Commit Graph

674 Commits (e022db46901ab9953a50bd12b019783a6879e9c4)

Author SHA1 Message Date
Guillermo del Angel f176c854c6 Swapping in logless Pair HMM for default usage with UG:
-- Changed default HMM model.
-- Removed check.
-- Changed md5's: PL's in the high 100s change by a point or two due to new implementation.
-- Resulting performance improvement is about 30 to 50% less runtime when using -glm INDEL.
2013-06-18 10:06:27 -04:00
Ryan Poplin 8511c4385c Adding new pruning parameter to ReadThreadingAssembler
-- numPruningSamples allows one to specify that the minPruning factor must be met by this many samples for a path to be considered good (e.g. seen twice in three samples). By default this is just one sample.
-- adding unit test to test this new functionality
2013-06-17 16:46:40 -04:00
Guillermo del Angel f6025d25ae Feature requested by Reich lab and Paavo lab in Leipzig for ancient DNA processing:
-- When doing cross-species comparisons and studying population history and ancient DNA data, having SOME measure of confidence is needed at every single site that doesn't depend on the reference base, even in a naive per-site SNP mode. Old versions of GATK provided GQ and some wrong PL values at reference sites but these were wrong. This commit addresses this need by adding a new UG command line argument, -allSitePLs, that, if enabled will:
a) Emit all 3 ALT snp alleles in the ALT column.
b) Emit all corresponding 10 PL values.
It's up to the user to process these PL values downstream to make sense of these. Note that, in order to follow VCF spec, the QUAL field in a reference call when there are non-null ALT alleles present will be zero, so QUAL will be useless and filtering will need to be done based on other fields.
-- Tweaks and fixes to processing pipelines for Reich lab.
2013-06-17 13:21:09 -04:00
Eric Banks e48f754478 Fixes to several of the annotations for reduced reads (and other issues).
1. Have the RMSMappingQuality annotation take into account the fact that reduced reads represent multiple reads.

2. The rank sume tests should not be using reduced reads (because they do not represent distinct observations).

3. Fixed a massive bug in the BaseQualityRankSumTest annotation!  It was not using the base qualities but rather
the read likelihoods?!

Added a unit test for Rank Sum Tests to prove that the distributions are correctly getting assigned appropriate p-values.
Also, and just as importantly, the test shows that using reduced reads in the rank sum tests skews the results and
makes insignificant distributions look significant (so it can falsely cause the filtering of good sites).

Also included in this commit is a massive refactor of the RankSumTest class as requested by the reviewer.
2013-06-16 01:18:20 -04:00
Mark DePristo dd5674b3b8 Add genotyping accuracy assessment to AssessNA12878
-- Now table looks like:

Name     VariantType  AssessmentType           Count
variant  SNPS         TRUE_POSITIVE              1220
variant  SNPS         FALSE_POSITIVE                0
variant  SNPS         FALSE_NEGATIVE                1
variant  SNPS         TRUE_NEGATIVE               150
variant  SNPS         CALLED_NOT_IN_DB_AT_ALL       0
variant  SNPS         HET_CONCORDANCE          100.00
variant  SNPS         HOMVAR_CONCORDANCE        99.63
variant  INDELS       TRUE_POSITIVE               273
variant  INDELS       FALSE_POSITIVE                0
variant  INDELS       FALSE_NEGATIVE               15
variant  INDELS       TRUE_NEGATIVE                79
variant  INDELS       CALLED_NOT_IN_DB_AT_ALL       2
variant  INDELS       HET_CONCORDANCE           98.67
variant  INDELS       HOMVAR_CONCORDANCE        89.58

-- Rewrite / refactored parts of subsetDiploidAlleles in GATKVariantContextUtils to have a BEST_MATCH assignment method that does it's best to simply match the genotype after subsetting to a set of alleles.  So if the original GT was A/B and you subset to A/B it remains A/B but if you subset to A/C you get A/A.  This means that het-alt B/C genotypes become A/B and A/C when subsetting to bi-allelics which is the convention in the KB.  Add lots of unit tests for this functions (from 0 previously)
-- BadSites in Assessment now emits TP sites with discordant genotypes with the type GENOTYPE_DISCORDANCE and tags the expected genotype in the info field as ExpectedGenotype, such as this record:

20      10769255        .       A       ATGTG   165.73  .       ExpectedGenotype=HOM_VAR;SupportingCallsets=ebanks,depristo,CEUTrio_best_practices;WHY=GENOTYPE_DISCORDANCE     GT:AD:DP:GQ:PL  0/1:1,9:10:6:360,0,6

