculationEngineInstance to do its work.

 * ReadAnchoring and KmerSequenceGraphMap: contain information as how a read map on the HaplotypeGraph that is
     used by GraphBasedLikelihoodCalcuationEngineInstance to do its work.

Remove mergeCommonChains from HaplotypeGraph creation

Fixed bamboo issues with HaplotypeGraphUnitTest

Fixed probrems with HaplotypeCallerIntegrationTest

Fixed issue with GraphLikelihoodVsLoglessAccuracyIntegrationTest

Fixed ReadThreadingLikelihoodCalculationEngine issues

Moved event-block iteration outside GraphBased*EngineInstance

Removed unecessary parameter from ReadAnchoring constructor.
Fixed test problem

Added a bit more documentation to EventBlockSearchEngine

Fixing some private - protected dependency issues

Further refactoring making GraphBased*Instance and HaplotypeGraph slimmer. Addressed last pull request commit comments

Fixed FastLoglessPairHMM public -> protected dependency

Fixed probrem with HaplotypeGraph unit test
2013-12-02 19:37:19 -05:00
Chris Hartl 1f777c4898 Introducing the latest-and-greatest in genotyping: CalculatePosteriors.
CalculatePosteriors enables the user to calculate genotype likelihood posteriors (and set genotypes accordingly) given one or more panels containing allele counts (for instance, calculating NA12878 genotypes based on 1000G EUR frequencies). The uncertainty in allele frequency is modeled by a Dirichlet distribution (parameters being the observed allele counts across each allele), and the genotype state is modeled by assuming independent draws (Hardy-Weinberg Equilibrium). This leads to the Dirichlet-Multinomial distribution.

Currently this is implemented only for ploidy=2. It should be straightforward to generalize. In addition there's a parameter for "EM" that currently does nothing but throw an exception -- another extension of this method is to run an EM over the Maximum A-Posteriori (MAP) allele count in the input sample as follows:
 while not converged:
  * AC = [external AC] + [sample AC]
  * Prior = DirichletMultinomial[AC]
  * Posteriors = [sample GL + Prior]
  * sample AC = MLEAC(Posteriors)

This is more useful for large callsets with small panels than for small callsets with large panels -- the latter of these being the more common usecase.

Fully unit tested.

Reviewer (Eric) jumped in to address many of his own comments plus removed public->protected dependencies.
2013-11-27 13:00:45 -05:00
Geraldine Van der Auwera 429582589f Set SAMFileWriter to create index in ReadUtils to fix SplitSamFile issue 2013-11-26 15:54:47 -05:00
Geraldine Van der Auwera 25bc6e64ae Patched Queue extensions lacking a main class definition 2013-11-22 14:57:09 -05:00
Ami Levy-Moonshine 6ad841cec5 Rewrite ReadLengthDistribution to count the read lengths into a hash table first and only at the end to produce a GATK report table.
Before that fix, the tool was couldn't work with more then one RG before.
- Address all review comments
2013-11-18 17:29:31 -05:00
Ami Levy-Moonshine 9c1023c933 fix a (ugly) weird error from last commit that changed all the scala files to end with MoleculoPipeline.scala 2013-11-18 11:44:24 -05:00
MauricioCarneiro 7f08250870 Merge pull request #417 from broadinstitute/bt_pairhmm_api_cleanup2
Improve the PairHMM API for better FPGA integration
2013-11-14 10:47:07 -08:00
bradtaylor e40a07bb58 Improve the PairHMM API for better FPGA integration
Motivation:
The API was different between the regular PairHMM and the FPGA-implementation
via CnyPairHMM. As a result, the LikelihoodCalculationEngine had
to use account for this. The goal is to change the API to be the same
for all implementations, and make it easier to access.

PairHMM
PairHMM now accepts a list of reads and a map of alleles/haplotpes and returns a PerReadAlleleLikelihoodMap.
Added a new primary method that loops the reads and haplotypes, extracts qualities,
and passes them to the computeReadLikelihoodGivenHaplotypeLog10 method.
Did not alter that method, or its subcompute method, at all.
PairHMM also now handles its own (re)initialization, so users don't have to worry about that.

CnyPairHMM
Added that same new primary access method to this FPGA class.
Method overrides the default implementation in PairHMM. Walks through a list of reads.
Individual-read quals and the full haplotype list are fed to batchAdd(), as before.
However, instead of waiting for every read to get added, and then walking through the reads
again to extract results, we just get the haplotype-results array for each read as soon as it
is generated, and pack it into a perReadAlleleLikelihoodMap for return.
The main access method is now the same no matter whether the FPGA CnyPairHMM is used or not.

LikelihoodCalculationEngine
The functionality to loop through the reads and haplotypes and get individual log10-likelihoods
was moved to the PairHMM, and so removed from here. However, this class does need to retain
the ability to pre-process the reads, and post-process the resulting likelihoods map.
Those features were separated from running the HMM and refactored into their own methods
Commented out the (unused) system for finding best N haplotypes for genotyping.

PairHMMIndelErrorModel
Similar changes were made as to the LCE. However, in this case the haplotypes are modified
based on each individual read, so the read-list we feed into the HMM only has one read.
2013-11-14 09:45:33 -05:00
Geraldine Van der Auwera f22ab033f6 Merge pull request #424 from broadinstitute/gg_yetanothergatkdocfix
Yet another gatkdoc fix
2013-11-13 11:35:59 -08:00
Geraldine Van der Auwera dac3dbc997 Improved gatkdocs for InbreedingCoefficient, ReduceReads, ErrorRatePerCycle
Clarified caveat for InbreedingCoefficient
Cleaned up docstrings for ReduceReads
Brushed up doc for ErrorRatePerCycle
2013-11-13 14:33:04 -05:00
Phillip Dexheimer 296bcc7fb1 Changed name of jobs submitted to cluster job runners
-- Added 'jobRunnerJobName' definition to QFunction, defaults to value of shortDescription
-- Edited Lsf and Drmaa JobRunners to use this string instead of description for naming jobs in the scheduler

Signed-off-by: Joel Thibault <thibault@broadinstitute.org>
2013-11-12 14:34:56 -05:00
Mauricio Carneiro 725656ae7e Generalizing the FullProcessingPipeline Qscript
We have generalized the processing script to be able to handle multiple scenarios. Originally it was
designed for PCR free data only, we added all the steps necessary to start from fastq and process
RNA-seq as well as non-human data. This is our go to script in TechDev.

   * add optional "starting from fastq" path to the pipeline
   * add mark duplicates (optionally) to the pipeline
   * add an option to run with the mouse data (without dbsnp and with single ended fastq)
   * add option to process RNA-seq data from topHat (add RG and reassign mapping quality if necessary)
   * add option to filter or include reads with N in the cigar string
   * add parameter to allow keeping the intermediate files
2013-11-07 16:34:29 -05:00
Eric Banks f15355856a Merge pull request #418 from broadinstitute/eb_fix_liftover_script
Fixing the liftover script to not require strict VCF header validation.
2013-11-07 06:04:56 -08:00
Eric Banks 2fc40a0aed Fixing the liftover script to not require strict VCF header validation.
Apparently no one has used the liftover script for a while (which I guess is a good thing)...
2013-11-07 09:02:17 -05:00
Eric Banks 0e3d83d1ef Merge pull request #413 from broadinstitute/rp_qd_and_qual_updates_in_ref_model_pipeline
Improvements to the reference model pipeline.
2013-11-05 06:33:17 -08:00
Eric Banks 09dfaf1a68 Merge pull request #416 from broadinstitute/mc_quick_fixes_to_cser_pipeline
Add interpretation to QualifyMissingIntervals
2013-11-05 06:08:13 -08:00
Eric Banks 96024403bf Update the dbsnp version in the bundle from 137 to 138; resolves PT #59771004. 2013-11-04 10:01:22 -05:00
Ryan Poplin b22c9c2cb4 Improvements to the reference model pipeline.
-- We use the RegenotypeVariants walker to recompute the qual field. (instead of the discussed idea of adding this functionality to CombineVariants)
-- QualByDepth will now be recomputed even if the stratified contexts are missing. This greatly improves the QD estimate for this pipeline. Doesn't work for multi-allelics since the qual can't be recomputed.
2013-11-01 17:58:25 -04:00
Eric Banks cafcb34855 Merge pull request #411 from broadinstitute/eb_add_exome_intervals_to_bundle_script
Updated the GATK bundle script to:
2013-10-29 07:38:44 -07:00
Eric Banks 209f2a61aa Updated the GATK bundle script to:
1. Include exome target list for b37
2. Not delete the 'current' link unless -run is applied to the command line!  (sorry, Ryan)
2013-10-29 10:33:51 -04:00
Louis Bergelson 9498950b1c Adding more specific error message when one of the scripts doesn't exist.
--Previously it gave a cryptic message:
----IO error while decoding blarg.script with UTF-8
----Please try specifying another one using the -encoding option
2013-10-21 14:57:42 -04:00
David Roazen 5a2ef37ead Tweak dcov documentation to help prevent user confusion
Geraldine-approved!
2013-10-16 15:24:33 -04:00
Mauricio Carneiro efbfdb64fe Qscript to Downsample and analyze an exome BAM
this script downsamples an exome BAM several times and makes a coverage distribution
analysis (of bases that pass filters) as well as haplotype caller calls with a NA12878
Knowledge Base assessment with comparison against multi-sample calling
with the UG.

This script was used for the "downsampling the exome" presentation
2013-10-10 14:37:33 -04:00
Chris Hartl 55bab9fa87 Merged bug fix from Stable into Unstable 2013-10-10 13:01:12 -04:00
Chris Hartl 06d28c7f8b VariantsToBinaryPed: Move .fam file writing to initialize to ensure ordering matches the ordering of the VCF. Change the documentation to clarify that the fam files are not directly copied, but subset and re-ordered. 2013-10-10 12:53:15 -04:00
Mauricio Carneiro 5d6421494b Fix mismatching number of columns in report
Quick fix the missing column header in the QualifyMissingIntervals
report.

Adding a QScript for the tool as well as a few minor updates to the
GATKReportGatherer.
2013-10-09 14:38:15 -04:00
Ryan Poplin f3a67edc24 Merge pull request #402 from broadinstitute/gg_dcov_docs
Improvements to gatkdocs related to downsampling
2013-09-27 07:07:21 -07:00
kshakir a29f1f84bf Merge pull request #397 from lbergelson/lb_scala_2.10.2
Update scala from 2.9 to 2.10.2
2013-09-26 21:51:43 -07:00
Geraldine Van der Auwera 66d0235efc Minor clarifications & formatting tweaks for dcov docs 2013-09-26 14:28:22 -04:00
Michael McCowan 5113e21437 Bug fix: annotation values ar parsed as Doubles when they should be parsed as Integers due to implicit conversion.
* Updated expected test data in which an integer annotation (MQ0) was formatted as a double.
2013-09-25 13:12:02 -04:00
Louis Bergelson c05208ecec Resolving warnings
--specifying exception types in cases where none was already specified
----mostly changed to catch Exception instead of Throwable
----EmailMessage has a point where it should only be expecting a RetryException but was catching everything

--changing build.xml so that it prints scala feature warning details

--added necessary imports needed to remove feature warnings

--updating a newly deprecated enum declaration to match the new syntax
2013-09-23 12:42:22 -04:00
Louis Bergelson b32ad99d3f Changing from scala 2.9.2 to 2.10.2.
--modified ivy dependencies
--modified scala classpath in build.xml to include scala-reflect

--changed imports to point to the new scala scala.reflect.internal.util

--set the bootclasspath in QScriptManager as well as the classpath variable.

--removing Set[File] <-> Set[String] conversions
----Set is invariant now and the conversions broke
--removing unit tests for Set[File] <-> Set[String] conversions
2013-09-23 12:42:22 -04:00
chapmanb 2f5064dd1d Provide close methods to clean up resources used while creating AlignmentContexts from BAM file regions. Allows utilization of CoveredLocusView via the API
Signed-off-by: David Roazen <droazen@broadinstitute.org>
2013-09-10 15:32:54 -04:00
Geraldine Van der Auwera 292426b504 Merge pull request #390 from broadinstitute/mc_update_clipreads
Added REVERT SOFTCLIPPED bases to ClipReads
2013-09-09 16:43:03 -07:00
Geraldine Van der Auwera 8b829255e7 Clarified docs on using clipping options 2013-09-09 19:40:03 -04:00
MauricioCarneiro 014bc4269e Merge pull request #361 from broadinstitute/bt_pairhmm_array_implementation
Add Array Logless PairHMM
2013-09-08 20:16:53 -07:00
Ryan Poplin 3503050a39 Created a single sample calling pipeline which leverages the reference model calculation mode of the HaplotypeCaller
-- Adding changes to CombineVariants to work with the Reference Model mode of the HaplotypeCaller.
-- Added -combineAnnotations mode to CombineVariants to merge the info field annotations by taking the median
-- Added new StrandBiasBySample genotype annotation for use in computing strand bias from single sample input vcfs
-- Bug fixes to calcGenotypeLikelihoodsOfRefVsAny, used in isActive() as well as the reference model
-- Added active region trimming capabilities to the reference model mode, not perfect yet, turn off with --dontTrimActiveRegions
-- We only realign reads in the reference model if there are non-reference haplotypes, a big time savings
-- We only realign reads in the reference model if the read is informative for a particular haplotype over another
-- GVCF blocks will now track and output the minimum PLs over the block

-- MD5 changes!
-- HC tests: from bug fixes in calcGenotypeLikelihoodsOfRefVsAny
-- GVCF tests: from HC changes above and adding in active region trimming
2013-09-06 16:56:34 -04:00
Mauricio Carneiro b6c3ed0295 Added REVERT SOFTCLIPPED bases to ClipReads 2013-09-06 09:30:01 -04:00
Louis Bergelson 4473b0065e adding a check for the UNAVAILABLE case of GenotypeType in CountVariants 2013-08-29 17:27:00 -04:00
bradtaylor 3671e41b0c Add Array Logless PairHMM
A new PairHMM implementation for read/haplotype likelihood calculations. Output is the same as the LOGLESS_CACHING version.

Instead of allocating an entire (read x haplotype) matrix for each HMM state, this version stores sub-computations in 1D arrays. It also accesses intersections of the (read x haplotype) alignment in a different order, proceeding over "diagonals" if we think of the alignment as a matrix.

This implementation makes use of haplotype caching. Because arrays are overwritten, it has to explicitly store mid-process information. Knowing where to capture this info requires us to look ahead at the subsequent haplotype to be analyzed. This necessitated a signature change in the primary method for all pairHMM implementations.

We also had to adjust the classes that employ the pairHMM:
LikelihoodCalculationEngine (used by HaplotypeCaller)
PairHMMIndelErrorModel (used by indel genotyping classes)

Made the array version the default in the HaplotypeCaller and the UnifiedArgumentCollection.
The latter affects classes:
ErrorModel
GeneralPloidyIndelGenotypeLikelihoodsCalculationModel
IndelGenotypeLikelihoodsCalculationModel
... all of which use the pairHMM via PairHMMIndelErrorModel
2013-08-28 17:21:23 -04:00
David Roazen 42d771f748 Remove org.apache.commons.collections.IteratorUtils dependency from the test suite
-This was a dependency of the test suite, but not the GATK proper,
 which caused problems when running the test suite on the packaged
 GATK jar at release time

-Use GATKVCFUtils.readVCF() instead
2013-08-21 19:44:02 -04:00
Eric Banks 9424008055 Merge pull request #383 from broadinstitute/dr_change_phone_home_aws_settings
Update GATK AWS phone-home configuration
2013-08-21 14:08:21 -07:00
David Roazen 9fbb4920d0 Update GATK AWS phone-home configuration
-Switch to using new GSA AWS account for storage of phone home data

-Use DNS-compliant bucket names, as per Amazon's best practices

-Encrypt publicly-distributed version of credentials. Grant only PutObject
 permission, and only for the relevant buckets.

-Store non-distributed credentials in private/GATKLogs/newAWSAccountCredentials
 for now -- need to integrate with existing python/shell scripts
 later to get the log downloading working with the new account
2013-08-21 14:31:46 -04:00
Ami Levy-Moonshine 0f5bb706ff - update picard, sam, variants and tribble after fixing bug in BCF2Utils.makeDictionary as reported in ticket 52571227
- update call for VCFSimpleHeaderLine constructor in GATKVCFUtils
2013-08-21 12:06:42 -04:00
Eric Banks e1174a582d Merge pull request #379 from broadinstitute/mc_dpp_updates_part2
Including SplitByRG in the FullProcessingPipeline
2013-08-19 18:42:12 -07:00
Eric Banks 6663d48ffe Merge pull request #381 from broadinstitute/mm_rev_picard_to_get_tribble_updates
Adaptations to accomodate Tribble API changes.
2013-08-19 18:31:02 -07:00
Michael McCowan c3a933ce84 Adaptations to accomodate Tribble API changes, comprising mostly of the following.
* Refactoring implementations of readHeader(LineReader) -> readActualHeader(LineIterator), including nullary implementations where applicable.
* Galvanizing fo generic types.
* Test fixups, mostly to pass around LineIterators instead of LineReaders.
* New rev of tribble, which incorporates a fix that addresses a problem with TribbleIndexedFeatureReader reading a header twice in some instances.
* New rev of sam, to make AbstractIterator visible (was moved from picard -> sam in Tribble API refactor).
2013-08-19 15:52:47 -04:00
Mauricio Carneiro e991307eb5 Including SplitByRG in the FullProcessingPipeline
Why wasn't it there before, you ask
----------------------------------

Before I was running it separately (by hand), but now it's integrated in
the FullProcessingPipeline.

Integration was a pain because of Queue's limitation of only allowing 1
@Output file. This forced me to write the ugliest piece of code of my
life, but it's working and it's processing the YRI from scratch using
that right now. So I'm happy... somewhat.

Other changes to the pipeline
-----------------------------

   * Add --filter_bases_not_stored to the IndelRealigner step -- sometimes BAM files have reads with no bases stored in the unmapped section (no idea why) but this disrupts the pipeline.
   * Change adaptor marking parameter to "dual indexed" instead of "pair-ended" -- for PCR Free data.
2013-08-18 00:51:32 -04:00
droazen ee5de8510d Merge pull request #380 from broadinstitute/gg_gatkdocs_arglabels
More detailed labels for arguments in the gakdocs
2013-08-16 15:34:56 -07:00
Geraldine Van der Auwera 80ed186971 More detailed labels for arguments in the gakdocs (requested by David) 2013-08-16 14:25:53 -04:00
Geraldine Van der Auwera 9bb0aac7bf Disabled the help system's printout of cmdline options when GATK errors out. Now the user has to explicitly ask for it using -h. 2013-08-16 13:09:52 -04:00
Geraldine Van der Auwera 3841635fcb Changed 'depreciated' to the more correct 'deprecated' 2013-08-16 13:06:41 -04:00
Eric Banks 08be871309 Removing unused code in VariantsToTable: GQ is not an INFO field and is taken care of by -GF and not -F. 2013-08-16 01:57:24 -04:00
Eric Banks 1a5e4cc4e7 Merge pull request #375 from broadinstitute/rp_queue_jobreport_rscript
Something changed with the ggtitle syntax in the latest version of ggplo...
2013-08-14 12:48:42 -07:00
Geraldine Van der Auwera 19a4bf9ff0 made AR an Advanced argument to discourage basic users from fiddling with it 2013-08-14 14:46:56 -04:00
Ryan Poplin d4ac183580 Something changed with the ggtitle syntax in the latest version of ggplot2. 2013-08-14 14:40:03 -04:00
Mauricio Carneiro 765f5450ac Updated Full Processing Pipeline
* add interleaved fastq option to sam2fastq
    * add optional adapter trimming path
    * add "skip_revert" option to skip reverting the bams (sometimes useful -- hidden parameter)
    * add a walker that reads in one bam file and outputs N bam files, one for each read group in the original bam. This is a very important step in any BAM reprocessing pipeline.

I am using this new pipeline to process the CEU and YRI PCR Free WGS
trios.
2013-08-13 23:35:32 -04:00
Geraldine Van der Auwera a09831489b Disabled emission of doc URLs for external codecs to avoid broken links 2013-08-10 10:04:04 -07:00
Geraldine Van der Auwera 4d20c71e09 Improvements to various gatkdocs
- Make -rod required
    - Document that contaminationFile is currently not functional with HC
    - Document liftover process more clearly
    - Document VariantEval combinations of ST and VE that are incompatible
    - Added a caveat about using MVLR from HC and UG.
    - Added caveat about not using -mte with -nt
    - Clarified masking options
    - Fixed docs based on Erics comments
2013-08-10 10:01:31 -07:00
kshakir 1f86cf13d1 Merge pull request #359 from lbergelson/lb_relax_add_parameter
Trivial update to QScript.scala
2013-08-07 06:45:01 -07:00
Mark DePristo 7aba5a2f9f Several improvements to AssessNA12878 and KB
-- Bugfix for BAMs containing reads without real (M,I,D,N) operators.  Simply needed to set validation stringency to SILENT in the read. Added a BadCigar filter to the SAMRecord stream anyway
-- Add capture all sites mode to AssessNA12878: will write all sites to the badSites VCF, regardless of whether they are bad.  It's useful if you essentially want to annotate a VCF with KB information for later analysis, such as computing ROC curves
-- Add ignore filters mode to AssessNA12878: will as expected treat all sites in the input VCF calls as PASS, even if the site has a FILTER field setting
-- Add minPNonRef argument to AssessNA12878: this will consider a site not called even if the NA12878 genotype is not 0/0 if the PLs are present and the PL for 0/0 isn't greater than this value.  It allows us to easily differentiate low confidence non-ref sites obtained via multi-sample calling from highly confident non-ref calls that might be real TP or FPs
2013-08-07 08:08:37 -04:00
lbergelson af36c7ce9a Update QScript.scala
Relaxing addAll parameter type from Seq to Traversable to make it slightly more flexible.
2013-08-02 14:09:26 -04:00
Mauricio Carneiro 285ab2ac62 Better caching for the HaplotypeCaller
Problem
-------
Caching strategy is incompatible with the current sorting of the haplotypes, and is rendering the cache nearly useless.

Before the PairHMM updates, we realized that a lexicographically sorted list of haplotypes would optimize the use of the cache. This was only true until we've added the initial condition to the first row of the deletion matrix, which depends on the length of the haplotype. Because of that, every time the haplotypes differ in length, the cache has to be wiped. A lexicographic sorting of the haplotypes will put different lengths haplotypes clustered together therefore wasting *tons* of re-compute.

Solution
-------
Very simple. Sort the haplotypes by LENGTH and then in lexicographic order.
2013-08-02 01:27:29 -04:00
Yossi Farjoun 284176cd7b moved SnpEffUtilUnitTest to public tree 2013-07-30 17:51:40 -04:00
droazen b8709b1942 Merge pull request #332 from broadinstitute/st_fpga_hmm
FPGA support for PairHMM
2013-07-30 14:21:21 -07:00
Joseph Rose d2860a5486 Adding a representation of the hierarchy of flags output by snpEff (Yossi) and a stratifier whose output states are coding regions, genes, stop_gain, stop_lost and splice sites, all determined by the snpEff hierarchy (J. Rose) 2013-07-30 15:38:32 -04:00
Chris Hartl 464a5b229d Add <pre> tags to the Genotype Concordance docs. Tables were not being displayed properly. 2013-07-29 15:48:17 -07:00
Geraldine Van der Auwera 3063d82797 Fixed example in CallableLoci gatkdoc 2013-07-26 15:51:31 -04:00
Geraldine Van der Auwera fc4a8b1dd0 Fixed example in DoC gatkdoc 2013-07-26 15:51:30 -04:00
Geraldine Van der Auwera 660b075900 Added deprecation notice for SomaticIndelDetector 2013-07-26 15:51:30 -04:00
Geraldine Van der Auwera 5ad99c362d Added caveat to gatkdocs for MAPQ read transformers & cleaned up AB annotation gatkdocs 2013-07-26 15:51:30 -04:00
Geraldine Van der Auwera 0ea3f8ca58 Added function to gatkdocs to specify what VCF field an annotation goes in (INFO or FORMAT) 2013-07-26 15:51:30 -04:00
Ryan Poplin 8c205dda1b Automatically order the annotation dimensions in the VQSR by their standard deviation instead of the order they were specified on the command line. 2013-07-26 10:22:43 -04:00
Louis Bergelson 7c43b5f26a Adding LibraryReadFilter.
--Moving LibraryReadFilter which has been part of Mutect into gatk public.
--Added an additional check for null values.
2013-07-26 09:32:14 -04:00
Mauricio Carneiro 31ab0824b1 quick indentation fixes to FPGA code 2013-07-24 14:09:49 -04:00
Eric Banks 6df43f730a Fixing ReadBackedPileup to represent mapping qualities as ints, not (signed) bytes.
Having them as bytes caused problems for downstream programmers who had data with high MQs.
2013-07-23 23:47:15 -04:00
David Roazen 605a5ac2e3 GATK engine: add ability to do on-the-fly BAM file sample renaming at runtime
-User must provide a mapping file via new --sample_rename_mapping_file argument.
 Mapping file must contain a mapping from absolute bam file path to new sample name
 (format is described in the docs for the argument).

-Requires that each bam file listed in the mapping file contain only one sample
 in their headers (they may contain multiple read groups for that sample, however).
 The engine enforces this, and throws a UserException if on-the-fly renaming is
 requested for a multi-sample bam.

-Not all bam files for a traversal need to be listed in the mapping file.

-On-the-fly renaming is done as the VERY first step after creating the SAMFileReaders
 in SAMDataSource (before the headers are even merged), to prevent possible consistency
 issues.

-Renaming is done ONCE at traversal start for each SAMReaders resource creation in the
 SAMResourcePool; this effectively means once per -nt thread

-Comprehensive unit/integration tests

Known issues: -if you specify the absolute path to a bam in the mapping file, and then
               provide a path to that same bam to -I using SYMLINKS, the renaming won't
               work. The absolute paths will look different to the engine due to the
               symlink being present in one path and not in the other path.

GSA-974 #resolve
2013-07-18 15:48:42 -04:00
David Roazen c15751e41e SAMReaderID: fix bug with hash code and equals() method
-Two SAMReaderIDs that pointed at the same underlying bam file through
 a relative vs. an absolute path were not being treated as equal, and
 had different hash codes. This was causing problems in the engine, since
 SAMReaderIDs are often used as the keys of HashMaps.

-Fix: explicitly use the absolute path to the encapsulated bam file in
 hashCode() and equals()

-Added tests to ensure this doesn't break again
2013-07-15 13:57:00 -04:00
sathibault 0a8f75b953 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
2013-07-15 08:17:32 -05:00
Eric Banks b16c7ce050 A whole slew of improvements to the Haplotype Caller and related code.
1. Some minor refactorings and claenup (e.g. removing unused imports) throughout.

2. Updates to the KB assessment functionality:
   a. Exclude duplicate reads when checking to see whether there's enough coverage to make a call.
   b. Lower the threshold on FS for FPs that would easily be filtered since it's only single sample calling.

3. Make the HC consistent in how it treats the pruning factor.  As part of this I removed and archived
   the DeBruijn assembler.

4. Improvements to the likelihoods for the HC
   a. We now include a "tristate" correction in the PairHMM (just like we do with UG).  Basically, we need
      to divide e by 3 because the observed base could have come from any of the non-observed alleles.
   b. We now correct overlapping read pairs.  Note that the fragments are not merged (which we know is
      dangerous).  Rather, the overlapping bases are just down-weighted so that their quals are not more
      than Q20 (or more specifically, half of the phred-scaled PCR error rate); mismatching bases are
      turned into Q0s for now.
   c. We no longer run contamination removal by default in the UG or HC.  The exome tends to have real
      sites with off kilter allele balances and we occasionally lose them to contamination removal.

5. Improved the dangling tail merging implementation.
2013-07-12 10:09:10 -04:00
Menachem Fromer a8ea57df9e Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-07-10 16:44:35 -04:00
Eric Banks 5dbb582be7 Merge pull request #310 from broadinstitute/mc_interval_list_to_fastq
Walker to create a fastq file from an interval list
2013-07-08 14:30:43 -07:00
Valentin Ruano Rubio ac77a4c699 Merge pull request #316 from broadinstitute/md_filter_counting
Bugfix for counting of applied filters
2013-07-08 10:58:47 -07:00
Eric Banks 921f551426 AnalyzeCovariates is no longer a deprecated tool. 2013-07-08 09:48:12 -04:00
Eric Banks 5f5c90e65c Fix bug introduced recently in the VariantAnnotator where only the last -comp was being annotated at a site.
Trivial fix, added integration test to cover it.
2013-07-05 00:04:52 -04:00
David Roazen 6d69c7dc71 Disable RetryMemoryLimit pipeline test
-This test is failing intermittently for unexplained reasons (see GSA-943)

-In the interest of keeping the rest of the pipeline test suite running, it's
 best to disable this one test until GSA-943 is resolved
2013-07-03 13:38:28 -04:00
Mark DePristo 3db02e5ef1 Merge pull request #315 from broadinstitute/md_ref_conf_hc
Reference confidence model for the haplotype caller
2013-07-02 13:04:33 -07:00
Mark DePristo 7be01777f6 Bugfix for incPos in GenomeLoc
-- Shouldn't have taken a GenomeLoc as an argument, as it's a instance method, not a public static
2013-07-02 15:46:49 -04:00
Mark DePristo e3e8631ff5 Working version of HaplotypeCaller ReferenceConfidenceModel that accounts for indels as well as SNP confidences
-- Assembly graph building now returns an object that describes whether the graph was successfully built and has variation, was succesfully built but didn't have variation, or truly failed in construction.  Fixing an annoying bug where you'd prefectly assembly the sequence into the reference graph, but then return a null graph because of this, and you'd increase your kmer because it null was also used to indicate assembly failure
--
-- Output format looks like:
20      10026072        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026073        .       A       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,119
20      10026074        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,121
20      10026075        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,119
20      10026076        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026077        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026078        .       C       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:5,0:5:15:0,15,217
20      10026079        .       A       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:6,0:6:18:0,18,240
20      10026080        .       G       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:6,0:6:18:0,18,268
20      10026081        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:7,0:7:21:0,21,267

We use a symbolic allele to indicate that the site is hom-ref, and because we have an ALT allele we can provide AD and PL field values.  Currently these are calculated as ref vs. any non-ref value (mismatch or insertion) but doesn't yet account properly for alignment uncertainty.
-- Can we enabled for single samples with --emitRefConfidence (-ERC).
-- This is accomplished by realigning the each read to its most likley haplotype, and then evaluting the resulting pileups over the active region interval.  The realignment is done by the HaplotypeBAMWriter, which now has a generalized interface that lets us provide a ReadDestination object so we can capture the realigned reads
-- Provide access to the more raw LocusIteratorByState constructor so we can more easily make them programmatically without constructing lots of misc. GATK data structures.  Moved the NO_DOWNSAMPLING constant from LIBSDownsamplingInfo to LocusIteratorByState so clients can use it without making LIBSDownsamplingInfo a public class.
-- Includes GVCF writer
-- Add 1 mb of WEx data to private/testdata
-- Integration tests for reference model output for WGS and WEx data
-- Emit GQ block information into VCF header for GVCF mode
-- OutputMode from StandardCallerArgumentCollection moved to UnifiedArgumentCollection as its no longer relevant for HC
-- Control max indel size for the reference confidence model from the command line.  Increase default to 10
-- Don't use out_mode in HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest
-- Unittests for ReferenceConfidenceModel
-- Unittests for new MathUtils functions
2013-07-02 15:46:38 -04:00
Mark DePristo 41aba491c0 Critical bugfix for adapter clipping in HaplotypeCaller
-- The previous code would adapter clip before reverting soft clips, so because we only clip the adapter when it's actually aligned (i.e., not in the soft clips) we were actually not removing bases in the adapter unless at least 1 bp of the adapter was aligned to the reference.  Terrible.
-- Removed the broken logic of determining whether a read adaptor is too long.
-- Doesn't require isProperPairFlag to be set for a read to be adapter clipped
-- Update integration tests for new adapter clipping code
2013-07-02 15:46:36 -04:00
David Roazen cdea744b95 Improve -dcov documentation to address recent user confusion
-Explicitly state that -dcov does not produce an unbiased random sampling from all available reads
 at each locus, and that instead it tries to maintain an even representation of reads from
 all alignment start positions (which, of course, is a form of bias)

-Recommend -dfrac for users who want a true across-the-board unbiased random sampling
2013-07-02 15:33:28 -04:00
Mark DePristo 9df58314ab Bugfix for counting of applied filters
-- Because LocusWalkers have multiple filtering streams, each counting filtering independent, and the close() function set calling setFilter on the global result, not on the private counter, which is incorporated into the global (thereby incrementing the counts of each filter).
-- [delivers #52667213]
2013-07-01 21:09:48 -04:00
David Roazen c3d59d890d Update licenses for new PbsEngine* classes 2013-07-01 15:50:20 -04:00
Khalid Shakir ec206eccfc Switch "all" test pipeline job runners to mean the job runners that run at The Broad. 2013-07-01 15:12:55 -04:00
Francesco acf90ca027 corrected number of arguments passed to PbsEngineJobRunner when requesting multiple cores
Signed-off-by: Khalid Shakir <kshakir@broadinstitute.org>
2013-07-01 15:08:15 -04:00
Francesco 948b2fca20 added PbsEngine plugin into engine folders, to be called in Queue with -jobRunner PbsEngine; the plugin is written modifying the existing GridEngine plugin, used as a template
Signed-off-by: Khalid Shakir <kshakir@broadinstitute.org>
2013-07-01 15:08:14 -04:00
Mauricio Carneiro 815f119f7c Walker to create a fastq file from an interval list
useful to convert bait and target interval lists into actual sequences that we can align with bwa and test for mappability.
2013-06-29 11:24:16 -04:00
David Roazen 31827022db Fix pipeline tests that were not respecting the pipeline test dry run setting
There are a few pipeline test classes that do not run Queue, but are
classified as pipeline tests because they submit farm jobs. Make these
unconventional pipeline tests respect the pipeline test dry run setting.
2013-06-28 15:27:17 -04:00
Scott Thibault 82dcdc01c0 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java
2013-06-28 10:13:05 -05:00
David Roazen 94294ed6c4 Move DownsampleReadsQC walker to private 2013-06-25 15:48:44 -04:00
Eric Banks 165b936fcd Fixing the 'header is negative' problem in Reduce Reads... again.
Previous fixes and tests only covered trailing soft-clips.  Now that up front
hard-clipping is working properly though, we were failing on those in the tool.

Added a patch for this as well as a separate test independent of the soft-clips
to make sure that it's working properly.
2013-06-24 14:06:21 -04:00
Mark DePristo fdfe4e41d5 Better GATK version and command line output
-- Previous version emitted command lines that look like:

##HaplotypeCaller="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] ..."

the new version provides additional information on when the GATK was run and the GATK version in a nicer format:

 ##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] read_buffer_size=null phone_home=AWS ...">

 -- Additionally, the command line options are emitted sequentially in the file, so you can see a running record of how a VCF was produced, such as this example from the integration test:

 ##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="lots of stuff">
 ##GATKCommandLine=<ID=SelectVariants,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:16:23 EDT 2013",Epoch=1371741383277,CommandLineOptions="lots of stuff">

 -- Removed the ProtectedEngineFeaturesIntegrationTest
 -- Actual unit tests for these features!
2013-06-20 11:19:13 -04:00
Mark DePristo 0672ac5032 Fix public / protected dependency 2013-06-19 19:42:09 -04:00
Valentin Ruano-Rubio 1f8282633b Removed plots generation from the BaseRecalibration software
Improved AnalyzeCovariates (AC) integration test.
Renamed AC test files ending with .grp to .table

Implementation:

* Removed RECAL_PDF/CSV_FILE from RecalibrationArgumentCollection (RAC). Updated rest of the code accordingly.
* Fixed BQSRIntegrationTest to work with new changes
2013-06-19 14:47:56 -04:00
Valentin Ruano-Rubio 08f92bb6f9 Added AnalyzeCovariates tool to generate BQSR assessment quality plots.
Implemtation details:

* Added tool class *.AnalyzeCovariates
* Added convenient addAll method to Utils to be able to add elements of an array.
* Added parameter comparison methods to RecalibrationArgumentCollection class in order to verify that multiple imput recalibration report are compatible and comparable.
* Modified the BQSR.R script to handle up to 3 different recalibration tables (-BQSR, -before and -after) and removed some irrelevant arguments (or argument values) from the output.
* Added an integration test class.
2013-06-19 14:38:02 -04:00
Mark DePristo fb114e34fe Merge pull request #295 from broadinstitute/dr_remove_PrintReads_ds_argument
PrintReads: remove -ds argument
2013-06-19 10:55:10 -07:00
droazen 573ecadecc Merge pull request #294 from broadinstitute/dr_handle_zero_length_cigar_elements
SAMDataSource: always consolidate cigar strings into canonical form
2013-06-19 10:32:22 -07:00
David Roazen 51ec5404d4 SAMDataSource: always consolidate cigar strings into canonical form
-Collapses zero-length and repeated cigar elements, neither of which
 can necessarily be handled correctly by downstream code (like LIBS).

-Consolidation is done before read filters, because not all read filters
 behave correctly with non-consoliated cigars.

-Examined other uses of consolidateCigar() throughout the GATK, and
 found them to not be redundant with the new engine-level consolidation
 (they're all on artificially-created cigars in the HaplotypeCaller
 and SmithWaterman classes)

-Improved comments in SAMDataSource.applyDecoratingIterators()

-Updated MD5s; differences were examined and found to be innocuous

-Two tests: -Unit test for ReadFormattingIterator
            -Integration test for correct handling of zero-length
             cigar elements by the GATK engine as a whole
2013-06-19 13:29:01 -04:00
David Roazen 23ee192d5e PrintReads: remove -ds argument
-This argument was completely redundant with the engine-level -dfrac
 argument.

-Could produce unintended consequences if used in conjunction with
 engine-level downsampling arguments.
2013-06-19 13:22:44 -04:00
David Roazen 0be788f0f9 Fix typo in snpEff documentation 2013-06-19 13:15:24 -04:00
Chris Hartl af275fdf10 Extend the documentation of GenotypeConcordance to include notes about Monomorphic and Filtered VCF records.
Address Geraldine's comments - information on moltenization and explanation of fields

Fix paren
2013-06-19 12:01:58 -04:00
Mark DePristo 15171c07a8 CatVariants accepts reference files ending in any standard extension
-- [resolves #49339235] Make CatVariants accept reference files ending in .fa (not only .fasta)
2013-06-19 11:10:36 -04:00
MauricioCarneiro 6a5502c94a Merge pull request #289 from broadinstitute/md_fix_bq
Bugfix: defaultBaseQualities actually works now
2013-06-18 11:58:39 -07:00
Mark DePristo 7b22467148 Bugfix: defaultBaseQualities actually works now
-- It was being applied in the wrong order (after the first call to the underlying MalformedReadFilter) so if your first read was malformed you'd blow up there instead of being fixed properly.  Added integration tests to ensure this continues to work.
-- [delivers #49538319]
2013-06-17 14:37:27 -04:00
Guillermo del Angel f6025d25ae Feature requested by Reich lab and Paavo lab in Leipzig for ancient DNA processing:
-- When doing cross-species comparisons and studying population history and ancient DNA data, having SOME measure of confidence is needed at every single site that doesn't depend on the reference base, even in a naive per-site SNP mode. Old versions of GATK provided GQ and some wrong PL values at reference sites but these were wrong. This commit addresses this need by adding a new UG command line argument, -allSitePLs, that, if enabled will:
a) Emit all 3 ALT snp alleles in the ALT column.
b) Emit all corresponding 10 PL values.
It's up to the user to process these PL values downstream to make sense of these. Note that, in order to follow VCF spec, the QUAL field in a reference call when there are non-null ALT alleles present will be zero, so QUAL will be useless and filtering will need to be done based on other fields.
-- Tweaks and fixes to processing pipelines for Reich lab.
2013-06-17 13:21:09 -04:00
Mark DePristo b69d210255 Bugfix: allow gzip VCF output in multi-threaded GATK output
-- VariantContextWriterStorage was gzipping the intermediate files that would be merged in, but the mergeInto function couldn't read those outputs, and we'd throw a very strange error. Now tmp. VCFs aren't compressed, even if the final VCF is.  Added integrationtest to ensure this behavior works going forward.
-- [delivers #47399279]
2013-06-17 12:39:18 -04:00
delangel 485ceb1e12 Merge pull request #283 from broadinstitute/md_beagleoutput
Simpler FILTER and info field encoding for BeagleOutputToVCF
2013-06-17 09:31:03 -07:00
James Warren f46f7d9b23 deducing dictionary path should not use global find and replace
Signed-off-by: David Roazen <droazen@broadinstitute.org>
2013-06-14 19:15:27 -04:00
Mark DePristo 1677a0a458 Simpler FILTER and info field encoding for BeagleOutputToVCF
-- Previous version created FILTERs for each possible alt allele when that site was set to monomorphic by BEAGLE.  So if you had a A/C SNP in the original file and beagle thought it was AC=0, then you'd get a record with BGL_RM_WAS_A in the FILTER field.  This obviously would cause problems for indels, as so the tool was blowing up in this case.  Now beagle sets the filter field to BGL_SET_TO_MONOMORPHIC and sets the info field annotation OriginalAltAllele to A instead.  This works in general with any type of allele.
 -- Here's an example output line from the previous and current versions:
 old: 20    64150   rs7274499       C       .       3041.68 BGL_RM_WAS_A    AN=566;DB;DP=1069;Dels=0.00;HRun=0;HaplotypeScore=238.33;LOD=3.5783;MQ=83.74;MQ0=0;NumGenotypesChanged=1;OQ=1949.35;QD=10.95;SB=-6918.88
 new: 20    64062   .       G       .       100.39  BGL_SET_TO_MONOMORPHIC  AN=566;DP=1108;Dels=0.00;HRun=2;HaplotypeScore=221.59;LOD=-0.5051;MQ=85.69;MQ0=0;NumGenotypesChanged=1;OQ=189.66;OriginalAltAllele=A;QD=15.81;SB=-6087.15
-- update MD5s to reflect these changes
-- [delivers #50847721]
2013-06-14 15:56:13 -04:00
David Roazen d167292688 Reduce number of leftover temp files in GATK runs
-WalkerTest now deletes *.idx files on exit

-ArtificialBAMBuilder now deletes *.bai files on exit

-VariantsToBinaryPed walker now deletes its temp files on exit
2013-06-14 15:56:03 -04:00
Ryan Poplin c4e508a71f Merge pull request #275 from broadinstitute/md_fragment_with_pcr
Improvements to HaplotypeCaller and NA12878 KB
2013-06-14 09:32:26 -07:00
droazen ac346a93ba Merge pull request #278 from broadinstitute/md_gatk_version_in_vcf
Emit the GATK version number in the VCF header
2013-06-13 13:22:20 -07:00
Mark DePristo 908183aba7 Merge pull request #277 from broadinstitute/dr_fix_com_sun_dependency
Remove com.sun.javadoc.* dependencies from the GATK proper, and isolate them for doclet use only
2013-06-13 13:12:45 -07:00
David Roazen f9c986be74 Remove com.sun.javadoc.* dependencies from the GATK proper, and isolate them for doclet use only
Problem:
Classes in com.sun.javadoc.* are non-standard. Since we can't depend on their availability for
all users, the GATK proper should not have any runtime dependencies on this package.

Solution:
-Isolate com.sun.javadoc.* dependencies in a DocletUtils class for use only by doclets. The
 only users who need to run our doclets are those who compile from source, and they
 should be competent enough to figure out how to resolve a missing com.sun.* dependency.

-HelpUtils now contains no com.sun.javadoc.* dependencies and can be safely used by walkers/other
 tools.