Indicating that the call was a HET but the expected result was HOM_VAR
-- Forbid subsetting of diploid genotypes to just a single allele.
-- Added subsetToRef as a separate specific function.  Use that in the DiploidExactAFCalc in the case that you need to reduce yourself to ref only. Preserves DP in the genotype field when this is possible, so a few integration tests have changed for the UG
2013-06-13 15:05:32 -04:00
Mark DePristo 33720b83eb No longer merge overlapping fragments from HaplotypeCaller
-- Merging overlapping fragments turns out to be a bad idea.  In the case where you can safely merge the reads you only gain a small about of overlapping kmers, so the potential gains are relatively small.  That's in contrast to the very large danger of merging reads inappropriately, such as when the reads only overlap in a repetitive region, and you artificially construct reads that look like the reference but actually may carry a larger true insertion w.r.t. the reference.  Because this problem isn't limited to repetitive sequeuence, but in principle could occur in any sequence, it's just not safe to do this merging.  Best to leave haplotype construction to the assembly graph.
2013-06-13 15:05:32 -04:00
Mark DePristo c837d67b2f Merge pull request #273 from broadinstitute/rp_readIsPoorlyModelled
Relaxing the constraints on the readIsPoorlyModelled function.
2013-06-13 08:40:24 -07:00
Ryan Poplin f44efc27ae Relaxing the constraints on the readIsPoorlyModelled function.
-- Turns out we were aggressively throwing out borderline-good reads.
2013-06-13 11:06:23 -04:00
Ryan Poplin d5f0848bd5 HC bam writer now sets the read to MQ0 if it isn't informative
-- Makes visualization of read evidence easier in IGV.
2013-06-13 10:11:54 -04:00
sathibault 336050ab71 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java
2013-06-13 07:28:24 -05:00
Ryan Poplin d1f397c711 Fixing bug with dangling tails in which the tail connects all the way back to the reference source node.
-- List of vertices can't contain a source node.
2013-06-12 12:23:01 -04:00
Ryan Poplin e1fd3dff9a Merge pull request #268 from broadinstitute/eb_calling_accuracy_improvements_to_HC
Eb calling accuracy improvements to hc
2013-06-11 11:18:51 -07:00
Eric Banks dadcfe296d Reworking of the dangling tails merging code.
We now run Smith-Waterman on the dangling tail against the corresponding reference tail.
If we can generate a reasonable, low entropy alignment then we trigger the merge to the
reference path; otherwise we abort.  Also, we put in a check for low-complexity of graphs
and don't let those pass through.

Added tests for this implementation that checks exact SW results and correct edges added.
2013-06-11 12:53:04 -04:00
Guillermo del Angel 55d5f2194c Read Error Corrector for haplotype assembly
Principle is simple: when coverage is deep enough, any single-base read error will look like a rare k-mer but correct sequence will be supported by many reads to correct sequences will look like common k-mers. So, algorithm has 3 main steps:
1. K-mer graph buildup.
For each read in an active region, a map from k-mers to the number of times they have been seen is built.
2. Building correction map.
All "rare" k-mers that are sparse (by default, seen only once), get mapped to k-mers that are good (by default, seen at least 20 times but this is a CL argument), and that lie within a given Hamming distance (by default, =1). This map can be empty (i.e. k-mers can be uncorrectable).
3. Correction proposal
For each constituent k-mer of each read, if this k-mer is rare and maps to a good k-mer, get differing base positions in k-mer and add these to a list of corrections for each base in each read. Then, correct read at positions where correction proposal is unanimous and non-empty.

The algorithm defaults are chosen to be very stringent and conservative in the correction: we only try to correct singleton k-mers, we only look for good k-mers lying at Hamming distance = 1 from them, and we only correct a base in read if all correction proposals are congruent.

By default, algorithm is disabled but can be enabled in HaplotypeCaller via the -readErrorCorrect CL option. However, at this point it's about 3x-10x more expensive so it needs to be optimized if it's to be used.
2013-06-11 12:26:24 -04:00
Eric Banks c0030f3f2d We no longer subset down to the best N haplotypes for the GL calculation.
I explain in comments within the code that this was causing problems with the marginalization over events.
2013-06-11 11:51:26 -04:00
Eric Banks c0e3874db0 Change the HC's phredScaledGlobalReadMismappingRate from 60 to 45, because Ryan and Mark told me to. 2013-06-11 11:51:26 -04:00
Eric Banks 77868d034f Do not allow the use of Ns in reads for graph construction.
Ns are treated as wildcards in the PairHMM so creating haplotypes with Ns gives them artificial advantages over other ones.
This was the cause of at least one FN where there were Ns at a SNP position.
2013-06-11 11:51:26 -04:00
Eric Banks e4e7d39e2c Fix FN problem stemming from sequence graphs that contain cycles.
Problem:
The sequence graphs can get very complex and it's not enough just to test that any given read has non-unique kmers.
Reads with variants can have kmers that match unique regions of the reference, and this causes cycles in the final
sequence graph.  Ultimately the problem is that kmers of 10/25 may not be large enough for these complex regions.