-Added comments with instructions on when it is safe to use DocletUtils vs. HelpUtils

[delivers #51450385]
[delivers #50387199]
2013-06-13 15:52:41 -04:00
Mark DePristo 74f311c973 Emit the GATK version number in the VCF header
-- Looks like ##GATKVersion=2.5-159-g3f91d93 in the VCF header line
-- delivers [#51595305]
2013-06-13 15:46:16 -04:00
Mark DePristo 6232db3157 Remove STANDARD option from GATKRunReport
-- AWS is now the default.  Removed old code the referred to the STANDARD type.  Deleted unused variables and functions.
2013-06-13 15:18:28 -04:00
Mark DePristo dd5674b3b8 Add genotyping accuracy assessment to AssessNA12878
-- Now table looks like:

Name     VariantType  AssessmentType           Count
variant  SNPS         TRUE_POSITIVE              1220
variant  SNPS         FALSE_POSITIVE                0
variant  SNPS         FALSE_NEGATIVE                1
variant  SNPS         TRUE_NEGATIVE               150
variant  SNPS         CALLED_NOT_IN_DB_AT_ALL       0
variant  SNPS         HET_CONCORDANCE          100.00
variant  SNPS         HOMVAR_CONCORDANCE        99.63
variant  INDELS       TRUE_POSITIVE               273
variant  INDELS       FALSE_POSITIVE                0
variant  INDELS       FALSE_NEGATIVE               15
variant  INDELS       TRUE_NEGATIVE                79
variant  INDELS       CALLED_NOT_IN_DB_AT_ALL       2
variant  INDELS       HET_CONCORDANCE           98.67
variant  INDELS       HOMVAR_CONCORDANCE        89.58

-- Rewrite / refactored parts of subsetDiploidAlleles in GATKVariantContextUtils to have a BEST_MATCH assignment method that does it's best to simply match the genotype after subsetting to a set of alleles.  So if the original GT was A/B and you subset to A/B it remains A/B but if you subset to A/C you get A/A.  This means that het-alt B/C genotypes become A/B and A/C when subsetting to bi-allelics which is the convention in the KB.  Add lots of unit tests for this functions (from 0 previously)
-- BadSites in Assessment now emits TP sites with discordant genotypes with the type GENOTYPE_DISCORDANCE and tags the expected genotype in the info field as ExpectedGenotype, such as this record:

20      10769255        .       A       ATGTG   165.73  .       ExpectedGenotype=HOM_VAR;SupportingCallsets=ebanks,depristo,CEUTrio_best_practices;WHY=GENOTYPE_DISCORDANCE     GT:AD:DP:GQ:PL  0/1:1,9:10:6:360,0,6

Indicating that the call was a HET but the expected result was HOM_VAR
-- Forbid subsetting of diploid genotypes to just a single allele.
-- Added subsetToRef as a separate specific function.  Use that in the DiploidExactAFCalc in the case that you need to reduce yourself to ref only. Preserves DP in the genotype field when this is possible, so a few integration tests have changed for the UG
2013-06-13 15:05:32 -04:00
Mark DePristo dd6e252373 GATKRunReport no longer tries to use the Broad filesystem destination, rather it goes unconditionally to S3 2013-06-13 13:33:10 -04:00
Ryan Poplin f44efc27ae Relaxing the constraints on the readIsPoorlyModelled function.
-- Turns out we were aggressively throwing out borderline-good reads.
2013-06-13 11:06:23 -04:00
sathibault 336050ab71 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java
2013-06-13 07:28:24 -05:00
Mark DePristo b2dc7095ab Merge pull request #267 from broadinstitute/dr_reducereads_downsampling_fix
Exclude reduced reads from elimination during downsampling
2013-06-11 13:52:28 -07:00
David Roazen 95b5f99feb Exclude reduced reads from elimination during downsampling
Problem:
-Downsamplers were treating reduced reads the same as normal reads,
 with occasionally catastrophic results on variant calling when an
 entire reduced read happened to get eliminated.

Solution:
-Since reduced reads lack the information we need to do position-based
 downsampling on them, best available option for now is to simply
 exempt all reduced reads from elimination during downsampling.

Details:
-Add generic capability of exempting items from elimination to
 the Downsampler interface via new doNotDiscardItem() method.
 Default inherited version of this method exempts all reduced reads
 (or objects encapsulating reduced reads) from elimination.

-Switch from interfaces to abstract classes to facilitate this change,
 and do some minor refactoring of the Downsampler interface (push
 implementation of some methods into the abstract classes, improve
 names of the confusing clear() and reset() methods).

-Rewrite TAROrderedReadCache. This class was incorrectly relying
 on the ReservoirDownsampler to preserve the relative ordering of
 items in some circumstances, which was behavior not guaranteed by
 the API and only happened to work due to implementation details
 which no longer apply. Restructured this class around the assumption
 that the ReservoirDownsampler will not preserve relative ordering
 at all.

-Add disclaimer to description of -dcov argument explaining that
 coverage targets are approximate goals that will not always be
 precisely met.

-Unit tests for all individual downsamplers to verify that reduced
 reads are exempted from elimination
2013-06-11 16:16:26 -04:00
Eric Banks dadcfe296d Reworking of the dangling tails merging code.
We now run Smith-Waterman on the dangling tail against the corresponding reference tail.
If we can generate a reasonable, low entropy alignment then we trigger the merge to the
reference path; otherwise we abort.  Also, we put in a check for low-complexity of graphs
and don't let those pass through.

Added tests for this implementation that checks exact SW results and correct edges added.
2013-06-11 12:53:04 -04:00
Mark DePristo 1c03ebc82d Implement ActiveRegionTraversal RefMetaDataTracker for map call; HaplotypeCaller now annotates ID from dbSNP
-- Reuse infrastructure for RODs for reads to implement general IntervalReferenceOrderedView so that both TraverseReads and TraverseActiveRegions can use the same underlying infrastructure
-- TraverseActiveRegions now provides a meaningful RefMetaDataTracker to ActiveRegionWalker.map
-- Cleanup misc. code as it came up
-- Resolves GSA-808: Write general utility code to do rsID allele matching, hook up to UG and HC
2013-06-10 16:20:31 -04:00
Mark DePristo 0d593cff70 Refactor rsID and overlap detection in VariantOverlapAnnotator utility class
-- Variants will be considered matching if they have the same reference allele and at least 1 common alternative allele.  This matching algorithm determines how rsID are added back into the VariantContext we want to annotate, and as well determining the overlap FLAG attribute field.
-- Updated VariantAnnotator and VariantsToVCF to use this class, removing its old stale implementation
-- Added unit tests for this VariantOverlapAnnotator class
-- Removed GATKVCFUtils.rsIDOfFirstRealVariant as this is now better to use VariantOverlapAnnotator
-- Now requires strict allele matching, without any option to just use site annotation.
2013-06-10 15:51:13 -04:00
Valentin Ruano-Rubio 96073c3058 This commit addresses JIRA issue GSA-948: Prevent users from doing the wrong thing with RNA-Seq data and the GATK.
The previous behavior is to process reads with N CIGAR operators as they are despite that many of the tools do not actually support such operator and results become unpredictible.

Now if the there is some read with the N operator, the engine returns a user exception. The error message indicates what is the problem (including the offending read and mapping position) and give a couple of alternatives that the user can take in order to move forward:

a) ask for those reads to be filtered out (with --filter_reads_with_N_cigar or -filterRNC)

b) keep them in as before (with -U ALLOW_N_CIGAR_READS or -U ALL)

Notice that (b) does not have any effect if (a) is enacted; i.e. filtering overrides ignoring.

Implementation:

* Added filterReadsWithMCigar argument to MalformedReadFilter with the corresponding changes in the code to get it to work.
* Added ALLOW_N_CIGAR_READS unsafe flag so that N cigar containing reads can be processed as they are if that is what the user wants.
* Added ReadFilterTest class commont parent for ReadFilter test cases.
* Refactor ReadGroupBlackListFilterUnitTest to extend ReadFilterTest and push up some functionality to that class.
* Modified MalformedReadFilterUnitTest to extend ReadFilterTest and to test the new filter functionality.
* Added AllowNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALLOW_N_CIGAR_READS flag is used.
* Added UnsafeNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALL flag is used.
* Updated a broken test case in UnifiedGenotyperIntegrationTest resulting from the new behavior.
* Updated EngineFeaturesIntegrationTest testdata to be compliant with new behavior
2013-06-10 10:44:42 -04:00
Michael McCowan 00c06e9e52 Performance improvements:
- Memoized MathUtil's cumulative binomial probability function.
 - Reduced the default size of the read name map in reduced reads and handle its resets more efficiently.
2013-06-09 11:26:52 -04:00
Mark DePristo 34bdf20132 Bugfix for bad AD values in UG/HC
-- In the case where we have multiple potential alternative alleles *and* we weren't calling all of them (so that n potential values < n called) we could end up trimming the alleles down which would result in the mismatch between the PerReadAlleleLikelihoodMap alleles and the VariantContext trimmed alleles.
-- Fixed by doing two things (1) moving the trimming code after the annotation call and (2) updating AD annotation to check that the alleles in the VariantContext and the PerReadAlleleLikelihoodMap are concordant, which will stop us from degenerating in the future.
-- delivers [#50897077]
2013-06-05 17:48:41 -04:00
Mark DePristo e19c24f3ee Bugfix for HaplotypeCaller error: Only one of refStart or refStop must be < 0, not both
-- This occurred because we were reverting reads with soft clips that would produce reads with negative (or 0) alignment starts.  From such reads we could end up with adaptor starts that were negative and that would ultimately produce the "Only one of refStart or refStop must be < 0, not both" error in the FragmentUtils merging code (which would revert and adaptor clip reads).
-- We now hard clip away bases soft clipped reverted bases that fall before the 1-based contig start in revertSoftClippedBases.
-- Replace buggy cigarFromString with proper SAM-JDK call TextCigarCodec.getSingleton().decode(cigarString)
-- Added unit tests for reverting soft clipped bases that create a read before the contig
-- [delivers #50892431]
2013-06-04 10:33:46 -04:00
Ryan Poplin ab40f4af43 Break out the GGA kmers and the read kmers into separate functions for the DeBruijn assembler.
-- Added unit test for new function.
2013-06-03 14:00:35 -04:00
sathibault de2a2a4cc7 Added command-line flag to disble FPGA
Completed integration with FPGA driver
2013-06-03 07:30:32 -05:00
Mark DePristo 6555361742 Fix error in merging code in HC
-- Ultimately this was caused by an underlying bug in the reverting of soft clipped bases in the read clipper.  The read clipper would fail to properly set the alignment start for reads that were 100% clipped before reverting, such as 10H2S5H => 10H2M5H.  This has been fixed and unit tested.
-- Update 1 ReduceReads MD5, which was due to cases where we were clipping away all of the MATCH part of the read, leaving a cigar like 50H11S and the revert soft clips was failing to properly revert the bases.
-- delivers #50655421
2013-05-31 16:29:29 -04:00
Mark DePristo 4b206a3540 Check that -compress arguments are within range 0-9
-- Although the original bug report was about SplitSamFile it actually was an engine wide error.  The two places in the that provide compression to the BAM write now check the validity of the compress argument via a static method in ReadUtils
-- delivers #49531009
2013-05-31 15:29:02 -04:00
Eric Banks a96f48bc39 Merge pull request #249 from broadinstitute/rp_hc_gga_mode
New implementation of the GGA mode in the HaplotypeCaller
2013-05-31 10:54:50 -07:00
droazen a665d759cd Merge pull request #251 from broadinstitute/md_mapq_reassign
Command-line read filters are now applied before Walker default filters
2013-05-31 09:05:24 -07:00
Ryan Poplin b5b9d745a7 New implementation of the GGA mode in the HaplotypeCaller
-- We now inject the given alleles into the reference haplotype and add them to the graph.
-- Those paths are read off of the graph and then evaluated with the appropriate marginalization for GGA mode.
-- This unifies how Smith-Waterman is performed between discovery and GGA modes.
-- Misc minor cleanup in several places.
2013-05-31 10:35:36 -04:00
Chris Hartl 199476eae1 Three squashed commits:
1) Add in checks for input parameters in MathUtils method. I was careful to use the bottom-level methods whenever possible, so that parameters don't needlessly go through multiple checks (so for instance, the parameters n and k for a binomial aren't checked on log10binomial, but rather in the log10binomialcoefficient subroutine).

This addresses JIRA GSA-767

Unit tests pass (we'll let bamboo deal with the integrations)

2) Address reviewer comments (change UserExceptions to IllegalArgumentExceptions).

3) .isWellFormedDouble() tests for infinity and not strictly positive infinity. Allow negative-infinity values for log10sumlog10 (as these just correspond to p=0).

After these commits, unit and integration tests now pass, and GSA-767 is done.

rebase and fix conflict:

public/java/src/org/broadinstitute/sting/utils/MathUtils.java
2013-05-31 00:26:50 -04:00
Mark DePristo b16de45ce4 Command-line read filters are now applied before Walker default filters
-- This allows us to use -rf ReassignMappingQuality to reassign mapping qualities to 60 *before* the BQSR filters them out with MappingQualityUnassignedFilter.
-- delivers #50222251
2013-05-30 16:54:18 -04:00
Ryan Poplin 61af37d0d2 Create a new normalDistributionLog10 function that is unit tested for use in the VQSR. 2013-05-30 16:00:08 -04:00
Mark DePristo 56b14be4bc Merge pull request #247 from broadinstitute/eb_fix_RR_negative_header_problem
Fix for the "Removed too many insertions, header is now negative" bug in ReduceReads.
2013-05-29 18:10:19 -07:00
Eric Banks a5a68c09fa Fix for the "Removed too many insertions, header is now negative" bug in ReduceReads.
The problem ultimately was that ReadUtils.readStartsWithInsertion() ignores leading hard/softclips, but
ReduceReads does not.  So I refactored that method to include a boolean argument as to whether or not
clips should be ignored.  Also rebased so that return type is no longer a Pair.
Added unit test to cover this situation.
2013-05-29 16:41:01 -04:00
David Roazen eb206e9f71 Fix confusing log output from the engine
-ReadShardBalancer was printing out an extra "Loading BAM index data for next contig"
 message at traversal end, which was confusing users and making the GATK look stupid.
 Suppress the extraneous message, and reword the log messages to be less confusing.

-Improve log message output when initializing the shard iterator in GenomeAnalysisEngine.
 Don't mention BAMs when the are none, and say "Preparing for traversal" rather than
 mentioning the meaningless-for-users concept of "shard strategy"

-These log messages are needed because the operations they surround might take a
 while under some circumstances, and the user should know that the GATK is actively
 doing something rather than being hung.
2013-05-29 16:17:04 -04:00
Mark DePristo 684c91c2e7 Merge pull request #245 from broadinstitute/dr_enforce_min_dcov
Require a minimum dcov value of 200 for Locus and ActiveRegion walkers when downsampling to coverage
2013-05-29 09:52:13 -07:00
David Roazen a7cb599945 Require a minimum dcov value of 200 for Locus and ActiveRegion walkers when downsampling to coverage
-Throw a UserException if a Locus or ActiveRegion walker is run with -dcov < 200,
 since low dcov values can result in problematic downsampling artifacts for locus-based
 traversals.

-Read-based traversals continue to have no minimum for -dcov, since dcov for read traversals
 controls the number of reads per alignment start position, and even a dcov value of 1 might
 be safe/desirable in some circumstances.

-Also reorganize the global downsampling defaults so that they are specified as annotations
 to the Walker, LocusWalker, and ActiveRegionWalker classes rather than as constants in the
 DownsamplingMethod class.

-The default downsampling settings have not been changed: they are still -dcov 1000
 for Locus and ActiveRegion walkers, and -dt NONE for all other walkers.
2013-05-29 12:07:12 -04:00
Mauricio Carneiro 38e765f00d Somehow the index of exampleDBSNP.vcf was missing
This was missed when we added all the indices of our testdata
2013-05-28 15:29:43 -04:00
Mark DePristo d167743852 Archived banded logless PairHMM
BandedHMM
---------
-- An implementation of a linear runtime, linear memory usage banded logless PairHMM.  Thought about 50% faster than current PairHMM, this implementation will be superceded by the GraphHMM when it becomes available.  The implementation is being archived for future reference

Useful infrastructure changes
-----------------------------
-- Split PairHMM into a N2MemoryPairHMM that allows smarter implementation to not allocate the double[][] matrices if they don't want, which was previously occurring in the base class PairHMM
-- Added functionality (controlled by private static boolean) to write out likelihood call information to a file from inside of LikelihoodCalculationEngine for using in unit or performance testing.  Added example of 100kb of data to private/testdata.  Can be easily read in with the PairHMMTestData class.
-- PairHMM now tracks the number of possible cell evaluations, and the LoglessCachingPairHMM updates the nCellsEvaluated so we can see how many cells are saved by the caching calculation.
2013-05-22 12:24:00 -04:00
delangel 925232b0fc Merge pull request #236 from broadinstitute/md_simple_hc_performance_improvements
3 simple performance improvements for HaplotypeCaller
2013-05-22 07:58:28 -07:00
Eric Banks 881b2b50ab Optimized counting of filtered records by filter.
Don't map class to counts in the ReadMetrics (necessitating 2 HashMap lookups for every increment).
Instead, wrap the ReadFilters with a counting version and then set those counts only when updating global metrics.
2013-05-21 21:54:49 -04:00
Mark DePristo 010034a650 Optimization/bugfix for PerReadAlleleLikelihoodMap
-- Add() call had a misplaced map.put call, so that we were always putting the result of get() back into the map, when what we really intended was to only put the value back in if the original get() resulted in a null and so initialized the result
2013-05-21 16:18:57 -04:00
Mark DePristo a1093ad230 Optimization for ActiveRegion.removeAll
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion.  This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element.   New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set.  Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
2013-05-21 16:18:57 -04:00
Mark DePristo d9cdc5d006 Optimization: track alleles in the PerReadAlleleLikelihoodMap with a HashSet
-- The previous version of PerReadAlleleLikelihoodMap only stored the alleles in an ArrayList, and used ArrayList.contains() to determine if an allele was already present in the map.  This is very slow with many alleles.  Now keeps both the ArrayList (for get() performance) and a Set of alleles for contains().
2013-05-21 16:18:56 -04:00
Eric Banks 20c7a89030 Fixes to get accurate read counts for Read traversals
1. Don't clone the dataSource's metrics object (because then the engine won't continue to get updated counts)
 2. Use the dataSource's metrics object in the CountingFilteringIterator and not the first shard's object!
 3. Synchronize ReadMetrics.incrementMetrics to prevent race conditions.

Also:
 * Make sure users realize that the read counts are approximate in the print outs.
 * Removed a lot of unused cruft from the metrics object while I was in there.
 * Added test to make sure that the ReadMetrics read count does not overflow ints.
 * Added unit tests for traversal metrics (reads, loci, and active region traversals); these test counts of reads and records.
2013-05-21 15:24:07 -04:00
Eric Banks 58f4b81222 Count Reads should use a Long instead of an Integer for counts to prevent overflows. Added unit test. 2013-05-21 15:23:51 -04:00
Mark DePristo 62fc88f92e CombineVariants no longer adds PASS to unfiltered records
-- [Delivers #49876703]
-- Add integration test and test file
-- Update SymbolicAlleles combine variant tests, which was turning unfiltered records into PASS!
2013-05-20 16:53:51 -04:00
Mauricio Carneiro c8b1c47764 Updating gsalib for R-3.0 compatibility
* add package namespace that exports all the visible objects
   * list gsalib dependencies in the package requirements

[fixes #49987933]
2013-05-18 12:43:38 -04:00
Eric Banks 8a442d3c9f @Output needs to be required for LiftoverVariants to prevent a NPE and documentation needed updating. 2013-05-17 10:04:10 -04:00
Yossi Farjoun 3e2a0b15ed - Added a @Hidden option ( -outputInsertLength ) to PileupWalker that causes it to emit insert sizes together with the pileup (to assist Mark Daly's investigation of the contamination dependance on insert length)
- Converted my old GATKBAMIndexText (within PileupWalkerIntegrationTest) to use a dataProvider
- Added two integration tests to test -outputInsertLength option
2013-05-16 12:47:16 -04:00
Mark DePristo 371f3752c1 Subshard timeouts in the GATK
-- The previous implementation of the maxRuntime would require us to wait until all of the work was completed within a shard, which can be a substantial amount of work in the case of a locus walker with 16kb shards.
-- This implementation ensures that we exit from the traversal very soon after the max runtime is exceeded, without completely all of our work within the shard.  This is done by updating all of the traversal engines to return false for hasNext() in the nano scheduled input provider.  So as soon as the timeout is exceeeded, we stop generating additional data to process, and we only have to wait until the currently executing data processing unit (locus, read, active region) completes.
-- In order to implement this timeout efficiently at this fine scale, the progress meter now lives in the genome analysis engine, and the exceedsTimeout() call in the engine looks at a periodically updated runtime variable in the meter.  This variable contains the elapsed runtime of the engine, but is updated by the progress meter daemon thread so that the engine doesn't call System.nanotime() in each cycle of the engine, which would be very expense.  Instead we basically wait for the daemon to update this variable, and so our precision of timing out is limited by the update frequency of the daemon, which is on the order of every few hundred milliseconds, totally fine for a timeout.
-- Added integration tests to ensure that subshard timeouts are working properly
2013-05-15 07:00:39 -04:00
Mark DePristo 43e78286a0 Merge pull request #226 from broadinstitute/hc_ceu_trio_calling
Trivial update to ceutrio.ped file to make it really the CEU trio samples
2013-05-14 17:02:52 -07:00
Yossi Farjoun 409a202492 Merge pull request #214 from broadinstitute/chartl_genotype_concordance_diploid_and_OGC
Add overall genotype concordance to the genotype concordance tool. In ad...
2013-05-14 14:19:54 -07:00
Mark DePristo 7d78a77f17 Trivial update to ceutrio.ped file to make it really the CEU trio sample names 2013-05-14 17:08:13 -04:00
Menachem Fromer de54223aed Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-14 10:15:21 -04:00
Mark DePristo 39e4396de0 New ActiveRegionShardBalancer allows efficient NanoScheduling
-- Previously we used the LocusShardBalancer for the haplotype caller, which meant that TraverseActiveRegions saw its shards grouped in chunks of 16kb bits on the genome.  These locus shards are useful when you want to use the HierarchicalMicroScheduler, as they provide fine-grained accessed to the underlying BAM, but they have two major drawbacks (1) we have to fairly frequently reset our state in TAR to handle moving between shard boundaries and (2) with the nano scheduled TAR we end up blocking at the end of each shard while our threads all finish processing.
-- This commit changes the system over to using an ActiveRegionShardBalancers, that combines all of the shard data for a single contig into a single combined shard.  This ensures that TAR, and by extensions the HaplotypeCaller, gets all of the data on a single contig together so the the NanoSchedule runs efficiently instead of blocking over and over at shard boundaries.  This simple change allows us to scale efficiently to around 8 threads in the nano scheduler:
  -- See https://www.dropbox.com/s/k7f280pd2zt0lyh/hc_nano_linear_scale.pdf
  -- See https://www.dropbox.com/s/fflpnan802m2906/hc_nano_log_scale.pdf
-- Misc. changes throughout the codebase so we Use the ActiveRegionShardBalancer where appropriate.
-- Added unit tests for ActiveRegionShardBalancer to confirm it does the merging as expected.
-- Fix bad toString in FilePointer
2013-05-13 11:09:02 -04:00
Mark DePristo b4f482a421 NanoScheduled ActiveRegionTraversal and HaplotypeCaller
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
  -- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
  -- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
2013-05-13 11:09:02 -04:00
Eric Banks 2f5ef6db44 New faster Smith-Waterman implementation that is edge greedy and assumes that ref and haplotype have same global start/end points.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
   * A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
     right thing for indels at the edges of the alignments.
     * Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
   * Lots of systematic testing added for this implementation.
   * NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
2013-05-13 09:36:39 -04:00
David Roazen 639030bd6d Enable convenient display of diff engine output in Bamboo, plus misc. minor test-related improvements
-Diff engine output is now included in the actual exception message thrown as a
 result of an MD5 mismatch, which allows it to be conveniently viewed on the
 main page of a build in Bamboo.

Minor Additional Improvements:

-WalkerTestSpec now auto-detects test class name via new JVMUtils.getCallingClass()
 method, and the test class name is now included as a regular part of integration
 test output for each test.

-Fix race condition in MD5DB.ensureMd5DbDirectory()

-integrationtests dir is now cleaned by "ant clean"

GSA-915 #resolve
2013-05-10 19:00:33 -04:00
Mark DePristo fa8a47ceef Replace DeBruijnAssembler with ReadThreadingAssembler
Problem
-------
The DeBruijn assembler was too slow.  The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp).  This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.

Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers.  The algorithm operates as follows:

identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
  find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
  for each base in the sequence from the starting vertex kmer:
    look at the existing outgoing nodes of current vertex V.  If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
    If no matching next vertex exists, find a unique vertex with kmer K.  If one exists, merge the sequence into this vertex, and continue
    If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue

This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size.  This allows us to assemble well with even very short kmers.

This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:

-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples.  This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor.  This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization.  This change is essential for us to get good variants from our paths when the kmer size is small.  It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation.  Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary.  This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler

Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations.  This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate.  Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
2013-05-08 21:41:42 -04:00
Chris Hartl d3c9910af6 Cosmetic changes (comments and variable names) to GenotypeConcordance and ConcordanceMetrics to address reviewer comments. 2013-05-08 17:25:14 -04:00
sathibault d79b5f0931 Adding Convey HC-1 HMM acceleration 2013-05-08 11:01:20 -05:00
Mark DePristo 2b86ab02be Improve queue script jobreport visualization script
-- the Queue jobreport PDF script now provides a high-level summary of the de-scattered runtimes of each analysis, so that its easy to see where your script is spending its time across scatters.
2013-05-07 12:11:46 -04:00
Menachem Fromer 86287dce76 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-06 13:52:55 -04:00
Chris Hartl 6ff74deac7 Add overall genotype concordance to the genotype concordance tool. In addition, protect from non-diploid genotypes, which can cause very strange behavior.
Update MD5 sums. As expected, md5 changes are consistent with the genotype concordance field being added to each output.
2013-05-06 13:06:30 -04:00
chartl 98021db264 Merge pull request #208 from broadinstitute/yf_fix_molten_GenotypeConcordance
- Fixed a small bug in the printout of molten data in GenotypeConcordanc...
2013-05-06 08:42:06 -07:00
Menachem Fromer 78e958bf39 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-06 10:39:21 -04:00
Mark DePristo f42bb86bdd e# This is a combination of 2 commits.
Only try to clip adaptors when both reads of the pair are on opposite strands

-- Read pairs that have unusual alignments, such as two reads both oriented like:

  <-----
     <-----

where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs.  This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
2013-05-03 11:19:14 -04:00
Mark DePristo 0587a145bf Utils.dupString should allow 0 number of duplicates to produce empty string 2013-05-03 09:32:05 -04:00
Mark DePristo f5a301fb63 Bugfix for AlignmentUtils.trimCigarByBases
-- Previous version would trim down 2M2D2M into 2M if you asked for the first 2 bases, but this can result in incorrect alignment of the bases to the reference as the bases no longer span the full reference interval expected.  Fixed and added unit tests
2013-05-03 09:32:05 -04:00
Mark DePristo 2bcbdd469f leftAlignCigarSequentially now supports haplotypes with insertions and deletions where the deletion allele was previously removed by the leftAlignSingleIndel during it's cleanup phase. 2013-05-03 09:32:05 -04:00
Eric Banks d981fd01b8 Now that we don't generate dict and fai files, the resource script needs to copy them to the bundle. 2013-05-02 15:18:13 -04:00
David Roazen 13bfa963da Revert changes to exampleFASTA.fasta.fai for now to get tests passing again 2013-05-02 12:59:20 -04:00
Eric Banks f88a964e2c Adding .fai file to example fasta since we don't generate it anymore 2013-05-02 10:54:32 -04:00
Eric Banks 6d0e383a60 Fixing the bundle script
1. someone out there busted it when adding high confidence 1000G calls
2. new path to NA12878 bam
3. updated clashing version argument
2013-05-02 09:40:36 -04:00
Yossi Farjoun 4b8b411b92 - Fixed a small bug in the printout of molten data in GenotypeConcordance
Output didn't "mix-up" the genotypes, it outputed the same HET vs HET (e.g.) 3 times rather than the combinations of HET vs {HET, HOM, HOM_REF}, etc.
This was only a problem in the text, _not_ the actual numbers, which were outputted correctly.

- Updated MD5's after looking at diffs to verify that the change is what I expected.
2013-05-02 09:16:07 -04:00
David Roazen f3c94a3c87 Update expected test output for Java 7
-Changes in Java 7 related to comparators / sorting produce a large number
 of innocuous differences in our test output. Updating expectations now
 that we've moved to using Java 7 internally.

-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
 intermittent failures.
2013-05-01 16:18:01 -04:00
David Roazen f57256b6c2 Delete unused FastaSequenceIndexBuilder class and accompanying test
This class, being unused, was no longer getting packaged into the
GATK release jar by bcel, and so attempting to run its unit test
on the release jar was producing an error.
2013-05-01 01:02:01 -04:00
Eric Banks 58424e56be Setting the reduce reads count tag was all wrong in a previous commit; fixing.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly.  Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.

The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly.  Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).

Also:
1. counts are now maintained as ints whenever possible.  Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
2013-04-30 13:45:42 -04:00
Mark DePristo 73fcacbf1b Change Long to long 2013-04-30 09:21:10 -04:00
Yossi Farjoun 0e7e6d35d8 GATKBAMIndex calls buffer.length() on every read. This is causing much pain.
Optimized by getting the read of the file upon opening the index-file and using that instead.
2013-04-29 12:49:02 -04:00
Mark DePristo 0387ea8df9 Bugfix for ReadClipper with ReducedReads
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts.  Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly.  Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
2013-04-29 11:12:09 -04:00
Mark DePristo 759c531d1b Merge pull request #197 from broadinstitute/dr_disable_snpeff_version_check
Add support for snpEff "GATK compatibility mode" (-o gatk)
2013-04-26 13:55:14 -07:00
David Roazen 7d90bbab08 Add support for snpEff "GATK compatibility mode" (-o gatk)
-Do not throw an exception when parsing snpEff output files
 generated by not-officially-supported versions of snpEff,
 PROVIDED that snpEff was run with -o gatk

-Requested by the snpEff author

-Relevant integration tests updated/expanded
2013-04-26 15:47:15 -04:00
Mark DePristo 071fd67d55 Merge pull request #193 from broadinstitute/eb_contamination_fixing_for_reduced_reads
Eb contamination fixing for reduced reads
2013-04-26 09:48:45 -07:00
Mark DePristo 92a6c7b561 Merge pull request #195 from broadinstitute/eb_exclude_sample_file_bug_in_select_variants
Fixed bug reported on the forum where using the --exclude_sample_file ar...
2013-04-26 09:47:38 -07:00
Eric Banks 360e2ba87e Fixed bug reported on the forum where using the --exclude_sample_file argument in SV was giving bad results.
Added integration test.
https://www.pivotaltracker.com/s/projects/793457/stories/47399245
2013-04-26 12:23:11 -04:00
Eric Banks ba2c3b57ed Extended the allele-biased down-sampling functionality to handle reduced reads.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.

Added lots of unit tests for new functionality.
2013-04-26 11:23:17 -04:00
Mark DePristo 528c3d083a Merge pull request #191 from broadinstitute/dr_fix_rod_system_locking
Detect stuck lock-acquisition calls, and disable file locking for tests
2013-04-25 09:32:54 -07:00
Mark DePristo d20be41fee Bugfix for FragmentUtils.mergeOverlappingPairedFragments
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences.  If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference.  Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
2013-04-25 11:11:15 -04:00
David Roazen 4d56142163 Detect stuck lock-acquisition calls, and disable file locking for tests
-Acquire file locks in a background thread with a timeout of 30 seconds,
 and throw a UserException if a lock acquisition call times out

    * should solve the locking issue for most people provided they
      RETRY failed farm jobs

    * since we use NON-BLOCKING lock acquisition calls, any call that
      takes longer than a second or two indicates a problem with the
      underlying OS file lock support

    * use daemon threads so that stuck lock acquisition tasks don't
      prevent the JVM from exiting

-Disable both auto-index creation and file locking for integration tests
 via a hidden GATK argument --disable_auto_index_creation_and_locking_when_reading_rods

    * argument not safe for general use, since it allows reading from
      an index file without first acquiring a lock

    * this is fine for the test suite, since all index files already
      exist for test files (or if they don't, they should!)

-Added missing indices for files in private/testdata

-Had to delete most of RMDTrackBuilderUnitTest, since it mostly tested auto-index
 creation, which we can't test with locking disabled, but I replaced the deleted
 tests with some tests of my own.

-Unit test for FSLockWithShared to test the timeout feature
2013-04-24 22:49:02 -04:00
Eric Banks 379a9841ce Various bug fixes for recent Reduce Reads additions plus solution implemented for low MQ reads.
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions.  Then we get the
best of both worlds.  As a note, coverage refers to just the individual base counts and not the entire pileup.

2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.

3. Each consensus keeps track of its own number of softclipped bases.  There was no reason that that number
should be shared between them.

4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now.  Don't lose that
information.  Maybe we'll decide to change this in the future, but for now we are conservative.

5. Also implemented various small performance optimizations based on profiling.

Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
2013-04-24 18:18:50 -04:00
Eric Banks 3f52f55c55 Merge pull request #186 from broadinstitute/md_libs_canonical_cigar
Performance optimizations and caliper benchmarks code for consolidateCigar
2013-04-24 12:58:32 -07:00
Ryan Poplin 80131ac996 Adding the 1000G_phase1.snps.high_confidence callset to the GATK resource bundle for use in the April 2013 updated best practices. 2013-04-24 11:41:32 -04:00
Mark DePristo df90597bfc Performance optimizations and caliper benchmarking code for consolidateCigar
-- Now that this function is used in the core of LIBS it needed some basic optimizations, which are now complete, pass all unit tests.
-- Added caliper benchmark for AlignmentUtils to assess performance (showing new version is 3x-10x faster)
-- Remove unused import in ReadStateManager
2013-04-24 11:36:43 -04:00
Eric Banks 3477e092ea Minor: bump up the amount of cached log10 data in MathUtils so that Monkol can actually call 50K samples. 2013-04-19 08:39:08 -04:00
Eric Banks 5bce0e086e Refactored binomial probability code in MathUtils.
* Moved redundant code out of UGEngine
  * Added overloaded methods that assume p=0.5 for speed efficiency
  * Added unit test for the binomialCumulativeProbability method
2013-04-16 18:19:07 -04:00
Eric Banks df189293ce Improve compression in Reduce Reads by incorporating probabilistic model and global het compression
The Problem:
  Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
  regions in an exome) causes RR (with default settings) to consider it a variant region.  This
  seriously hurts compression performance.

The Solution:
  1. We now use a probabilistic model for determining whether we can create a consensus (in other
  words, whether we can error correct a site) instead of the old ratio threshold.  We calculate
  the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
  that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
  2. We also allow het compression globally, not just at known sites.  So if we cannot create a
  consensus at a given site then we try to perform het compression; and if we cannot perform het
  compression that we just don't reduce the variant region.  This way very wonky regions stay
  uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
  locus get het compressed.

Details:
  1. -minvar is now deprecated in favor of -min_pvalue.
  2. Added integration test for bad pvalue input.
  3. -known argument still works to force het compression only at known sites; if it's not included
     then we allow het compression anywhere.  Added unit tests for this.
  4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
     Before finalizing het compression, we now check for insertions or other variant regions (usually due
     to multi-allelics) which can render a region incompressible (and we back out if we find one).  We
     were checking for excessive softclips before, but now we add these tests too.
  5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
     consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
     out instead of backing out all of them.
  6. We no longer create a mini read at the stop of the variant window for het compression.  Instead, we
     allow it to be part of the next global consensus.
  7. The coverage test is no longer run systematically on all integration tests because the quals test
     supercedes it.  The systematic quals test is now much stricter in order to catch bugs and edge cases
     (very useful!).
  8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
     for a consensus was affected by good and bad bases/reads).
  9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
     This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
  10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
     with insertions from a header.

Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
2013-04-16 18:19:06 -04:00
Geraldine Van der Auwera e176fc3af1 Merge pull request #159 from broadinstitute/md_bqsr_ion
Trivial BQSR bug fixes and improvement
2013-04-16 08:54:47 -07:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Guillermo del Angel a971e7ab6d Several improvements to ReadAdaptorTrimmer so that it can be incorporated into ancient DNA processing pipelines (for which it was developed):
-- Add pair cleaning feature. Reads in query-name sorted order are required and pairs need to appear consecutively, but if -cleanPairs option is set, a malformed pair where second read is missing is just skipped instead of erroring out.
-- Add integration tests
-- Move walker to public
2013-04-13 13:41:36 -04:00
Mauricio Carneiro a063e79597 Updating the exampleGRP.grp test file
It had been generated with an old version of BQSRv2 and wasn't compatible with exampleBAM anymore.
2013-04-13 09:07:13 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mauricio Carneiro 3960733c88 Fix PrintReads out of space issue
Problem:
--------
Print Reads was running out of disk space when using the -BQSR option even for small bam files

Solution:
---------
Configure setupWriter to expect pre sorted reads
2013-04-09 08:19:52 -04:00
Mark DePristo 1b36db8940 Make ActiveRegionTraversal robust to excessive coverage
-- Add a maximum per sample and overall maximum number of reads held in memory by the ART at any one time.  Does this in a new TAROrderedReadCache data structure that uses a reservior downsampler to limit the total number of reads to a constant amount.  This constant is set to be by default 3000 reads * nSamples to a global maximum of 1M reads, all controlled via the ActiveRegionTraversalParameters annotation.
-- Added an integration test and associated excessively covered BAM excessiveCoverage.1.121484835.bam (private/testdata) that checks that the system is operating correctly.
-- #resolves GSA-921
2013-04-08 15:48:19 -04:00
Mark DePristo 317dc4c323 Add size() method to Downsampler interface
-- This method provides client with the current number of elements, without having to retreive the underlying list<T>.  Added unit tests for LevelingDownsampler and ReservoirDownsampler as these are the only two complex ones.  All of the others are trivially obviously correct.
2013-04-08 15:48:13 -04:00
Mark DePristo 21410690a2 Address reviewer comments 2013-04-08 12:48:20 -04:00
Mark DePristo 6d22485a4c Critical bugfix to ReduceRead functionality of the GATKSAMRecord
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5].  The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding.  Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i.  Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
2013-04-08 12:47:50 -04:00
Mark DePristo 3a19266843 Fix residual merge conflicts 2013-04-08 12:47:50 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 7105ad65a6 Remove the capability of EventMap to emit symbolic alleles for unassembled events
-- These events always occur on the very edge of the haplotypes, and are intrinsically dodgy.  So instead of emitting them and then potentially having to deal with merging real basepair events into them we just no longer emit those events.
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 167cd49e71 Added -forceActive argument to ActiveRegionWalkers
-- Causes the ART tool to treat all bases as active.   Useful for debugging
2013-04-08 12:47:48 -04:00
Mark DePristo 8656bd5e29 Haplotype now consolidates cigars in setCigar
-- This fixes edge base bugs where non-consolidated cigars are causing problems in users of the Haplotype object.  Input arguments are now checks (let's see if we blow up)
2013-04-08 12:47:47 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mark DePristo b7d59ea13b LIBS unit test debugging should be false 2013-04-08 12:47:47 -04:00
Guillermo del Angel c9d3c67a9b Small Queue/scala improvements, and commiting pipeline scripts developed for ancient DNA processing for posterity:
-- Picard extension so Queue scripts can use FastqToSam
-- Single-sample BAM processing: merge/trim reads + BWA + IR + MD + BQSR. Mostly identical to standard pipeline,
except for the adaptor trimming/merging which is critical for short-insert libraries.
-- Single-sample calling (experimental, work in progress): standard UG run but outputting at all sites, meant for
deep whole genomes.

New scripts
2013-04-08 11:52:13 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Eric Banks 6253ba164e Using --keepOriginalAC in SelectVariants was causing it to emit bad VCFs
* This occurred when one or more alleles were lost from the record after selection
  * Discussed here: http://gatkforums.broadinstitute.org/discussion/comment/4718#Comment_4718
  * Added some integration tests for --keepOriginalAC (there were none before)
2013-04-05 00:53:28 -04:00
Eric Banks 7897d52f32 Don't allow users to specify keys and IDs that contain angle brackets or equals signs (not allowed in VCF spec).
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
  * This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
  * Added integration test to confirm failure with User Error
  * Removed illegal header line in KB test VCF that was causing related tests to fail.
2013-04-05 00:52:32 -04:00
Eric Banks 14bbba0980 Optimization to method for getting values in ArgumentMatch
* Very trivial, but I happened to see this code and it drove me nuts so I felt compelled to refactor it.
  * Instead of iterating over keys in map to get the values, just iterate over the values...
2013-04-04 23:30:47 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
David Roazen 2eac97a76c Remove auto-creation of fai/dict files for fasta references
-A UserException is now thrown if either the fai or dict file for the
 reference does not exist, with pointers to instructions for creating
 these files.

-Gets rid of problematic file locking that was causing intermittent
 errors on our farm.

-Integration tests to verify that correct exceptions are thrown in
 the case of a missing fai / dict file.

GSA-866 #resolve
2013-04-02 18:34:08 -04:00
Mark DePristo e7a8e6e8ee Merge pull request #140 from broadinstitute/dr_interval_intersection_bug_GSA-909
Intervals: fix bug where we could fail to find the intersection of unsorted/missorted interval lists
2013-04-02 11:59:01 -07:00
David Roazen 5baf906c28 Intervals: fix bug where we could fail to find the intersection of unsorted/missorted interval lists
-The algorithm for finding the intersection of two sets of intervals
 relies on the sortedness of the intervals within each set, but the engine
 was not sorting the intervals before attempting to find the intersection.

-The result was that if one or both interval lists was unsorted / lexicographically
 sorted, we would often fail to find the intersection correctly.

-Now the IntervalBinding sorts all sets of intervals before returning them,
 solving the problem.

-Added an integration test for this case.

GSA-909 #resolve
2013-04-02 14:01:52 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Mark DePristo 7c83efc1b9 Merge pull request #135 from broadinstitute/mc_pgtag_fix
Fixing @PG tag uniqueness issue
2013-03-31 11:36:40 -07:00
Guillermo del Angel 9686e91a51 Added small feature to VariantFiltration to filter sites outside of a given mask:
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
2013-03-31 08:48:16 -04:00
Mauricio Carneiro ec475a46b1 Fixing @PG tag uniqueness issue
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".

How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.

Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter

Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31

Issue Tracker:
--------------
[fixes 47100885]
2013-03-30 20:31:33 -04:00
Mauricio Carneiro 52e67a6973 ReviewedStingException -> IllegalStateException 2013-03-30 20:11:55 -04:00
Guillermo del Angel 6b8bed34d0 Big bad bug fix: feature added to LeftAlignAndTrimVariants to left align multiallelic records didn't work.
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
2013-03-30 19:31:28 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
Guillermo del Angel 8fbf9c947f Upgrades and changes to LeftAlignVariants, motivated by 1000G consensus indel production:
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
2013-03-29 10:02:06 -04:00
Chris Hartl 73d1c319bf Rarely-occurring logic bugfix for GenotypeConcordance, streamlining and testing of MathUtils
Currently, the multi-allelic test is covering the following case:

Eval   A   T,C
Comp   A   C

reciprocate this so that the reverse can be covered.

Eval   A   C
Comp   A   T,C

And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.

This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:

Eval:   A  G,T      0/0   2/0   2/2   1/1
Comp:   A  C,T      0/0   1/0   0/0   0/0

Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:

Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)

Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.

Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
 - dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
 - vectorSum
 - array shuffle, random subset
 - countOccurances (general forms, the char form is used in the codebase)
 - getNMaxElements
 - array permutation
 - sorted array permutation
 - compare floats
 - sum() (for integer arrays and lists).

Final keyword was extensively added to MathUtils.

The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).

The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.