Solution:
We continue to try kmers of 10/25 but detect whether cycles exist; if so, we do not use them.  If (and only if) we
can't get usable graphs from the 10/25 kmers, then we start iterating over larger kmers until we either can generate
a graph without cycles or attempt too many iterations.
2013-06-11 11:51:26 -04:00
Ryan Poplin 58e354176e Minor changes to docs in the graph pruning. 2013-06-11 10:33:22 -04:00
Mark DePristo 1c03ebc82d Implement ActiveRegionTraversal RefMetaDataTracker for map call; HaplotypeCaller now annotates ID from dbSNP
-- Reuse infrastructure for RODs for reads to implement general IntervalReferenceOrderedView so that both TraverseReads and TraverseActiveRegions can use the same underlying infrastructure
-- TraverseActiveRegions now provides a meaningful RefMetaDataTracker to ActiveRegionWalker.map
-- Cleanup misc. code as it came up
-- Resolves GSA-808: Write general utility code to do rsID allele matching, hook up to UG and HC
2013-06-10 16:20:31 -04:00
Mauricio Carneiro 1d67d07cf1 better docs for Qualify Missing Intervals
now that it's available to the public, better give'em good docs!
2013-06-10 15:17:40 -04:00
Mauricio Carneiro c84f0deb1d Don't crash if cds file is not provided
CDS file should be optional.
2013-06-10 13:42:00 -04:00
Mauricio Carneiro a95fbd48e5 Moving QualifyMissingIntervals to protected
Making this walker available so we can share it with the CSER group for CLIA analysis.
2013-06-10 13:11:41 -04:00
Michael McCowan 00c06e9e52 Performance improvements:
- Memoized MathUtil's cumulative binomial probability function.
 - Reduced the default size of the read name map in reduced reads and handle its resets more efficiently.
2013-06-09 11:26:52 -04:00
Mark DePristo 209dd64268 HaplotypeCaller now emits per-sample DP
-- Created a new annotation DepthPerSampleHC that is by default on in the HaplotypeCaller
-- The depth for the HC is the sum of the informative alleles at this site.  It's not perfect (as we cannot differentiate between reads that align over the event but aren't informative vs. those that aren't even close) but it's a pretty good proxy and it matches with the AD field (i.e., sum(AD) = DP).
-- Update MD5s
-- delivers [#48240601]
2013-06-06 09:47:32 -04:00
Mark DePristo 34bdf20132 Bugfix for bad AD values in UG/HC
-- In the case where we have multiple potential alternative alleles *and* we weren't calling all of them (so that n potential values < n called) we could end up trimming the alleles down which would result in the mismatch between the PerReadAlleleLikelihoodMap alleles and the VariantContext trimmed alleles.
-- Fixed by doing two things (1) moving the trimming code after the annotation call and (2) updating AD annotation to check that the alleles in the VariantContext and the PerReadAlleleLikelihoodMap are concordant, which will stop us from degenerating in the future.
-- delivers [#50897077]
2013-06-05 17:48:41 -04:00
Mark DePristo c9f5b53efa Bugfix for HC can fail to assemble the correct reference sequence in some cases
-- Ultimately this was caused by overly aggressive merging of CommonSuffixMerger.  In the case where you have this graph:

ACT [ref source] -> C
G -> ACT -> C

we would merge into

G -> ACT -> C

which would linearlize into

GACTC

Causing us to add bases to the reference source node that couldn't be recovered.  The solution was to ensure that CommonSuffixMerger only operates when all nodes to be merged aren't source nodes themselves.