In addition, more extensive tests were added for
 - logBinomialCoefficient (Newton's identity should always hold)
 - logFactorial
 - log10sumlog10 and its approximation

All unit tests pass
2013-03-28 23:25:28 -04:00
MauricioCarneiro a2b69790a6 Merge pull request #128 from broadinstitute/eb_rr_polyploid_compression_GSA-639 2013-03-28 06:39:43 -07:00
Mark DePristo 12475cc027 Display the active MappingQualityFilter if mmq > 0 in the HaplotypeCaller 2013-03-26 14:27:18 -04:00
Mark DePristo ad04fdb233 PerReadAlleleLikelihoodMap getMostLikelyAllele returns an MostLikelyAllele objects now
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users.  The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not.  That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves.  There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second.  For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads.   All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event.  In this case our annotations will all fall apart, returning their default values.  Added a JIRA to address this (should be discussed in group meeting)
2013-03-26 14:27:13 -04:00
Eric Banks 593d3469d4 Refactored the het (polyploid) consensus creation in ReduceReads.
* It is now cleaner and easier to test; added tests for newly implemented methods.
 * Many fixes to the logic to make it work
   * The most important change was that after triggering het compression we actually need to back it out if it
      creates reads that incorporated too many softclips at any one position (because they get unclipped).
   * There was also an off-by-one error in the general code that only manifested itself with het compression.
 * Removed support for creating a het consensus around deletions (which was broken anyways).
   * Mauricio gave his blessing for this.
 * Het compression now works only against known sites (with -known argument).
    * The user can pass in one or more VCFs with known SNPs (other variants are ignored).
    * If no known SNPs are provided het compression will automatically be disabled.
 * Added SAM tag to stranded (i.e. het compressed) reduced reads to distinguish their
   strandedness from normal reduced reads.
    * GATKSAMRecord now checks for this tag when determining whether or not the read is stranded.
    * This allows us to update the FisherStrand annotation to count het compressed reduced reads
       towards the FS calculation.
    * [It would have been nice to mark the normal reads as unstranded but then we wouldn't be
       backwards compatible.]
    * Updated integration tests accordingly with new het compressed bams (both for RR and UG).
 * In the process of fixing the FS annotation I noticed that SpanningDeletions wasn't handling
   RR properly, so I fixed it too.
    * Also, the test in the UG engine for determining whether there are too many overlapping
       deletions is updated to handle RR.
 * I added a special hook in the RR integration tests to additionally run the systematic
   coverage checking tool I wrote earlier.
    * AssessReducedCoverage is now run against all RR integration tests to ensure coverage is
       not lost from original to reduced bam.
    * This helped uncover a huge bug in the MultiSampleCompressor where it would drop reads
       from all but 1 sample (now fixed).
    * AssessReducedCoverage moved from private to protected for packaging reasons.
 * #resolve GSA-639

At this point, this commit encompasses most of what is needed for het compression to go live.
There are still a few TODO items that I want to get in before the 2.5 release, but I will save
those for a separate branch because as it is I feel bad for the person who needs to review all
these changes (sorry, Mauricio).
2013-03-25 09:34:54 -04:00
Mauricio Carneiro eb33da6820 Added support to reduce reads to Callable Loci
-- added calls to representativeCount() of the pileup instead of using ++
-- renamed CallableLoci integration test
-- added integration test for reduce read support on callable loci
2013-03-21 15:53:04 -04:00
Mark DePristo 7ae15dadbe HC now by default only uses reads with MAPQ >= 20 for assembly and calling
-- Previously we tried to include lots of these low mapping quality reads in the assembly and calling, but we effectively were just filtering them out anyway while generating an enormous amount of computational expense to handle them, as well as much larger memory requirements.  The new version simply uses a read filter to remove them upfront.  This causes no major problems -- at least, none that don't have other underlying causes -- compared to 10-11mb of the KB
-- Update MD5s to reflect changes due to no longer including mmq < 20 by default
2013-03-21 13:10:50 -04:00
Mark DePristo 3a8f001c27 Misc. fixes upon pull request review
-- DeBruijnAssemblerUnitTest and AlignmentUtilsUnitTest were both in DEBUG = true mode (bad!)
-- Remove the maxHaplotypesToConsider feature of HC as it's not useful
2013-03-20 22:54:37 -04:00
Mark DePristo 98c4cd060d HaplotypeCaller now uses SeqGraph instead of kmer graph to build haplotypes.
-- DeBruijnAssembler functions are no longer static.  This isn't the right way to unit test your code
-- An a HaplotypeCaller command line option to use low-quality bases in the assembly
-- Refactored DeBruijnGraph and associated libraries into base class
-- Refactored out BaseEdge, BaseGraph, and BaseVertex from DeBruijn equivalents.  These DeBruijn versions now inherit from these base classes.  Added some reasonable unit tests for the base and Debruijn edges and vertex classes.
-- SeqVertex: allows multiple vertices in the sequence graph to have the same sequence and yet be distinct
-- Further refactoring of DeBruijnAssembler in preparation for the full SeqGraph <-> DeBruijnGraph split
-- Moved generic methods in DeBruijnAssembler into BaseGraph
-- Created a simple SeqGraph that contains SeqVertex objects
-- Simple chain zipper for SeqGraph that reproduces the results for the mergeNode function on DeBruijnGraphs
-- A working version of the diamond remodeling algorithm in SeqGraph that converts graphs that look like A -> Xa, A -> Ya, Xa -> Z, Ya -> Z into A -> X -> a, A -Y -> a, a -> Z
-- Allow SeqGraph zip merging of vertices where the in vertex has multiple incoming edges or the out vertex has multiple outgoing edges
-- Fix all unit tests so they work with the new SeqGraph system.  All tests passed without modification.
-- Debugging makes it easier to tell which kmer graph contributes to a haplotype
-- Better docs and unit tests for BaseVertex, SeqVertex, BaseEdge, and KMerErrorCorrector
-- Remove unnecessary printing of cleaning info in BaseGraph
-- Turn off kmer graph creation in DeBruijnAssembler.java
-- Only print SeqGraphs when debugGraphTransformations is set to true
-- Rename DeBruijnGraphUnitTest to SeqGraphUnitTest.  Now builds DeBruijnGraph, converts to SeqGraph, uses SeqGraph.mergenodes and tests for equality.
-- Update KBestPathsUnitTest to use SeqGraphs not DebruijnGraphs
-- DebruijnVertex now longer takes kmer argument -- it's implicit that the kmer length is the sequence.length now
2013-03-20 22:54:36 -04:00
Mark DePristo ffea6dd95f HaplotypeCaller now has the ability to only consider the best N haplotypes for genotyping
-- Added a -dontGenotype mode for testing assembly efficiency
-- However, it looks like this has a very negative impact on the quality of the results, so the code should be deleted
2013-03-20 22:54:36 -04:00
Mark DePristo a8fb26bf01 A generic downsampler that reduces coverage for a bunch of reads
-- Exposed the underlying minElementsPerStack parameter for LevelingDownsampler
2013-03-20 22:54:35 -04:00
Mark DePristo 752440707d AlignmentUtils.calcNumDifferentBases computes the number of bases that differ between a reference and read sequence given a cigar between the two. 2013-03-20 22:54:35 -04:00
Geraldine Van der Auwera d70bf64737 Created new DeprecatedToolChecks class
--Based on existing code in GenomeAnalysisEngine
	--Hashmaps hold mapping of deprecated tool name to version number and recommended replacement (if any)
	--Using FastUtils for maps; specifically Object2ObjectMap but there could be a better type for Strings...
	--Added user exception for deprecated annotations
	--Added deprecation check to AnnotationInterfaceManager.validateAnnotations
	--Run when annotations are initialized
	--Made annotation sets instead of lists
2013-03-20 06:46:02 -04:00
Geraldine Van der Auwera 6b4d88ebe9 Created ListAnnotations utility (extends CommandLineProgram)
--Refactored listAnnotations basic method out of VA into HelpUtils
	--HelpUtils.listAnnotations() is now called by both VA and the new ListAnnotations utility (lives in sting.tools)
	--This way we keep the VA --list option but we also offer a way to list annotations without a full valid VA command-line, which was a pain users continually complained about
	--We could get rid of the VA --list option altogether ...?
2013-03-20 06:15:27 -04:00
Geraldine Van der Auwera 95a9ed853d Made some documentation updates & fixes
--Mostly doc block tweaks
	--Added @DocumentedGATKFeature to some walkers that were undocumented because they were ending up in "uncategorized". Very important for GSA: if a walker is in public or protected, it HAS to be properly tagged-in. If it's not ready for the public, it should be in private.
2013-03-20 06:15:20 -04:00
Mark DePristo d7bec9eb6e AssessNA12878 bugfixes
-- @Output isn't required for AssessNA12878
-- Previous version would could non-variant sites in NA12878 that resulted from subsetting a multi-sample VC to NA12878 as CALLED_BUT_NOT_IN_DB sites.  Now they are properly skipped
-- Bugfix for subsetting samples to NA12878.  Previous version wouldn't trim the alleles when subsetting down a multi-sample VCF, so we'd have false FN/FP sites at indels when the multi-sample VCF has alleles that result in the subset for NA12878 having non-trimmed alleles.  Fixed and unit tested now.
2013-03-18 15:48:08 -04:00
Ami Levy-Moonshine 0e9c1913ff fix typos in argument docs and in printed output in CoveredByNSamplesSites and rewrite an unaccurate comment 2013-03-18 13:54:21 -04:00
Mark DePristo 2b80068164 Merged bug fix from Stable into Unstable 2013-03-18 12:36:21 -04:00
Mark DePristo 7ab7c873a1 Temp. to PairHMM to avoid bad likelihoods
-- Simply caps PairHMM likelihoods from rising above 0 by taking the min of the likelihood and 0.  Will be properly fixed in GATK 2.5 with better PairHMM implementation.
2013-03-18 12:34:51 -04:00
David Roazen a67d8c8dd6 Bump timeout for MaxRuntimeIntegrationTest
Looks like returning this timeout to its original value was a
bit too aggressive -- adding 40 seconds to the tolerance limit.
2013-03-17 16:17:29 -04:00
David Roazen 742a7651e9 Further tweaking of test timeouts
Increase one timeout, restore others that were only timing out due to the
Java crypto lib bug to their original values.

-DOUBLE timeout for NanoSchedulerUnitTest.testNanoSchedulerInLoop()

-REDUCE timeout for EngineFeaturesIntegrationTest to its original value

-REDUCE timeout for MaxRuntimeIntegrationTest to its original value

-REDUCE timeout for GATKRunReportUnitTest to its original value
2013-03-15 14:49:21 -04:00
Mark DePristo 8317cc155e Merge pull request #108 from broadinstitute/eb_bqsr_out_of_bounds_fix
Added check in the MalformedReadFilter for reads without stored bases (i...
2013-03-14 17:29:35 -07:00
MauricioCarneiro 6f0269df2c Merge pull request #107 from broadinstitute/eb_fix_bqsr_clip_exception 2013-03-14 14:40:06 -07:00
Eric Banks 232afdcbea Added check in the MalformedReadFilter for reads without stored bases (i.e. that use '*').
* We now throw a User Error for such reads
  * User can override this to filter instead with --filter_bases_not_stored
  * Added appropriate unit test
2013-03-14 17:17:26 -04:00
droazen 0fd9f0e77c Merge pull request #104 from broadinstitute/eb_fix_output_annotation_GSA-837
Fixed the logic of the @Output annotation and its interaction with 'required'
2013-03-14 12:52:00 -07:00
Ryan Poplin 38914384d1 Changing CALLED_IN_DB_UNKNOWN_STATUS to count as TRUE_POSITIVEs in the simplified stats for AssessNA12878. 2013-03-14 14:44:18 -04:00
Eric Banks 6d6264b108 Merge pull request #105 from broadinstitute/gg_annotations_cleanup_45802765
Cleaned up annotations
2013-03-14 11:35:00 -07:00
Geraldine Van der Auwera 61349ecefa Cleaned up annotations
- Moved AverageAltAlleleLength, MappingQualityZeroFraction and TechnologyComposition to Private
  - VariantType, TransmissionDisequilibriumTest, MVLikelihoodRatio and GCContent are no longer Experimental
  - AlleleBalanceBySample, HardyWeinberg and HomopolymerRun are Experimental and available to users with a big bold caveat message
  - Refactored getMeanAltAlleleLength() out of AverageAltAlleleLength into GATKVariantContextUtils in order to make QualByDepth independent of where AverageAltAlleleLength lives
  - Unrelated change, bundled in for convenience: made HC argument includeUnmappedreads @Hidden
  - Removed unnecessary check in AverageAltAlleleLength
2013-03-14 14:26:48 -04:00
Eric Banks 7cab709a88 Fixed the logic of the @Output annotation and its interaction with 'required'.
ALL GATK DEVELOPERS PLEASE READ NOTES BELOW:

I have updated the @Output annotation to behave differently and to include a 'defaultToStdout' tag.
  * The 'defaultToStdout' tags lets walkers specify whether to default to stdout if -o is not provided.
  * The logic for @Output is now:
    * if required==true then -o MUST be provided or a User Error is generated.
    * if required==false and defaultToStdout==true then the output is assigned to stdout if no -o is provided.
      * this is the default behavior (i.e. @Output with no modifiers).
    * if required==false and defaultToStdout==false then the output object is null.
      * use this combination for truly optional outputs (e.g. the -badSites option in AssessNA12878).

  * I have updated walkers so that previous behavior has been maintained (as best I could).
    * In general, all @Outputs with default long/short names have required=false.
    * Walkers with nWayOut options must have required==false and defaultToStdout==false (I added checks for this)
  * I added unit tests for @Output changes with David's help (thanks!).
  * #resolve GSA-837
2013-03-14 11:58:51 -04:00
Eric Banks 573ed07ad0 Fixed reported bug in BQSR for RNA seq alignments with Ns.
* ClippingOp updated to incorporate Ns in the hard clips.
  * ReadUtils.getReadCoordinateForReferenceCoordinate() updated to account for Ns.
  * Added test that covers the BQSR case we saw.
  * Created GSA-856 (for Mauricio) to add lots of tests to ReadUtils.
    * It will require refactoring code and not in the scope of what I was willing to do to fix this.
2013-03-14 11:26:52 -04:00
Eric Banks ff87b62fe3 Fixed bug in SelectVariants where maxIndelSize argument wasn't getting applied to deletions.
Added unit tests and docs.
2013-03-13 15:11:34 -04:00
Mark DePristo b5b63eaac7 New GATKSAMRecord concept of a strandless read, update to FS
-- Strandless GATK reads are ones where they don't really have a meaningful strand value, such as Reduced Reads or fragment merged reads.  Added GATKSAMRecord support for such reads, along with unit tests
-- The merge overlapping fragments code in FragmentUtils now produces strandless merged fragments
-- FisherStrand annotation generalized to treat strandless as providing 1/2 the representative count for both strands.  This means that that merged fragments are properly handled from the HC, so we don't hallucinate fake strand-bias just because we managed to merge a lot of reads together.
-- The previous getReducedCount() wouldn't work if a read was made into a reduced read after getReducedCount() had been called.  Added new GATKSAMRecord method setReducedCounts() that does the right thing.  Updated SlidingWindow and SyntheticRead to explicitly call this function, and so the readTag parameter is now gone.
-- Update MD5s for change to FS calculation.  Differences are just minor updates to the FS
2013-03-13 11:16:36 -04:00
Mark DePristo 925846c65f Cleanup of FragmentUtils
-- Code was undocumented, big, and not well tested.  All three things fixed.
-- Currently not passing, but the framework works well for testing
-- Added concat(byte[] ... arrays) to utils
2013-03-13 07:36:20 -04:00
David Roazen 8ed78b453f Increase timeout for a test in the EngineFeaturesIntegrationTest
-This test was intermittently failing when run on the farm
2013-03-12 23:53:26 -04:00
Mark DePristo b3f67899b5 Merge pull request #101 from broadinstitute/dr_fix_failing_parallel_tests
Fix more tests that fail when run in parallel on the farm
2013-03-12 14:11:02 -07:00
David Roazen cdb1fa1105 Fix more tests that fail when run in parallel on the farm
-Allow the default S3 put timeout of 30 seconds for GATKRunReports
 to be overridden via a constructor argument, and use a timeout
 of 300 seconds for tests. The timeout remains 30 seconds in all
 other cases.

-Change integration tests that themselves dispatch farm jobs
 into pipeline tests. Necessary because some farm nodes are
 not set up as submit hosts. Pipeline tests are still run
 directly on gsa4.

-Bump up the timeout for the MaxRuntimeIntegrationTest even more
 (was still occasionally failing on the farm!)
2013-03-12 16:53:30 -04:00
Geraldine Van der Auwera f972963918 Fixed issues raised by Appistry QA (mostly small fixes, corrections & clarifications to GATKDocs)
GATK-73 updated docs for bqsr args
GATK-9 differentiate CountRODs from CountRODsByRef
GATK-76 generate GATKDoc for CatVariants
GATK-4 made resource arg required
GATK-10 added -o, some docs to CountMales; some docs to CountLoci
GATK-11 fixed by MC's -o change; straightened out the docs.
GATK-77 fixed references to wiki
GATK-76 Added Ami's doc block
GATK-14 Added note that these annotations can only be used with VariantAnnotator
GATK-15 specified required=false for two arguments
GATK-23 Added documentation block
GATK-33 Added documentation
GATK-34 Added documentation
GATK-32 Corrected arg name and docstring in DiffObjects
GATK-32 Added note to DO doc about reference (required but unused)
GATK-29 Added doc block to CountIntervals
GATK-31 Added @Output PrintStream to enable -o
GATK-35 Touched up docs
GATK-36 Touched up docs, specified verbosity is optional
GATK-60 Corrected GContent annot module location in gatkdocs
GATK-68 touched up docs and arg docstrings
GATK-16 Added note of caution about calling RODRequiringAnnotations as a group
GATK-61 Added run requirements (num samples, min genotype quality)
Tweaked template and generic doc block formatting (h2 to h3 titles)
GATK-62 Added a caveat to HR annot
Made experimental annotation hidden
GATK-75 Added setup info regarding BWA
GATK-22 Clarified some argument requirements
GATK-48 Clarified -G doc comments
GATK-67 Added arg requirement
GATK-58 Added annotation and usage docs
GSATDG-96 Corrected doc
Updated MD5 for DiffObjectsIntegrationTests (only change is link in table title)
2013-03-12 10:57:14 -04:00
Guillermo del Angel 695723ba43 Two features useful for ancient DNA processing.
Ancient DNA sequencing data is in many ways different from modern data, and methods to analyze it need to be adapted accordingly.
Feature 1: Read adaptor trimming. Ancient DNA libraries typically have very short inserts (in the order of 50 bp), so typical Illumina libraries sequenced in, say, 100bp HiSeq will have a large adaptor component being read after the insert.
If this adaptor is not removed, data will not be aligneable. There are third party tools that remove adaptor and potentially merge read pairs, but are cumbersome to use and require precise knowledge of the library construction and adaptor sequence.
-- New walker ReadAdaptorTrimmer walks through paired end data, computes pair overlap and trims auto-detected adaptor sequence.
-- Unit tests added for trimming operation.
-- Utility walker (may be retired later) DetailedReadLengthDistribution computes insert size or read length distribution stratified by read group and mapping status and outputs a GATKReport with data.
-- Renamed MaxReadLengthFilter to ReadLengthFilter and added ability to specify minimum read length as a filter (may be useful if, as a consequence of adaptor trimming, we're left with a lot of very short reads which will map poorly and will just clutter output BAMs).

Feature 2: Unbiased site QUAL estimation: many times ancestral allele status is not known and VCF fields like QUAL, QD, GQ, etc. are affected by the pop. gen. prior at a site. This might introduce subtle biases in studies where a species is aligned against the reference of another species, so an option for UG and HC not to apply such prior is introduced.
-- Added -noPrior argument to StandardCallerArgumentCollection.
-- Added option not to fill priors is such argument is set.
-- Added an integration test.
2013-03-09 18:18:13 -05:00
Yossi Farjoun baad965a57 - Changed loadContaminationFile file parser to delimit by tab only. This allows spaces in sampleIDs, which apparently are allowed.
- This was needed since samples with spaces in their names are regularly found in the picard pipeline.
- Modified the tests to account for this (removed spaces from the good tests, and changed the failing tests accordingly)
- Cleaned up the unit tests using a @DataProvider (I'm in love...).
- Moved AlleleBiasedDownsamplingUtilsUnitTest to public to match location of class it is testing (due to the way bamboo operates)
2013-03-07 13:04:24 -05:00
David Roazen 3ab78543a7 Fix tests that were consistently or intermittently failing when run in parallel on the farm
-Make MaxRuntimeIntegrationTest more lenient by assuming that startup overhead
 might be as long as 120 seconds on a very slow node, rather than the original
 assumption of 20 seconds

-In TraverseActiveRegionsUnitTest, write temp bam file to the temp directory, not
 to the current working directory

-SimpleTimerUnitTest: This test was internally inconsistent. It asserted that
 a particular operation should take no more than 10 milliseconds, and then asserted
 again that this same operation should take no more than 100 microseconds (= 0.1 millisecond).
 On a slow node it could take slightly longer than 100 microseconds, however.
 Changed the test to assert that the operation should require no more than 10000 microseconds
 (= 10 milliseconds)

-change global default test timeout from 20 to 40 minutes (things just take longer
 on the farm!)

-build.xml: allow runtestonly target to work with scala test classes
2013-03-06 13:56:54 -05:00
Eric Banks 3759d9dd67 Added the functionality to impose a relative ordering on ReadTransformers in the GATK engine.
* ReadTransformers can say they must be first, must be last, or don't care.
  * By default, none of the existing ones care about ordering except BQSR (must be first).
    * This addresses a bug reported on the forum where BAQ is incorrectly applied before BQSR.
  * The engine now orders the read transformers up front before applying iterators.
  * The engine checks for enabled RTs that are not compatible (e.g. both must be first) and blows up (gracefully).
  * Added unit tests.
2013-03-06 12:38:59 -05:00
Mark DePristo 446cd61f7e Merge pull request #84 from broadinstitute/eb_allelic_primitives
Added new walker to split MNPs into their allelic primitives (SNPs).
2013-03-06 09:02:21 -08:00
Menachem Fromer 5577715ae2 Have all significant XHMM commands be run with LongRunTime 2013-03-06 10:18:23 -05:00
Eric Banks 78721ee09b Added new walker to split MNPs into their allelic primitives (SNPs).
* Can be extended to complex alleles at some point.
  * Currently only works for bi-allelics (documented).
  * Added unit and integration tests.
2013-03-05 23:16:42 -05:00
Mauricio Carneiro e2d41f0282 Turning @Output required to false
By default all output is assigned to stdout if a -o is not provided. Technically this makes @Output a not required parameter, and the documentation is misleading because it's reading from the annotation.
GSA-820 #resolve
2013-03-05 17:26:16 -05:00
Eric Banks 2be57fbcfb Merged bug fix from Stable into Unstable 2013-03-05 13:28:46 -05:00
Eric Banks 5e89f01e10 Don't allow the use of compressed (.gz) references in the GATK. 2013-03-05 13:28:19 -05:00
Mauricio Carneiro d0c8105387 Cleaning up hilarious exception messages
Too many users (with RNASeq reads) are hitting these exceptions that were never supposed to happen. Let's give them (and us) a better and clearer error message.
2013-03-04 16:52:22 -05:00
Mark DePristo 42d3919ca4 Expanded functionality for writing BAMs from HaplotypeCaller
-- The new code includes a new mode to write out a BAM containing reads realigned to the called haplotypes from the HC, which can be easily visualized in IGV.
-- Previous functionality maintained, with bug fixes
-- Haplotype BAM writing code now lives in utils
-- Created a base class that includes most of the functionality of writing reads realigned to haplotypes onto haplotypes.
-- Created two subclasses, one that writes all haplotypes (previous functionality) and a CalledHaplotypeBAMWriter that will only write reads aligned to the actually called haplotypes
-- Extended PerReadAlleleLikelihoodMap.getMostLikelyAllele to optionally restrict set of alleles to consider best
-- Massive increase in unit tests in AlignmentUtils, along with several new powerful functions for manipulating cigars
-- Fix bug in SWPairwiseAlignment that produces cigar elements with 0 size, and are now fixed with consolidateCigar in AlignmentUtils
-- HaplotypeCaller now tracks the called haplotypes in the GenotypingEngine, and returns this information to the HC for use in visualization.
-- Added extensive docs to HaplotypeCaller on how to use this capability
-- BUGFIX -- don't modify the read bases in GATKSAMRecord in LikelihoodCalculationEngine in the HC
-- Cleaned up SWPairwiseAlignment.  Refactored out the big main and supplementary static methods.  Added a unit test with a bug TODO to fix what seems to be an edge case bug in SW
-- Integration test to make sure we can actually write a BAM for each mode.  This test only ensures that the code runs and doesn't exception out.  It doesn't actually enforce any MD5s
-- HaplotypeBAMWriter also left aligns indels in the reads, as SW can return a random placement of a read against the haplotype.  Calls leftAlign to make the alignments more clear, with unit test of real read to cover this case
-- Writes out haplotypes for both all haplotype and called haplotype mode
-- Haplotype writers now get the active region call, regardless of whether an actual call was made.  Only emitting called haplotypes is moved down to CalledHaplotypeBAMWriter
2013-03-03 12:07:29 -05:00
depristo 6204e6ccc9 Merge pull request #76 from broadinstitute/md_kb_bugfix_GSA-795
Bug fixes and optimizations for NA12878 KB
2013-03-01 10:52:16 -08:00
Eric Banks ebd5404124 Fixed the add functionality of GenomeLocSortedSet.
* Fixed GenomeLocSortedSet.add() to ensure that overlapping intervals are detected and an exception is thrown.
 * Fixed GenomeLocSortedSet.addRegion() by merging it with the add() method; it now produces sorted inputs in all cases.
 * Cleaned up duplicated code throughout the engine to create a list of intervals over all contigs.
 * Added more unit tests for add functionality of GLSS.
 * Resolves GSA-775.
2013-02-28 23:31:00 -05:00
Mark DePristo 4095a9ef32 Bugfixes for AssessNA12878
-- Refactor initialization routine into BadSitesWriter.  This now adds the GQ and DP genotype header lines which are necessarily if the input VCF doesn't have proper headers
-- GATKVariantContextUtils subset to biallelics now tolerates samples with bad GL values for multi-allelics, where it just removes the PLs and issues a warning.
2013-02-28 10:35:06 -05:00
depristo 92d6a4f441 Merge pull request #75 from broadinstitute/eb_missing_rg_error_GSA-407
Added better error message for BAMs with bad read groups.
2013-02-28 05:20:39 -08:00
Eric Banks 12fc198b80 Added better error message for BAMs with bad read groups.
* Split the cases into reads that don't have a RG at all vs. those with a RG that's not defined in the header.
  * Added integration tests to make sure that the correct error is thrown.
  * Resolved GSA-407.
2013-02-27 16:02:56 -05:00
Eric Banks 69b8173535 Replace uses of NestedHashMap with NestedIntegerArray.
* Removed from codebase NestedHashMap since it is unused and untested.
 * Integration tests change because the BQSR CSV is now sorted automatically.
 * Resolves GSA-732
2013-02-27 14:03:39 -05:00
David Roazen 752f4335a5 Merged bug fix from Stable into Unstable 2013-02-27 05:20:41 -05:00
David Roazen 2a7af43164 Fix improper dependencies in QScripts used by pipeline tests, and attempt to fix the flawed MisencodedBaseQualityUnitTest
-Some QScripts used by public pipeline tests unnecessarily used the (now protected) UnifiedGenotyper.
 Changed them to use PrintReads instead.