-- Added a convenient argument to the haplotype caller (captureAssemblyFailureBAM) that will write out the exact reads to a BAM file that went into a failed assembly run (going to a file called AssemblyFailure.BAM).  This can be used to rerun the haplotype caller to produce the exact error, which can be hard in regions of deep coverage where the downsampler state determines the exact reads going into assembly and therefore makes running with a sub-interval not reproduce the error
-- Did some misc. cleanup of code while debugging
-- [delivers #50917729]
2013-06-03 16:16:39 -04:00
Ryan Poplin ab40f4af43 Break out the GGA kmers and the read kmers into separate functions for the DeBruijn assembler.
-- Added unit test for new function.
2013-06-03 14:00:35 -04:00
sathibault de2a2a4cc7 Added command-line flag to disble FPGA
Completed integration with FPGA driver
2013-06-03 07:30:32 -05:00
Mark DePristo 64b4d80729 Make BQSR calculateIsIndel robust to indel CIGARs are start/end of read
-- The previous implementation attempted to be robust to this, but not all cases were handled properly.  Added a helper function updateInde() that bounds up the update to be in the range of the indel array, and cleaned up logic of how the method works.  The previous behavior was inconsistent across read fwd/rev stand, so that the indel cigars at the end of read were put at the start of reads if the reads were in the forward strand but not if they were in the reverse strand.  Everything is now consistent, as can be seen in the symmetry of the unit tests:

        tests.add(new Object[]{"1D3M",   false, EventType.BASE_DELETION, new int[]{0,0,0}});
        tests.add(new Object[]{"1M1D2M", false, EventType.BASE_DELETION, new int[]{1,0,0}});
        tests.add(new Object[]{"2M1D1M", false, EventType.BASE_DELETION, new int[]{0,1,0}});
        tests.add(new Object[]{"3M1D",   false, EventType.BASE_DELETION, new int[]{0,0,1}});

        tests.add(new Object[]{"1D3M",   true, EventType.BASE_DELETION, new int[]{1,0,0}});
        tests.add(new Object[]{"1M1D2M", true, EventType.BASE_DELETION, new int[]{0,1,0}});
        tests.add(new Object[]{"2M1D1M", true, EventType.BASE_DELETION, new int[]{0,0,1}});
        tests.add(new Object[]{"3M1D",   true, EventType.BASE_DELETION, new int[]{0,0,0}});

        tests.add(new Object[]{"4M1I",   false, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
        tests.add(new Object[]{"3M1I1M", false, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
        tests.add(new Object[]{"2M1I2M", false, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});
        tests.add(new Object[]{"1M1I3M", false, EventType.BASE_INSERTION, new int[]{1,0,0,0,0}});
        tests.add(new Object[]{"1I4M",   false, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});

        tests.add(new Object[]{"4M1I",   true, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});
        tests.add(new Object[]{"3M1I1M", true, EventType.BASE_INSERTION, new int[]{0,0,0,0,1}});
        tests.add(new Object[]{"2M1I2M", true, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
        tests.add(new Object[]{"1M1I3M", true, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
        tests.add(new Object[]{"1I4M",   true, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});

-- delivers #50445353
2013-05-31 13:58:37 -04:00
Ryan Poplin b5b9d745a7 New implementation of the GGA mode in the HaplotypeCaller
-- We now inject the given alleles into the reference haplotype and add them to the graph.
-- Those paths are read off of the graph and then evaluated with the appropriate marginalization for GGA mode.
-- This unifies how Smith-Waterman is performed between discovery and GGA modes.
-- Misc minor cleanup in several places.
2013-05-31 10:35:36 -04:00
Ryan Poplin 61af37d0d2 Create a new normalDistributionLog10 function that is unit tested for use in the VQSR. 2013-05-30 16:00:08 -04:00
Eric Banks a5a68c09fa Fix for the "Removed too many insertions, header is now negative" bug in ReduceReads.
The problem ultimately was that ReadUtils.readStartsWithInsertion() ignores leading hard/softclips, but
ReduceReads does not.  So I refactored that method to include a boolean argument as to whether or not
clips should be ignored.  Also rebased so that return type is no longer a Pair.
Added unit test to cover this situation.
2013-05-29 16:41:01 -04:00
Mauricio Carneiro f1affa9fbb Turn off downsampling for DiagnoseTargets
Diagnose targets should never be downsampled. (and I didn't know there was a default downsampling going on for locus walkers)
2013-05-28 14:58:50 -04:00
Ryan Poplin 85905dba92 Bugfix for GGA mode in UG silently ignoring indels
-- Started by Mark. Finished up by Ryan.
-- GGA mode still respected glm argument for SNP and INDEL models, so that you would silently fail to genotype indels at all if the -glm INDEL wasn't provided, but you'd still emit the sites, so you'd see records in the VCF but all alleles would be no calls.
-- https://www.pivotaltracker.com/story/show/48924339 for more information
-- [resolves #48924339]
2013-05-24 13:47:26 -04:00
Mauricio Carneiro da21924b44 Make the missing targets output never use stdout
Problem
--------
Diagnose Targets is outputting missing intervals to stdout if the argument -missing is not provided