-Moved ExampleUnifiedGenotyperPipelineTest to protected

-Attempt to fix the flawed and sporadically failing MisencodedBaseQualityUnitTest:

   After looking at this class a bit, I think the problem was the use of global arrays for the quals
   shared across all reads in all tests (BAMRecord class definitely does not make a separate copy for
   each read!). One test (testFixBadQuals) modifies the bad quals array, and if this happens to run
   before the testBadQualsThrowsError test the bad quals array will have been "fixed" and no exception
   will be thrown.
2013-02-27 04:45:53 -05:00
David Roazen a53b4a7521 Merged bug fix from Stable into Unstable 2013-02-26 21:41:13 -05:00
David Roazen 65d31ba4ad Fix runtime public -> protected dependencies in the test suite
-replace unnecessary uses of the UnifiedGenotyper by public integration tests
 with PrintReads

-move NanoSchedulerIntegrationTest to protected, since it's completely dependent
 on the UnifiedGenotyper
2013-02-26 21:19:12 -05:00
depristo 93205154b5 Merge pull request #63 from broadinstitute/eb_fix_pairhmm_unittest_GSA-776
Eb fix pairhmm unittest gsa 776
2013-02-26 11:56:58 -08:00
Mauricio Carneiro 711cbd3b5a Archiving CoverageBySample
This walker was not updated since 2009, and users were getting wrong answers when running it with ReduceReads. I don't want to deal with this because DiagnoseTargets does everything this walker does.
2013-02-26 13:49:00 -05:00
depristo 51d618de97 Merge pull request #62 from broadinstitute/rp_increase_max_kmer_in_assembly
The maximum kmer length is derived from the reads.
2013-02-26 05:37:02 -08:00
Eric Banks 7519484a38 Refactored PairHMM.initialize to first take haplotype max length and then the read max length so that it is consistent with other PairHMM methods. 2013-02-25 15:04:23 -05:00
Ryan Poplin 89e2943dd1 The maximum kmer length is derived from the reads.
-- This is done to take advantage of longer reads which can produce less ambiguous haplotypes
-- Integration tests change for HC and BiasedDownsampling
2013-02-25 14:40:25 -05:00
David Roazen 3645ea9bb6 Sequence dictionary validation: detect problematic contig indexing differences
The GATK engine does not behave correctly when contigs are indexed
differently in the reads sequence dictionaries vs. the reference
sequence dictionary, and the inconsistently-indexed contigs are included
in the user's intervals. For example, given the dictionaries:

Reference dictionary = { chrM, chr1, chr2, ... }
BAM dictionary       = { chr1, chr2, ... }

and the interval "-L chr1", the engine would fail to correctly retrieve
the reads from chr1, since chr1 has a different index in the two dictionaries.

With this patch, we throw an exception if there are contig index differences
between the dictionaries for reads and reference, AND the user's intervals
include at least one of the mismatching contigs.

The user can disable this exception via -U ALLOW_SEQ_DICT_INCOMPATIBILITY

In all other cases, dictionary validation behaves as before.

I also added comprehensive unit tests for the (previously-untested)
SequenceDictionaryUtils class.

GSA-768 #resolve
2013-02-25 11:14:22 -05:00
Ryan Poplin 6a639c8ffc Replace Smith-Waterman alignment with the bubble traversal.
-- Instead of doing a full SW alignment against the reference we read off bubbles from the assembly graph.
-- Smith-Waterman is run only on the base composition of the bubbles which drastically reduces runtime.
-- Refactoring graph functions into a new DeBruijnAssemblyGraph class.
-- Bug fix in path.getBases().
-- Adding validation code to the assembly engine.
-- Renaming SimpleDeBruijnAssembler to match the naming of the new Assembly graph class.
-- Adding bug fixes, docs and unit tests for DeBruijnAssemblyGraph and KBestPaths classes.
-- Added ability to ignore bubbles that are too divergent from the reference
-- Max kmer can't be bigger than the extension size.
-- Reverse the order that we create the assembly graphs so that the bigger kmers are used first.
-- New algorithm for determining unassembled insertions based on the bubble traversal instead of the full SW alignment.
-- Don't need the full read span reference loc for anything any more now that we clip down to the extended loc for both assembly and likelihood evaluation.
-- Updating HaplotypeCaller and BiasedDownsampling integration tests.
-- Rebased everything into one commit as requested by Eric
-- improvements to the bubble traversal are coming as a separate push
2013-02-22 15:42:16 -05:00
depristo 2ad559cf58 Merge pull request #59 from broadinstitute/mc_reving_testng_GSA-695
Updating TestNG to the latest version
2013-02-22 10:39:04 -08:00
Mauricio Carneiro 4ac50c89ad Updating TestNG to the latest version
-- changed SkipException constructors that are now private in TestNG
-- Updated build.xml to use the latest testng
-- Added guice dependency to ivy
-- Fixed broken SampleDBUnitTest

The SampleDBUnitTest was only passing before because the map comparison in the old TestNG was broken. It was comparing two DIFFERENT samples and testing for "equals"

GSA-695 #resolve
2013-02-22 09:40:23 -05:00
Mark DePristo 182c32a2b7 Relax bounds checking in QualityUtils.boundQual
-- Previous version did runtime checking that qual >= 0 but BQSR was relying on boundQual to restore -1 to 1.  So relax the bound.
2013-02-22 08:46:59 -05:00
Mark DePristo 8ac6d3521f Vast improvements to AssessNA12878 code and functionality
-- AssessNA12878 now breaks out multi-allelics into bi-allelic components.  This means that we can properly assess multi-allelic calls against the bi-allelic KB
-- Refactor AssessNA12878, moving into assess package in KB.  Split out previously private classes in the walker itself into separate classes.  Added real docs for all of the classes.
-- Vastly expand (from 0) unit tests for NA12878 assessments
-- Allow sites only VCs to be evaluated by Assessor
-- Move utility for creating simple VCs from a list of string alleles from GATKVariantContextUtilsUnitTest to GATKVariantContextUtils
-- Assessor bugfix for discordant records at a site.  Previous version didn't handle properly the case where one had a non-matching call in the callset w.r.t. the KB, so that the KB element was eaten during the analysis.  Fixed.  UnitTested
-- See GSA-781 -- Handle multi-allelic variants in KB for more information
-- Bugfix for missing site counting in AssessNA12878.  Previous version would count N misses for every missed value at a site.  Not that this has much impact but it's worth fixing
-- UnitTests for BadSitesWriter
-- UnitTests for filtered and filtering sites in the Assessor
-- Cleanup end report generation code (simply the code).  Note that instead of "indel" the new code will print out "INDELS"
-- Assessor DoC calculations now us LIBS and RBPs for the depth calculation.  The previous version was broken for reduced reads.  Added unit test that reads a complex reduced read example and matches the DoC of this BAM with the output of the GATK DoC tool here.
-- Added convenience constructor for LIBS using just SAMFileReader and an iterator.  It's now easy to create a LIBS from a BAM at a locus.  Added advanceToLocus function that moves the LIBS to a specific position.  UnitTested via the assessor (which isn't ideal, but is a proper test)
2013-02-21 20:43:12 -05:00
Mark DePristo 29319bf222 Improved allele trimming code in GATKVariantContextUtils
-- Now supports trimming the alleles from both the reverse and forward direction.
-- Added lots of unit tests for forwrad allele trimming, as well as creating VC from forward and reverse trimming.
-- Added docs and tests for the code, to bring it up to GATK spec
2013-02-21 12:01:43 -05:00
Eric Banks 6996a953a8 Haplotype/Allele based optimizations for the HaplotypeCaller that knock off nearly 20% of the total runtime (multi-sample).
These 2 changes improve runtime performance almost as much as Ryan's previous attempt (with ID-based comparisons):
* Don't unnecessarily overload Allele.getBases() in the Haplotype class.
  * Haplotype.getBases() was calling clone() on the byte array.
* Added a constructor to Allele (and Haplotype) that takes in an Allele as input.
  * It makes a copy of he given allele without having to go through the validation of the bases (since the Allele has already been validated).
  * Rev'ed the variant jar accordingly.

For the reviewer: all tests passed before rebasing, so this should be good to go as far as correctness.
2013-02-21 10:14:11 -05:00
Geraldine Van der Auwera c3e01fea40 Added several more info types / annotations to GATKDocs
-- top-level walker type (locus, read etc)
-- parallelism options (nt or nct)
-- annotation type (for Variant Annotations)
-- downsampling settings that override engine defaults
-- reference window size
-- active region settings
-- partitionBy info
2013-02-21 03:12:40 -05:00
Geraldine Van der Auwera e674b4a524 Added new ReadFilter that allows users to specifically reassign one single mapping quality to a different value. Useful for TopHat and other RNA-seq software users. 2013-02-20 01:24:45 -05:00
MauricioCarneiro 76810465aa Merge pull request #40 from broadinstitute/gg_retrieve_readfilters_GSATDG-63 2013-02-19 19:42:35 -08:00
Mark DePristo 910d966428 Extend timeout of NanoScheduler deadlock tests
-- The previous timeout of 1 second was just dangerously short.  Increase the timeout to 10 seconds
2013-02-19 20:25:25 -05:00
Eric Banks 0055a6f1cd Merge pull request #45 from broadinstitute/mc_fix_indelrealigner_GSA-774
Fix to the Indel Realigner bug described in GSA-774
2013-02-19 16:16:48 -08:00
Geraldine Van der Auwera faef85841b Added GATKDocs fct to indicate default Read Filters for each tool
-- Added getClazzAnnotations() as hub to retrieve various annotations values and class properties through reflection
-- Added getReadFilters() method to retrieve Read Filter annotations
-- getReadFilters() uses recursion to walk up the inheritance to also capture superclass annotations
-- getClazzAnnotations() stores collected info in doc handler root, which is unit.forTemplate in Doclet
-- Modified FreeMarker template to use the Readfilters info (displayed after arg table, before additional capabilities)
-- Tadaaa :-) #GSATDG-63 resolve
2013-02-19 16:12:29 -05:00
Mauricio Carneiro 371ea2f24c Fixed IndelRealigner reference length bug (GSA-774)
-- modified ReadBin GenomeLoc to keep track of softStart() and softEnd() of the reads coming in, to make sure the reference will always be sufficient even if we want to use the soft-clipped bases
-- changed the verification from readLength to aligned bases to allow reads with soft-clipped bases
-- switched TreeSet -> PriorityQueue in the ConstrainedMateFixer as some different reads can be considered equal by picard's SAMRecordCoordinateComparator (the Set was replacing them)
-- pulled out ReadBin class so it can be testable
-- added unit tests for ReadBin with soft-clips
-- added tests for getMismatchCount (AlignmentUtils) to make sure it works with soft-clipped reads

GSA-774 #resolve
2013-02-19 16:00:36 -05:00
Mauricio Carneiro 815028edd4 Added verbose error message to the PluginManager
-- added a logger.error with a more descriptive message of what the most likely cause of the error is

Typical error happens when a walker's global variable is not initialized properly (usually in test conditions). The old error message was very hard to understand "Could not create module because of an exception of type NullPointerException ocurred caused by exception null"
2013-02-19 16:00:35 -05:00
Ryan Poplin c025e84c8b Fix for calculating read pos rank sum test with reads that are informative but don't actually overlap the variant due to some hard clipping.
-- Updated a few integration tests for HC, UG, and UG general ploidy
2013-02-19 14:09:24 -05:00
Mark DePristo be45edeff2 ActivityProfile and ActiveRegions respects engine interval boundaries
-- Active regions are created as normal, but they are split and trimmed to the engine intervals when added to the traversal, if there are intervals present.
-- UnitTests for ActiveRegion.splitAndTrimToIntervals
-- GenomeLocSortedSet.getOverlapping uses binary search to efficiently in ~ log N time find overlapping intervals
-- UnitTesting overlap function in GenomeLocSortedSet
-- Discovered fundamental implementation bug in that adding genome locs out of order (elements on 20 then on 19) produces an invalid GenomeLocSortedSet.  Created a JIRA to address this: https://jira.broadinstitute.org/browse/GSA-775
-- Constructor that takes a collection of genome locs now sorts its input and merges overlapping intervals
-- Added docs for the constructors in GLSS
-- Update HaplotypeCaller MD5s, which change because ActiveRegions are now restricted to the engine intervals, which changes slightly the regions in the tests and so the reads in the regions, and thus the md5s
-- GenomeAnalysisEngineUnitTest needs to provide non-null genome loc parser
2013-02-18 10:40:25 -05:00
Mark DePristo 3b67aa8aee Final edge case bug fixes to QualityUtil routines
-- log10 functions in QualityUtils allow -Infinity to allow log10(0.0) values
-- Fix edge condition of log10OneMinusX failing with Double.MIN_VALUE
-- Fix another edge condition of log10OneMinusX failing with a small but not min_value double
2013-02-16 07:31:38 -08:00
Mark DePristo b393c27f07 QualityUtils now uses runtime argument checks instead of contract
-- There's some runtime cost for these tests, but it's not big enough to outweigh the value of catching errors quickly
2013-02-16 07:31:38 -08:00
Mark DePristo 9a29d6d4be Fix an catastrophic bug (WoW!) in the reference calculation of the UG
-- The UG was using MathUtils binomial probability backward, so that the estimated confidence was always NaN, and was as a side effect other utils converted this to a meaningless 0.0.  This is all because there wasn't a unit test.
-- I've fixed the calculation, so it's now log10 based, uses robust MathUtils and QualityUtils functions to compute probabilities, and added a unit test.
2013-02-16 07:31:38 -08:00
Mark DePristo 9e28d1e347 Cleanup and unit tests for QualityUtils
-- Fixed a few conversion bugs with edge case quals (ones that were very high)
-- Fixed a critical bug in the conversion of quals that was causing near capped quals to fall below their actual value.  Will undoubtedly need to fix md5s
-- More precise prob -> qual calculations for very high confidence events in phredScaleCorrectRate, trueProbToQual, and errorProbToQual.  Very likely to improve accuracy of many calculations in the GATK
-- Added errorProbToQual and trueProbToQual calculations that accept an integer cap, and perform the (tricky) conversion from int to byte correctly.
-- Full docs and unit tests for phredScaleCorrectRate and phredScaleErrorRate.
-- Renamed probToQual to trueProbToQual
-- Added goodProbability and log10OneMinusX to MathUtils
-- Went through the GATK and cleaned up many uses of QualityUtils
-- Cleanup constants in QualityUtils
-- Added full docs for all of the constants
-- Rename MAX_QUAL_SCORE to MAX_SAM_QUAL_SCORE for clarity
-- Moved MAX_GATK_USABLE_Q_SCORE to RecalDatum, as it's s BQSR specific feature
-- Convert uses of QualityUtils.errorProbToQual(1-x) to QualityUtils.trueProbToQual(x)
-- Cleanup duplicate quality score routines in MathUtils.  Moved and renamed MathUtils.log10ProbabilityToPhredScale => QualityUtils.phredScaleLog10ErrorRate. Removed 3 routines from MathUtils, and remapped their usages into the better routines in QualityUtils
2013-02-16 07:31:37 -08:00
Yossi Farjoun aa99a5f47c Added an option to print out the version string
@argument (-)-version
(should this be @hidden?)

Prints out the version to System.out and quit(0)
No tests. (any ideas on how to test this would be happily accepted)
2013-02-15 12:42:59 -05:00
MauricioCarneiro bbfbe1bc26 Merge pull request #41 from broadinstitute/jt_cmi_queue_packaging
ValidatingPileup was renamed to CheckPileup
2013-02-15 09:19:00 -08:00
droazen 664960373d Merge pull request #31 from broadinstitute/yf_fast_BAM_index_traversal
-re-enables fast BAM indexing
2013-02-15 09:12:32 -08:00
Joel Thibault 182a950202 ValidatingPileup was renamed to CheckPileup 2013-02-15 11:56:19 -05:00
MauricioCarneiro 1dd284a5bb Merge pull request #39 from broadinstitute/tj_printreads_tag_for_bqsr_GSA-720
PrintReads writes a header when used with -BQSR
2013-02-15 07:18:28 -08:00
MauricioCarneiro b58a0eca6b Merge pull request #33 from broadinstitute/gg_more_gatkdocs_tweaks_GSATDG-62
Refactored GATKDocs categories some more ( GSATDG-62 )
2013-02-14 22:35:07 -08:00
Tad Jordan 6cb80591e3 PrintReads writes a header when used with -BQSR 2013-02-14 22:19:14 -05:00
Yossi Farjoun 3a7c8c13e2 Re-enabled fastBAMindexing by replacing the FileChannel with a SeekableBufferedStream
This helps a lot since FileChannel is very low-level and traversing the BAMIndex involves lots of short reads.

- Fixed a deterioration in BAMIndex due to rev'ed picard (see below)
- Added unit tests for SeekableBufferedStream
- Added integrationTests for GATKBAMIndex (in PileupWalkerIntegrationTest)
- Added a runtime-test to verify that the amount read equals the amount requested.
- Added failing tests with expectedExceptions
- Used a DataProvider to make code nicer
2013-02-14 17:51:15 -05:00
Mark DePristo f92328a1a1 Extend default timeout to 20 minutes
-- The default of 10 minutes is right on the edge for some tests, and we really want a default not to enforce a max time (test should be short) but to stop testng from failing to terminate ever in the case where some test is truly hung
2013-02-13 17:43:40 -08:00
Geraldine Van der Auwera 6208742f7c Refactored GATKDocs categories some more ( GSATDG-62 )
-- Renamed ValidatePileup to CheckPileup since validation is reserved word
-- Renamed AlignmentValidation to CheckAlignment (same as above)
-- Refactored category definitions to use constants defined in HelpConstants
-- Fixed a couple of minor typos and an example error
-- Reorganized the GATKDocs index template to use supercategories
-- Refactored integration tests for renamed walkers (my earlier refactoring had screwed them up or not carried over)
2013-02-13 16:49:18 -05:00
Guillermo del Angel 4308b27f8c Fixed non-determinism in HaplotypeCaller and some UG calls -
-- HaplotypeCaller and PerReadAlleleLikelihoodMap should use LinkedHashMaps instead of plain HashMaps. That way the ordering when traversing alleles is maintained. If the JVM traverses HashMaps with random ordering, different reads (with same likelihood) may be removed by contamination checker, and different alleles may be picked if they have same likelihoods for all reads.
-- Put in some GATKDocs and contracts in HaplotypeCaller files (far from done, code is a beast)
-- Update md5's due to different order of iteration in LinkedHashMaps instead of HashMaps inside HaplotypeCaller  (due to change in PerReadAlleleLikelihoodMap that also slightly modifies reads chosen by per-read downsampling).
-- Reenabled testHaplotypeCallerMultiSampleGGAMultiAllelic test
-- Added some defensive argument checks into HaplotypeCaller public functions (not intended to be done yet).
2013-02-12 15:43:29 -05:00
Geraldine Van der Auwera dff5ef562b Reorganized walker categories in GATKDocs (@DocumentedGATKFeature details)
-- Sorted out contents of BAM Processing vs. Diagnostics & QC Tools
-- Moved two validation-related walkers from Diagnostics & QC to Validation Utilities
-- Reworded some category names and descriptions to be more explicit and user-friendly
2013-02-12 13:36:15 -05:00
Mark DePristo e40d83f00e Final version of PairHMMs with correct edge conditions
-- Uses 1/N for N potential start sites as the probability of starting at any one of the potential start sites
-- Add flag that says to use the original edge condition, respected by all subclasses.  This brings the new code back to the original state, but with all of the cleanup I've done
-- Only test configurations where the read length <= haplotype length.  I think this is actually the contract, but we'll talk about this tomorrow
-- Fix egregious bug with the myLog10SumLog10 function doing the exact opposite of the requested arguments, so that doExact really meant don't do exact
-- PairHMM now exposes computeReadLikelihoodGivenHaplotypeLog10 but subclasses must overload subComputeReadLikelihoodGivenHaplotypeLog10.  This protected function does the work, and the public function will do argument and result QC
-- Have to be more tolerant of reference (approximate) HMM.  All unit tests from the original HMM implementations pass now
-- Added locs of docs
-- Generalize unit tests with multiple equivalent matches of read to haplotype
-- Added runtime argument checking for initial and computeReadLikelihoodGivenHaplotypeLog10
-- Functions to dumpMatrices for debugging
-- Fix nasty bug (without original unit tests) in LoglessPairHMM
-- Max read and haplotype lengths only worked in previous code if they were exactly equal to the provided read and haplotype sizes.  Fixed bug.  Added unit test to ensure this doesn't break again.
-- Added dupString(string, n) method to Utils
-- Added TODOs for next commit.  Need to compute number of potential start sites not in initialize but in the calc routine since this number depends not on the max sizes but the actual read sizes
-- Unit tests for the hapStartIndex functionality of PairHMM
-- Moved computeFirstDifferingPosition to PairHMM, and added unit tests
-- Added extensive unit tests for the hapStartIndex functionality of computeReadLikelihoodGivenHaplotypeLog10
-- Still TODOs left in the code that I'll fix up
-- Logless now compute constants, if they haven't been yet initialized, even if you forgot to say so
-- General: the likelihood penalty for potential start sites is now properly computed against the actual read and reference bases, not the maximum.  This involved moving some initialize() code into the computeLikelihoods function.  That's ok because all of the potential log10 functions are actually going to cached versions, so the slowdown is minimal
-- Added some unit tests to ensure that common errors (providing haplotypes too long, reads too long, not initializing the HMM) are captured as errors
2013-02-09 19:19:22 -05:00
Mark DePristo 09595cdeb9 Remove ExactPairHMM and OriginalPairHMM, everyone just uses Log10PairHMM with appropriate arguments 2013-02-09 13:06:54 -05:00
Mark DePristo 2d802e17a4 Delete the CachingPairHMM 2013-02-09 13:06:54 -05:00
Mark DePristo 7dcafe8b81 Preliminary version of LoglessCachingPairHMM that avoids positive likelihoods
-- Would have been squashed but could not because of subsequent deletion of Caching and Exact/Original PairHMMs
-- Actual working unit tests for PairHMMUnitTest
-- Fixed incorrect logic in how I compared hmm results to the theoretical and exact results
-- PairHMM has protected variables used throughout the subclasses
2013-02-09 13:06:54 -05:00
Mark DePristo ca76de0619 Move ProcessUtilsUnitTest to private 2013-02-09 12:34:45 -05:00
MauricioCarneiro f5e52b72ea Merge pull request #23 from broadinstitute/md_process_utils_unit_tests
UnitTests for ProcessUtils
2013-02-09 09:27:31 -08:00
MauricioCarneiro 3ff10ab277 Merge pull request #24 from broadinstitute/md_ngsplatform_unittests
Expand NGSPlatform to meet SAM 1.4 spec, with full unit tests
2013-02-09 09:27:03 -08:00
Mark DePristo b127fc6a1a Expand NGSPlatform to meet SAM 1.4 spec, with full unit tests
-- Added CAPILLARY and HELICOS platforms as required by spec 1.4
-- Added extensive unit tests to ensure NGSPlatform functions work as expected.
-- Fixed some NPE bugs for reads that don't have RGs or PLs in their RG fields
2013-02-09 11:16:21 -05:00
Mark DePristo fc3307a97f UnitTests for ProcessUtils 2013-02-09 10:13:01 -05:00
Mark DePristo 7fb620dce7 Generalize and fixup ContigComparator
-- Now uses a SAMSequenceDictionary to do the comparison of contigs (which is the right way to do it)
-- Added unit tests
2013-02-09 09:52:13 -05:00
Mark DePristo a3dc7dc5cb Extend AWS timeout for uploads of the GATK run reports to 30 seconds 2013-02-08 17:37:36 -05:00
Mauricio Carneiro 5f49c95cc1 Added distance across contigs calculation to GenomeLocs
-- distance across contigs is calculated given a sequence dictionary (from SAMFileHeader)
-- unit test added
GSATDG-45
2013-02-07 16:31:41 -05:00
Eric Banks 9826192854 Added contracts, docs, and tests for several methods in AlignmentUtils. There are over 74K tests being run now for this class!
* AlignmentUtils.getMismatchCount()
* AlignmentUtils.calcAlignmentByteArrayOffset()
* AlignmentUtils.readToAlignmentByteArray().
* AlignmentUtils.leftAlignIndel()
2013-02-07 13:04:24 -05:00
eitanbanks 584899329c Merge pull request #13 from broadinstitute/dr_variant_migration_GSA-692
Replace org.broadinstitute.variant with jar built from the Picard repo
2013-02-06 07:22:30 -08:00
Eric Banks 562f2406d7 Added check that BaseRecalibrator is not being run on a reduced bam.
- Throws user exception if it is.
 - Can be turned off with --allow_bqsr_on_reduced_bams_despite_repeated_warnings argument.
 - Added test to check this is working.
 - Added docs to BQSRReadTransformer explaining why this check is not performed on PrintReads end.
 - Added small bug fix to GenomeAnalysisEngine that I uncovered in this process.
 - Added comment about not changing the program record name, as per reviewer comments.
 - Removed unused variable.
2013-02-06 10:14:27 -05:00
Eric Banks 4e5ff3d6f1 Bug fix for NPE in HC with --dbsnp argument.
- I had added the framework in the VA engine but should not have hooked it up to the HC yet since the RefMetaDataTracker is always null.
 - Added contracts and docs to the relevant methods in the VA engine so that this doesn't happen in the future.
2013-02-05 21:59:19 -05:00
David Roazen e7e76ed76e Replace org.broadinstitute.variant with jar built from the Picard repo
The migration of org.broadinstitute.variant into the Picard repo is
complete. This commit deletes the org.broadinstitute.variant sources
from our repo and replaces it with a jar built from a checkout of the
latest Picard-public svn revision.
2013-02-05 17:24:25 -05:00
Mauricio Carneiro f6bc5be6b4 Fixing license on Yossi's file
Somebody needs to set up the license hook ;-)
2013-02-05 11:14:43 -05:00
MauricioCarneiro 050c4794a5 Merge pull request #11 from yfarjoun/per_sample2
-Added Per-Sample Contamination Removal to UnifiedGenotyper: Added an @A...
2013-02-05 08:04:29 -08:00
Eric Banks 00c98ff0cf Need to reset the static counter before tests are run or else we won't be deterministic.
Also need to give credit where credit is due: David was right that this was not a non-deterministic Bamboo failure...
2013-02-05 10:41:46 -05:00
Yossi Farjoun de03f17be4 -Added Per-Sample Contamination Removal to UnifiedGenotyper: Added an @Advanced option to the StandardCallerArgumentCollection, a file which should
contain two columns, Sample (String) and Fraction (Double) that form the Sample-Fraction map for the per-sample AlleleBiasedDownsampling.
-Integration tests to UnifiedGenotyper (Using artificially contaminated BAMs created from a mixure of two broadly concented samples) were added
-includes throwing an exception in HC if called using per-sample contamination file (not implemented); tested in a new integration test.
-(Note: HaplotypeCaller already has "Flat" contamination--using the same fraction for all samples--what it doesn't have is
   _per-sample_ AlleleBiasedDownsampling, which is what has been added here to the UnifiedGenotyper.
-New class: DefaultHashMap (a Defaulting HashMap...) and new function: loadContaminationFile (which reads a Sample-Fraction file and returns a map).
-Unit tests to the new class and function are provided.
-Added tests to see that malformed contamination files are found and that spaces and tabs are now read properly.
-Merged the integration tests that pertain to biased downsampling, whether HaplotypeCaller or unifiedGenotyper, into a new IntegrationTest class.
2013-02-04 18:24:36 -05:00
Mark DePristo a281fa6548 Resolves Genome Sequence Analysis GSA-750 Don't print an endless series of starting messages from the ProgressMeter
-- The progress meter isn't started until the GATK actually calls execute on the microscheduler.  Now we get a message saying "Creating shard strategy" while this (expensive) operation runs
2013-02-04 15:47:30 -05:00
Tad Jordan eb847fa102 Message "script failed" moved to the correct place in the code
GSA-719 fixed
2013-02-04 15:37:23 -05:00
Chris Hartl 3c99010be4 Part 1 of Variant Annotator Unit tests: PerReadAlleleLikelihoodMap
- Added contract enforcement for public methods
 - Refactored the conversion from read -> (allele -> likelihood) to allele -> list[read] into its own method
 - added method documentation for non getters/setters
 - finals, finals everywhere
 - Add in a unit test for the PerReadAlleleLikelihoodMap. Complete coverage except for .clear() and a method that is a straight call into a separately-tested utility class.
2013-02-04 14:16:06 -05:00
Guillermo del Angel 5521bf3dd7 Fix bad contract implementation 2013-02-03 16:15:14 -05:00
Guillermo del Angel f31bf37a6f First step in better BQSR unit tests for covariates (not done yet): more test coverage in basic covariates, test logging several read groups/read lengths and more combinations simultaneously.
Add basic Javadocs headers for PerReadAlleleLikehoodMap.
2013-02-03 15:31:30 -05:00
Mark DePristo 8d08780582 GATKRunReport now tracks the errorMessage and errorThrown during post for later analysis
-- This is primarily useful in the unit tests, as I now print out additional information on why a test might have failed, if it in fact did.
2013-02-02 19:24:31 -05:00
Mark DePristo 6382d5bdc9 Final cleanup and unit testing for GATKRunReport
-- Bringing code up to document, style, and code coverage specs
-- Move GATKRunReportUnitTest to private
-- Fully expand GATKRunReportUnitTests to coverage writing and reading GATKRunReport to local disk, to standard out, to AWS.
-- Move documentation URL from GATKRunReport to UserException
-- Delete a few unused files from s3GATKReport
-- Added capabilities to GATKRunReport to make testing easier
-- Added capabilities to deserialize GATKRunReports from an InputStream
2013-02-02 15:06:56 -05:00
Mark DePristo eb17230c2f Update AWS access and private keys to the new GATK2LogUploader user
-- Updated EncryptAWSKeys to write the key into the correct resources directory
2013-02-02 15:06:56 -05:00
Eric Banks 03df5e6ee6 - Added more comprehensive tests for consensus creation to RR. Still need to add tests for I/D ops.
- Added RR qual correctness tests (note that this is a case where we don't add code coverage but still need to test critical infrastructure).
- Also added minor cleanup of BaseUtils
2013-02-01 15:37:19 -05:00
David Roazen c6581e4953 Update MD5s to reflect version number change in the BAM header
I've confirmed via a script that all of these differences only
involve the version number bump in the BAM headers and nothing
else:

< @HD   VN:1.0  GO:none SO:coordinate
---
> @HD   VN:1.4  GO:none SO:coordinate
2013-02-01 13:51:31 -05:00
David Roazen c4b0ba4d45 Temporarily back out the Picard team's patches to GATKBAMIndex from December
These patches to GATKBAMIndex are causing massive BAM index reading errors in
combination with the latest version of Picard. The bug is either in the patches
themselves or in the underlying SeekableBufferedStream class they rely on. Until
the cause can be identified, we are temporarily backing out these changes so that
we can continue to run with the latest Picard/Tribble.

This reverts commits:
81483ec21e528790dfa719d18cdee27d577ca98e
68cf0309db490b79eecdabb4034987ff825ffea8
54bb68f28ad5fe1b3df01702e9c5e108106a0176
2013-02-01 13:51:31 -05:00
David Roazen 1fb182d951 Restore Utils.appendArray()
This utility method was used by the PipelineTest class, and deleting it
was causing tests to not compile.
2013-02-01 13:51:31 -05:00
Mark DePristo 6d9816f1a5 Cleanup unused utils functions, and add unit test for one (append) 2013-02-01 13:51:31 -05:00
Mark DePristo 206eab80e3 Expanded unit tests for AlignmentUtils
-- Added JIRA entries for the remaining capabilities to be fixed up and unit tested
2013-02-01 13:51:31 -05:00
David Roazen 292037dfda Rev picard, sam-jdk, and tribble
This is a necessary prerequisite for the org.broadinstitute.variant migration.

-Picard and sam-jdk go from version 1.67.1197 to 1.84.1337

-Picard-private goes from version 2375 to 2662

-Tribble goes from version 119 to 1.84.1337

-RADICALLY trimmed down the list of classes we extract from Picard-private
 (jar goes from 326993 bytes to 6445 bytes!)
2013-02-01 13:51:30 -05:00
Ryan Poplin e07cefb058 Updating AlignmentUtils.consolidateCigar() to the GATK coding standards. 2013-02-01 13:51:30 -05:00
Mark DePristo c3c4e2785b UnitTest for calcNumHighQualityBases in AlignmentUtils 2013-01-31 13:57:23 -05:00
David Roazen 6ec1e613a2 Move AWS keys to a resources subdirectory within the phonehome package
Resources must be in a subdirectory called "resources" in the package
hierarchy to be picked up by the packaging system. Adding each resource
manually to the jars in build.xml does not cause the resource to be
added to the standalone GATK jar when we package the GATK, so it's best
to always use this convention.
2013-01-31 11:56:34 -05:00
Ryan Poplin 496727ac5e Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-31 11:51:08 -05:00
Ryan Poplin ac033ce41a Intermediate commit of new bubble assembly graph traversal algorithm for the HaplotypeCaller. Adding functionality for a path from an assembly graph to calculate its own cigar string from each of the bubbles instead of doing a massive Smith-Waterman alignment between the path's full base composition and the reference. 2013-01-31 11:32:19 -05:00
Eric Banks 9c0207f8ef Fixing BQSR/BAQ bug:
If a read had an existing BAQ tag, was clipped by our engine, and couldn't have the BAQ recalculated (for whatever reason), then we would
fail in the BQSR because we would default to using the old tag (which no longer matched the length of the read bases).
The right thing to do here is to remove the old BAQ tag when RECALCULATE and ADD_TAG are the BAQ modes used but BAQ cannot be recalculated.
Added a unit test to ensure that the tags are removed in such a case.
2013-01-31 11:03:17 -05:00
Mark DePristo 404ee9a6e4 More aggressive checking of AWS key quality upon startup in the GATK 2013-01-31 09:08:38 -05:00
Ryan Poplin 438c98035b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-30 17:12:28 -05:00
Ryan Poplin bb29bd7df7 Use base List and Map types in the HaplotypeCaller when possible. 2013-01-30 17:09:27 -05:00
Mark DePristo b707331332 Encrypt GATK AWS keys using the GATK private key, and decrypt as needed as a resource when uploading to AWS logs
-- Has the overall effect that the GATK user AWS keys are no longer visible in the gatk source as plain text.  This will stop AWS from emailing me (they crawl the web looking for keys)
-- Added utility EncryptAWSKeys that takes as command line arguments the GATK user AWS access and secret keys, encrypts them with the GATK private key, and writes out the resulting file to resources in phonehome.
-- GATKRunReport now decrypts as needed these keys using the GATK public key as resources in the GATK bundle
-- Refactored the essential function of Resource (reading the resource) from IOUtils into the class itself.  Now how to get the data in the resouce is straightforward
-- Refactored md5 calculation code from a byte[] into Utils.  Added unit tests
-- Committing the encrypted AWS keys
-- #resolves https://jira.broadinstitute.org/browse/GSA-730
2013-01-30 16:42:23 -05:00
David Roazen 591df2be44 Move additional VariantContext utility methods back to the GATK
Thanks to Eric for his feedback
2013-01-30 13:58:17 -05:00
David Roazen 9985f82a7a Move BaseUtils back to the GATK by request, along with associated utility methods 2013-01-30 13:09:44 -05:00
Mark DePristo 1ff78679ca UnitTesting example for copying
-- Example combinatorial unit tests, plus unit tests that create reads and bam files, pileups, variant context (from scratch and from a file), and genome locs
2013-01-30 11:19:08 -05:00
Eric Banks d067c7f136 Resolving merge conflicts 2013-01-30 10:47:59 -05:00
Eric Banks 9025567cb8 Refactoring the SimpleGenomeLoc into the now public utility UnvalidatingGenomeLoc and the RR-specific FinishedGenomeLoc.
Moved the merging utility methods into GenomeLoc and moved the unit tests around accordingly.
2013-01-30 10:45:29 -05:00
Mark DePristo 4852c7404e GenomeLocs are already comparable, so I'm removing the less complete GenomeLocComparator class and updating ReduceReads and CompressionStash to use built-in comparator 2013-01-30 10:12:27 -05:00
Mark DePristo 45603f58cd Refactoring and unit testing GenomeLocParser
-- Moved previously inner class to MRUCachingSAMSequenceDictionary, and unit test to 100% coverage
-- Fully document all functions in GenomeLocParser
-- Unit tests for things like parsePosition (shocking it wasn't tested!)
-- Removed function to specifically create GenomeLocs for VariantContexts.  The fact that you must incorporate END attributes in the context means that createGenomeLoc(Feature) works correctly
-- Depreciated (and moved functionality) of setStart, setStop, and incPos to GenomeLoc
-- Unit test coverage at like 80%, moving to 100% with next commit
2013-01-30 09:47:47 -05:00
Mark DePristo 8562bfaae1 Optimize GenomeLocParser.createGenomeLoc
-- The new version is roughly 2x faster than the previous version.  The key here was to cleanup the workflow for validateGenomeLoc and remove the now unnecessary synchronization blocks from the CachingSequencingDictionary, since these are now thread local variables
-- #resolves https://jira.broadinstitute.org/browse/GSA-724
2013-01-30 09:47:47 -05:00
Mark DePristo 69dd5cc902 AutoFormattingTimeUnitTest should be in utils 2013-01-30 09:47:47 -05:00
Mark DePristo 92c5635e19 Cleanup, document, and unit test ActiveRegion
-- All functions tested.  In the testing / review I discovered several bugs in the ActiveRegion routines that manipulate reads.  New version should be correct
-- Enforce correct ordering of supporting states in constructor
-- Enforce read ordering when adding reads to an active region in add
-- Fix bug in HaplotypeCaller map with new updating read spans.  Now get the full span before clipping down reads in map, so that variants are correctly placed w.r.t. the full reference sequence
-- Encapsulate isActive field with an accessor function
-- Make sure that all state lists are unmodifiable, and that the docs are clear about this
-- ActiveRegion equalsExceptReads is for testing only, so make it package protected
-- ActiveRegion.hardClipToRegion must resort reads as they can become out of order
-- Previous version of HC clipped reads but, due to clipping, these reads could no longer overlap the active region.  The old version of HC kept these reads, while the enforced contracts on the ActiveRegion detected this was a problem and those reads are removed.  Has a minor impact on PLs and RankSumTest values
-- Updating HaplotypeCaller MD5s to reflect changes to ActiveRegions read inclusion policy
2013-01-30 09:47:12 -05:00
David Roazen 6449c320b4 Fix the CachingIndexedFastaSequenceFileUnitTest
BaseUtils.convertIUPACtoN() no longer throws a UserException,
since it's in org.broadinstitute.variant
2013-01-29 21:07:16 -05:00
Mauricio Carneiro 29fd536c28 Updating licenses manually
Please check that your commit hook is properly pointing at ../../private/shell/pre-commit

Conflicts:
	public/java/test/org/broadinstitute/variant/VariantBaseTest.java
2013-01-29 17:27:53 -05:00
David Roazen a536e1da84 Move some VCF/VariantContext methods back to the GATK based on feedback
-Moved some of the more specialized / complex VariantContext and VCF utility
 methods back to the GATK.

-Due to this re-shuffling, was able to return things like the Pair class back
 to the GATK as well.
2013-01-29 16:56:55 -05:00
Ami Levy-Moonshine a1908a0eca Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-29 16:33:20 -05:00
Ami Levy-Moonshine 4aaef495c6 correct the help message 2013-01-29 16:33:12 -05:00
Ryan Poplin bf25196a0b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-28 22:33:13 -05:00
Ryan Poplin e9c3a0acdf fix typo 2013-01-28 22:18:58 -05:00
Ami Levy-Moonshine a8a68697f1 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-28 20:18:51 -05:00
Guillermo del Angel 5995f01a01 Big intermediate commit (mostly so that I don't have to go again through merge/rebase hell) in expanding BQSR capabilities. Far from done yet:
a) Add option to stratify CalibrateGenotypeLikelihoods by repeat - will add integration test in next push.
b) Simulator to produce BAM files with given error profile - for now only given SNP/indel error rate can be given. A bad context can be specified and if such context is present then error rate is increased to given value.
c) Rewrote RepeatLength covariate to do the right thing - not fully working yet, work in progress.
d) Additional experimental covariates to log repeat unit and combined repeat unit+length. Needs code refactoring/testing
2013-01-28 19:55:46 -05:00
Ami Levy-Moonshine 3f5c2e4989 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-28 19:04:52 -05:00
Ami Levy-Moonshine c103623cf6 bug fix in my new function at SampleUtils.java 2013-01-28 19:04:39 -05:00
Ryan Poplin d665a8ba0c The Bayesian calculation of Qemp in the BQSR is now hierarchical. This fixes issues in which the covariate bins were very sparse and the prior estimate being used was the original quality score. This resulted in large correction factors for each covariate which breaks the equation. There is also now a new option, qlobalQScorePrior, which can be used to ignore the given (very high) quality scores and instead use this value as the prior. 2013-01-28 15:56:33 -05:00
Tad Jordan 8777e02aa5 R issue in Queue fixed.
GSA-721
2013-01-28 14:42:20 -05:00
David Roazen f63f27aa13 org.broadinstitute.variant refactor, part 2
-removed sting dependencies from test classes
-removed org.apache.log4j dependency
-misc cleanup
2013-01-28 09:03:46 -05:00
David Roazen 1599c9a20e Remove the ability to package GATK/Queue Lite from the build system
Still need to reconfigure Bamboo to open-source protected, but this
can be done during the 2.4 release freeze.
2013-01-28 02:42:37 -05:00
David Roazen 3744d1a596 Collapse the downsampling fork in the GATK engine
With LegacyLocusIteratorByState deleted, the legacy downsampling implementation
was already non-functional. This commit removes all remaining code in the
engine belonging to the legacy implementation.
2013-01-28 01:50:30 -05:00
Mark DePristo 63913d516f Add join call to Progress meter unit test so we actually know the daemon thread has finished 2013-01-27 16:52:45 -05:00
Mark DePristo 14d8afe413 Remove startSearchAt state variable from ActivityProfile
-- New algorithm will only try to create an active region if there's at least maxREgionSize + propagation distance states in the list.  When that's true, we are guaranteed to actually find a region.  So this algorithm is not only truly correct but as super fast, as we only ever do the search for the end of the region when we will certainly find one, and actually generate a region.
2013-01-27 14:10:08 -05:00
Mark DePristo c97a361b5d Added realistic BandPassFilterUnitTest that ensures quality results for 1000G phase I VCF and NA12878 VCF
-- Helped ID more bugs in the ActivityProfile, necessitating a new algorithm for popping off active regions.  This new algorithm requires that at least maxRegionSize + prob. propagation distance states have been examined.  This ensures that the incremental results are the same as you get reading in an entire profile and running getRegions on the full profile
-- TODO is to remove incremental search start algorithm, as this is no longer necessary, and nicely eliminates a state variable I was always uncomfortable with
2013-01-27 14:10:08 -05:00
Mark DePristo 72b2e77eed Linearize the findEndOfRegion algorithm in ActivityProfile, radically improving its performance
-- Previous algorithm was O(N^2)
-- #resolve GSA-723 https://jira.broadinstitute.org/browse/GSA-723
2013-01-27 14:10:06 -05:00
Mark DePristo 0fb238b61e TraverseActiveRegions Optimizations and Bugfixes: make sure to record position of current locus to discharge active regions when there's no data
-- Now records the position of the current locus, as well as that of the last read.  Necessary when passing through regions with no reads.  The previous version would keep accumulating empty active regions, and never discharge them until end of traversal (if there was no reads in the future) or until a read was finally found
-- Protected a call to logger.debug with if ( logger.isDebugEnabled()) to avoid a lot of overhead in writing unseen debugger logging information
2013-01-27 14:10:06 -05:00
Mark DePristo 93d88cdc68 Optimization: LocusReferenceView now passes along the contig index to createGenomeLoc, speeding up their creation
-- Also cleaned up some unused methods
2013-01-27 14:10:06 -05:00
Mark DePristo 52a28968a9 ART optimization: BandPassActivityProfile only applies the gaussian filter if the state probability > 0 2013-01-27 14:10:06 -05:00
Mauricio Carneiro 705cccaf63 Making SplitReads output FastQ's instead of BAM
- eliminates one step in my pipeline
   - BAM is too finicky and maintaining parameters that wouldn't be useful was becoming a headache, better avoided.
2013-01-27 02:36:31 -05:00
Mauricio Carneiro 6ea7133d95 Updating licenses of latest moved files 2013-01-26 13:46:52 -05:00
Mauricio Carneiro e7c9e3639e Making metrics a required parameter in MarkDuplicates
As requested by user (forum)
2013-01-25 17:49:49 -05:00
Ami Levy-Moonshine 99cb8d68e9 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-25 16:07:38 -05:00
Mark DePristo b8c0b05785 Add contract to ensure that getAdapterBoundary returns the right result
-- Also renamed the function to getAdaptorBoundary for consistency across the codebase
2013-01-25 16:05:17 -05:00
Mark DePristo e445c71161 LIBS optimization for adapter clipping
-- GATKSAMRecords now cache the result of the getAdapterBoundary, allowing us to avoid repeating a lot of work in LIBS
-- Added unittests to cover adapter clipping
2013-01-25 16:05:17 -05:00
Ami Levy-Moonshine f50db01742 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-25 15:55:56 -05:00
Ami Levy-Moonshine b4447cdca2 In cases where one uses VariantContextUtils.GenotypeMergeType.REQUIRE_UNIQUE we used to verify that the samples names are unique in VariantContextUtils.simpleMerge for each VCs. It couse to a bug that was reported on the forum (when a VCs had 2 VC from the same sample).
Now we will check it only in CombineVariants.init using the headers. A new function was added to SamplesUtils with unitTests in CVunitTest.java.
2013-01-25 15:49:51 -05:00
Khalid Shakir c58e02a3bd Added a QFunction.jobLocalDir for optionally tracking a node local directory that may have faster intermediate storage, with SGF ensuring that if the directory happens to be on the same machine that it get's a clone specific sub-directory to avoid collisions. 2013-01-25 14:28:04 -05:00
Ami Levy-Moonshine fc22a5c71c Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-25 11:47:38 -05:00
Ami Levy-Moonshine eaf6279d48 adding RBP to the general calling pipeline and few other small changes to it (to make it run with the current bundel file names 2013-01-25 11:47:30 -05:00
Mark DePristo 008b617577 Cleanup the getLIBS function in LocusIterator
-- Now throws an UnsupportedOperationException in the base class.  Only LocusView implements this function and actually returns the LIBS
2013-01-25 11:07:28 -05:00
Eric Banks 6dd0e1ddd6 Pulled out the --regenotype functionality from SelectVariants into its own tool: RegenotypeVariants.
This allows us to move SelectVariants into the public suite of tools now.
2013-01-25 09:42:04 -05:00
Mark DePristo c7a29b1d39 Fixed NPE in ActiveRegionUnitTest by allowing null supporting states in ActiveRegion 2013-01-24 13:48:00 -05:00
Mark DePristo 592f90aaef ActivityProfile now cuts intelligently at the best local minimum when in a larger than max size active region
-- This new algorithm is essential to properly handle activity profiles that have many large active regions generated from lots of dense variant events.  The new algorithm passes unit tests and passes visualize visual inspection of both running on 1000G and NA12878
-- Misc. commenting of the code
-- Updated ActiveRegionExtension to include a min active region size
-- Renamed ActiveRegionExtension to ActiveRegionTraversalParameters, as it carries more than just the traversal extension now
2013-01-24 13:48:00 -05:00
Mark DePristo c96b64973a Soft clip probability propagation is capped by the MAX_PROB_PROPAGATION_DISTANCE, which is 50 bp 2013-01-24 13:48:00 -05:00
Mark DePristo 0c94e3d96e Adaptively compute the band pass filter from the sigma, up to a maximum size of 50 bp
-- Previously we allowed band pass filter size to be specified along with the sigma.  But now that sigma is controllable from walkers and from the command line, we instead compute the filter size given the kernel from the sigma, including all kernel points with p > 1e-5 in the kernel.  This means that if you use a smaller kernel you get a small band size and therefore faster ART
-- Update, as discussed with Ryan, the sigma and band size to 17 bp for HC (default ART wide) and max band size of 50 bp
2013-01-24 13:47:59 -05:00
Mark DePristo 9e43a2028d Making band pass filter size, sigma, active region max size and extension all accessible from the command line 2013-01-24 13:47:59 -05:00
Mark DePristo cd91e365f4 Optimize getCurrentContigLength and getLocForOffset in ActivityProfile 2013-01-24 13:47:59 -05:00
Eric Banks 6790e103e0 Moving lots of walkers back from protected to public (along with several of the VA annotations).
Let's see whether Mauricio's automatic git hook really works!
2013-01-24 11:42:49 -05:00
Mark DePristo ee8039bf25 Fix trivial call in unit test 2013-01-23 13:51:58 -05:00
Mark DePristo 09edc6baeb TraverseActiveRegions now writes out very nice active region and activity profile IGV formatted files 2013-01-23 13:46:01 -05:00
Mark DePristo 8e8126506b Renaming IncrementalActivityProfile to ActivityProfile
-- Also adding a work in progress functionality to make it easy to visualize activity profiles and active regions in IGV
2013-01-23 13:46:01 -05:00
Mark DePristo e917f56df8 Remove old ActivityProfile and old BandPassActivityProfile 2013-01-23 13:46:01 -05:00
Mark DePristo 7fd27a5167 Add band pass filtering activity profile
-- Based on the new incremental activity profile
-- Unit Tested!  Fixed a few bugs with the old band pass filter
-- Expand IncrementalActivityProfileUnitTest to test the band pass filter as well for basic properties
-- Add new UnitTest for BandPassIncrementalActivityProfile
-- Added normalizeFromRealSpace to MathUtils
-- Cleanup unused code in new activity profiles
2013-01-23 13:46:01 -05:00
Mark DePristo eb60235dcd Working version of incremental active region traversals
-- The incremental version now processes active regions as soon as they are ready to be processed, instead of waiting until the end of the shard as in the previous version.  This means that ART walkers will now take much less memory than previously.  On chr20 of NA12878 the majority of regions are processed with as few as 500 reads in memory.  Over the whole chr20 only 5K reads were ever held in ART at one time.
-- Fixed bug in the way active regions worked with shard boundaries.  The new implementation no longer see shard boundaries in any meaningful way, and that uncovered a problem that active regions were always being closed across shard boundaries.  This behavior was actually encoded in the unit tests, so those needed to be updated as well.
-- Changed the way that preset regions work in ART.  The new contract ensures that you get exactly the regions you requested.  the isActive function is still called, but its result has no impact on the regions.  With this functionality is should be possible to use the HC as a generic assembly by forcing it to operate over very large regions
-- Added a few misc. useful functions to IncrementalActivityProfile
2013-01-23 13:46:00 -05:00
Mark DePristo ce160931d5 Optimize creation of reads in ArtificialBAMBuilder
-- Now caches the reads so subsequent calls to makeReads() don't reallocate the reads from scratch each time
2013-01-23 13:46:00 -05:00
Mark DePristo e050f649fd IncrementalActivityProfile, complete with extensive unit tests
-- This is an activity profile compatible with fetching its implied active regions incrementally, as activity profile states are added
2013-01-23 13:45:21 -05:00
Mark DePristo 8d9b0f1bd5 Restructure ActivityProfiler into root class ActivityProfile and derived class BandPassActivityProfile
-- Required before I jump in an redo the entire activity profile so it's can be run imcrementally
-- This restructuring makes the differences between the two functionalities clearer, as almost all of the functionality is in the base class. The only functionality provided by the BandPassActivityProfile is isolated to a finalizeProfile function overloaded from the base class.
-- Renamed ActivityProfileResult to ActivityProfileState, as this is a clearer indication of its actual functionality.  Almost all of the misc. walker changes are due to this name update
-- Code cleanup and docs for TraverseActiveRegions
-- Expanded unit tests for ActivityProfile and ActivityProfileState
2013-01-23 13:45:21 -05:00
Mark DePristo 42b807a5fe Unit tests for ActivityProfileResult 2013-01-23 13:45:20 -05:00
Mauricio Carneiro 7b8b064165 Last manual license update (hopefully)
if everyone updates their git hook accordingly, this will be the last time I have to manually run the script.

GSATDG-5
2013-01-18 16:13:07 -05:00
Ami Levy-Moonshine 0fb7b73107 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-18 15:03:42 -05:00
Ami Levy-Moonshine 826c29827b change the default VCFs gatherer of the GATK (not just the UG) 2013-01-18 15:03:12 -05:00
Eric Banks 6a903f2c23 I finally gave up on trying to get the Haplotype/Allele merging to work in the HaplotypeCaller.
I've resigned myself instead to create a mapping from Allele to Haplotype.  It's cheap so not a big deal, but really shouldn't be necessary.
Ryan and I are talking about refactoring for GATK2.5.
2013-01-18 01:21:08 -05:00
Eric Banks ded659232b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 22:49:56 -05:00
Eric Banks a623cca89a Bug fix for HaplotypeCaller, as reported on the forum: when reduced reads didn't completely overlap a deletion call,
we were incorrectly trying to find the reference position of a base on the read that didn't exist.
Added integration test to cover this case.
2013-01-16 22:47:58 -05:00
Mark DePristo 738c24a3b1 Add tests to ensure that all insertion reads appear in the active region traversal 2013-01-16 16:25:36 -05:00
Eric Banks 79bc818022 Bug fix for VariantsToVCF: old dbSNP files can have '-' as reference base and those records always need to be padded. 2013-01-16 16:15:58 -05:00
Mark DePristo 2a42b47e4a Massive expansion of ActiveRegionTraversal unit tests, resulting in several bugfixes to ART
-- UnitTests now include combinational tiling of reads within and spanning shard boundaries
-- ART now properly handles shard transitions, and does so efficiently without requiring hash sets or other collections of reads
-- Updating HC and CountReadsInActiveRegions integration tests
2013-01-16 15:30:00 -05:00
Mark DePristo ddcb33fcf8 Cache result of getLocation() in Shard so we don't performance expensive calculation over and over 2013-01-16 15:30:00 -05:00
Mark DePristo 4d0e7b50ec ArtificialBAMBuilder utility class for creating streams of GATKSAMRecords with a variety of properties
--  Allows us to make a stream of reads or an index BAM file with read having the following properties (coming from n samples, of fixed read length and aligned to the genome with M operator, having N reads per alignment start, skipping N bases between each alignment start, starting at a given alignment start)
-- This stream can be handed back to the caller immediately, or written to an indexed BAM file
-- Update LocusIteratorByStateUnitTest to use this functionality (which was refactored from LIBS unit tests and ArtificialSAMUtils)
2013-01-16 15:29:59 -05:00
Eric Banks ec1cfe6732 Oops, forgot to add 1 of my files 2013-01-16 15:05:49 -05:00
Eric Banks e47a389b26 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 14:59:11 -05:00
Eric Banks d18dbcbac1 Added tests for changing IUPAC bases to Ns, for failing on bad ref bases, and for the HaplotypeCaller not failing when running over a region with an IUPAC base.
Out of curiosity, why does Picard's IndexedFastaSequenceFile allow one to query for start position 0?  When doing so, that base is a line feed (-1 offset to the first base in the contig) which is an illegal base (and which caused me no end of trouble)...
2013-01-16 14:55:33 -05:00
Khalid Shakir 4ffb43079f Re-committing the following changes from Dec 18:
Refactored interval specific arguments out of GATKArgumentCollection into InvtervalArgumentCollection such that it can be used in other CommandLinePrograms.
Updated SelectHeaders to print out full interval arguments.
Added RemoteFile.createUrl(Date expiration) to enable creation of presigned URLs for download over http: or file:.
2013-01-16 12:43:15 -05:00
Eric Banks 445735a4a5 There was no reason to be sharing the Haplotype infrastructure between the HaplotypeCaller and the HaplotypeScore annotation since they were really looking for different things.
Separated them out, adding efficiencies for the HaplotypeScore version.
2013-01-16 11:10:13 -05:00
Eric Banks 392b5cbcdf The CachingIndexedFastaSequenceFile now automatically converts IUPAC bases to Ns and errors out on other non-standard bases.
This way walkers won't see anything except the standard bases plus Ns in the reference.
Added option to turn off this feature (to maintain backwards compatibility).

As part of this commit I cleaned up the BaseUtils code by adding a Base enum and removing all of the static indexes for
each of the bases.  This uncovered a bug in the way the DepthOfCoverage walker counts deletions (it was counting Ns instead!) that isn't covered by tests.  Fortunately that walker is being deprecated soon...
2013-01-16 10:22:43 -05:00
Eric Banks 4fb3e48099 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 00:13:38 -05:00
Eric Banks 0d282a7750 Bam writing from HaplotypeCaller seems to be working on all my test cases. Note that it's a hidden debugging option for now.
Please let me know if you notice any bad behavior with it.
2013-01-16 00:12:02 -05:00
Eric Banks d3baa4b8ca Have Haplotype extend the Allele class.
This way, we don't need to create a new Allele for every read/Haplotype pair to be placed in the PerReadAlleleLikelihoodMap (very inefficient).  Also, now we can easily get the Haplotype associated with the best allele for a given read.
2013-01-15 11:36:20 -05:00
Mark DePristo 3c37ea014b Retire original TraverseActiveRegion, leaving only the new optimized version
-- Required some updates to MD5s, which was unexpected, and will be sorted out later with more detailed unit tests
2013-01-15 10:24:45 -05:00
Eric Banks 94800771e3 1. Initial implementation of bam writing for the HaplotypeCaller with -bam argument; currently only assembled haplotypes are emitted.
2. Framework is set up in the VariantAnnotator for the HaplotypeCaller to be able to call in to annotate dbSNP plus comp RODs.  Until the HC uses meta data though, this won't work.
2013-01-15 10:19:18 -05:00
Mark DePristo 39bc9e999d Add a test to LocusIteratorByState to ensure that we aren't holding reads anywhere
-- Run an iterator with 100Ks of reads, each carrying MBs of byte[] data, through LIBS, all starting at the same position.  Will crash with an out-of-memory error if we're holding reads anywhere in the system.
-- Is there a better way to test this behavior?
2013-01-14 16:30:16 -05:00
Mark DePristo b8b2b9b2de ManagingReferenceOrderedView optimization: don't allow a fresh RefMetaDataTracker in the frequent case where there's no reference meta data 2013-01-14 16:30:16 -05:00
Mark DePristo 7eea6b8f92 ReservoirDownsampler optimizations
-- Add an option to not allocate always ArrayLists of targetSampleSize, but rather the previous size + MARGIN.  This helps for LIBS as most of the time we don't need nearly so much space as we allow
-- consumeFinalizedItems returns an empty list if the reservior is empty, which it often true for our BAM files with low coverage
-- Allow empty sample lists for SamplePartitioner as these are used by the RefTraversals and other non-read based traversals

Make the reservoir downsampler use a linked list, rather than a fixed sized array list, in the expectFewOverflows case
2013-01-14 16:30:16 -05:00
Mark DePristo c7f0ca8ac5 Optimization for LIBS: PerSampleReadStateManager now uses a simple LinkedList of AlignmentStateMachine
-- Instead of storing a list of list of alignment starts, which is expensive to manipulate, we instead store a linear list of alignment starts.  Not grouped as previously.  This enables us to simplify iteration and update operations, making them much faster
-- Critically, the downsampler still requires this list of list.  We convert back and forth between these two representations as required, which is very rarely for normal data sets (WGS NA12878 on chr20 is 0.2%, 4x WGS is even less).
2013-01-14 16:30:16 -05:00
Mark DePristo 5a5422e4f8 Refactor PerSampleReadStates into a separate class
-- No longer update the total counts in each per-sample state manager, but instead return delta counts that are updated by the overall ReadStateManager
-- One step on the way to improving the underlying representation of the data in PerSampleReadStateManager
-- Make LocusIteratorByState final
2013-01-14 16:30:16 -05:00
Mark DePristo 5c2799554a Refactor updateReadStates into PerSampleReadStateManager, add tracking of downsampling rate 2013-01-14 16:30:16 -05:00
Mark DePristo a4334a67e0 SamplePartitioner optimizations and bugfixes
-- Use a linked hash map instead of a hash map since we want to iterate through the map fairly often
-- Ensure that we call doneSubmittingReads before getting reads for samples.  This function call fell out before and since it wasn't enforced I only noticed the problem while writing comments
-- Don't make unnecessary calls to contains for map.  Just use get() and check that the result is null
-- Use a LinkedList in PassThroughDownsampler, since this is faster for add() than the existing ArrayList, and we were's using random access to any resulting
2013-01-14 16:30:16 -05:00
Mark DePristo 19288b007d LIBS bugfix: kept reads now only (correctly) includes reads that at least passed the reservoir
-- Added unit tests to ensure this behavior is correct
2013-01-14 16:30:16 -05:00
Mark DePristo 83fcc06e28 LIBS optimizations and performance tools
-- Made LIBSPerformance a full featured CommandLineProgram, and it can be used to assess the LIBS performance by reading a provided BAM
-- ReadStateManager now provides a clean interface to iterate in sample order the per-sample read states, allowing us to avoid many map.get calls
-- Moved updateReadStates to ReadStateManager
-- Removed the unnecessary wrapping of an iterator in ReadStateManager
-- readStatesBySample is now a LinkedHashMap so that iteration occurs in LIBS sample order, allowing us to avoid many unnecessary calls to map.get iterating over samples.  Now those are just map native iterations
-- Restructured collectPendingReads for simplicity, removing redundant and consolidating common range checks.  The new piece is code is much clearer and avoids several unnecessary function calls
2013-01-14 16:30:15 -05:00
Mark DePristo ec05ecef60 getAdaptorBoundary returns an int, not an Integer, as this was taking 30% of the allocation effort for LIBS 2013-01-14 16:30:15 -05:00
Mark DePristo 3a6b4b43b7 Backporting LIBSPerformance improvements to original commit 2013-01-13 09:53:10 -05:00
Mark DePristo f204908a94 Add some todos for future optimization to LIBS 2013-01-11 15:17:18 -05:00
Mark DePristo e88dae2758 LocusIteratorByState operates natively on GATKSAMRecords now
-- Updated code to reflect this new typing
2013-01-11 15:17:18 -05:00
Mark DePristo 94cb50d3d6 Retire LegacyLocusIteratorByState
-- Left in the remaining infrastructure for David to remove, but the legacy downsampler is no longer a functional option in the GATK
2013-01-11 15:17:18 -05:00
Mark DePristo cc0c1b752a Delete old LocusIteratorByState, leaving only new LIBS and legacy 2013-01-11 15:17:18 -05:00
Mark DePristo bd03511e35 Updating AlignmentStateMachinePerformance to include some more useful performance assessments 2013-01-11 15:17:18 -05:00
Mark DePristo 9e23c592e6 ReadBackedPileup cleanup
-- Only ReadBackedPileupImpl (concrete class) and ReadBackedPileup (interface) live, moved all functionality of AbstractReadBackedPileup into the impl
-- ReadBackedPileupImpl was literally a shell class after we removed extended events.  A few bits of code cleanup and we reduced a bunch of class complexity in the gatk
-- ReadBackedPileups no longer accept pre-cached values (size, nMapQ reads, etc) but now lazy load these values as needed
-- Created optimized calculation routines to iterator over all of the reads in the pileup in whatever order is most efficient as well.
-- New LIBS no longer calculates size, n mapq, and n deletion reads while making pileups.
-- Added commons-collections for IteratorChain
2013-01-11 15:17:18 -05:00
Mark DePristo e3e3ae29b2 Final documentation for LocusIteratorByState 2013-01-11 15:17:18 -05:00
Mark DePristo 6a91902aa2 Fix final merge conflicts 2013-01-11 15:17:18 -05:00
Mark DePristo b9a33d3c66 Split original and optimized ART into largely independent pieces
-- Allows us to cleanly run old and new art, which now have different traversal behavior (on purpose).  Split unit tests as well.
2013-01-11 15:17:18 -05:00
Mark DePristo 02130dfde7 Cleanup ART
-- Initialize routine captures essential information for running the traversal
2013-01-11 15:17:17 -05:00
Mark DePristo 9b2be795a7 Initial working version of new ActiveRegionTraversal based on the LocusIteratorByState read stream
-- Implemented as a subclass of TraverseActiveRegions
-- Passes all unit tests
-- Will be very slow -- needs logical fixes
2013-01-11 15:17:17 -05:00
Mark DePristo 8b83f4d6c7 Near final cleanup of PileupElement
-- All functions documented and unit tested
-- New constructor interface
-- Cleanup some uses of old / removed functionality
2013-01-11 15:17:17 -05:00
Mark DePristo fb9eb3d4ee PileupElement and LIBS cleanup
-- function to create pileup elements in AlignmentStateMachine and LIBS
-- Cleanup pileup element constructors, directing users to LIBS.createPileupFromRead() that really does the right thing
2013-01-11 15:17:17 -05:00
Mark DePristo 2f2a592c8e Contracts and documentation for AlignmentStateMachine and LocusIteratorByState
-- Add more unit tests for both as well
2013-01-11 15:17:17 -05:00