Solution
--------
Make it NOT default to stdout

[Delivers #50386741]
2013-05-22 14:22:54 -04:00
Mark DePristo d167743852 Archived banded logless PairHMM
BandedHMM
---------
-- An implementation of a linear runtime, linear memory usage banded logless PairHMM.  Thought about 50% faster than current PairHMM, this implementation will be superceded by the GraphHMM when it becomes available.  The implementation is being archived for future reference

Useful infrastructure changes
-----------------------------
-- Split PairHMM into a N2MemoryPairHMM that allows smarter implementation to not allocate the double[][] matrices if they don't want, which was previously occurring in the base class PairHMM
-- Added functionality (controlled by private static boolean) to write out likelihood call information to a file from inside of LikelihoodCalculationEngine for using in unit or performance testing.  Added example of 100kb of data to private/testdata.  Can be easily read in with the PairHMMTestData class.
-- PairHMM now tracks the number of possible cell evaluations, and the LoglessCachingPairHMM updates the nCellsEvaluated so we can see how many cells are saved by the caching calculation.
2013-05-22 12:24:00 -04:00
Mark DePristo a1093ad230 Optimization for ActiveRegion.removeAll
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion.  This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element.   New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set.  Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
2013-05-21 16:18:57 -04:00
Eric Banks 1f3624d204 Base Recalibrator doesn't recalibrate all reads, so the final output line was confusing 2013-05-21 11:35:05 -04:00
Ryan Poplin 507853c583 Active region boundary parameters need to be bigger when running in GGA mode. CGL performance is quite a bit better as a result.
-- The troule stems from the fact that we may be trying to genotype indels even though it appears there are only SNPs in the reads.
2013-05-20 14:29:04 -04:00
sathibault 195f0c3e98 Disable CnyPairHMM 2013-05-17 08:30:23 -05:00
Yossi Farjoun 9234a0efcd Merge pull request #223 from broadinstitute/mc_dt_gaddy_outputs
Bug fixes and missing interval functionality for Diagnose Targets

While the code seems fine, the complex parts of it are untested. This is probably fine for now, but private code can have a tendency to creep into the codebase once accepted. I would have preferred that unit test OR a big comment stating that the code is untested (and thus broken by Mark's rule).

It is with these cavets that I accept the pull request.
2013-05-16 09:25:54 -07:00
Mauricio Carneiro 9eceae793a Tool to manipulate intervals outside the GATK
Performs basic set operations on intervals like union, intersect and difference between two or more intervals. Useful for techdev and QC purposes.
2013-05-13 11:56:24 -04:00
Mauricio Carneiro 3dbb86b052 Outputting missing intervals in DiagnoseTargets
Problem
------
Diagnose Targets identifies holes in the coverage of a targetted experiment, but it only reports them doesn't list the actual missing loci

Solution
------
This commit implements an optional intervals file output listing the exact loci that did not pass filters

Itemized changes
--------------
   * Cache callable statuses (to avoid recalculation)
   * Add functionality to output missing intervals
   * Implement new tool to qualify the missing intervals (QualifyMissingIntervals) by gc content, size, type of missing coverage and origin (coding sequence, intron, ...)
2013-05-13 11:51:56 -04:00
Mauricio Carneiro 1466396a31 Diagnose target is outputting intervals out of order
Problem
-------
When the interval had no reads, it was being sent to the VCF before the intervals that just got processed, therefore violating the sort order of the VCF.

Solution
--------
Use a linked hash map, and make the insertion and removal all happen in one place regardless of having reads or not. Since the input is ordered, the output has to be ordered as well.

Itemized changes
--------------
   * Clean up code duplication in LocusStratification and SampleStratification
   * Add number of uncovered sites and number of low covered sites to the VCF output.
   * Add new VCF format fields
   * Fix outputting multiple status when threshold is 0 (ratio must be GREATER THAN not equal to the threshold to get reported)

[fixes #48780333]
[fixes #48787311]
2013-05-13 11:50:22 -04:00
Mark DePristo b4f482a421 NanoScheduled ActiveRegionTraversal and HaplotypeCaller
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
  -- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
  -- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
2013-05-13 11:09:02 -04:00
Mark DePristo 111e8cef0f Merge pull request #219 from broadinstitute/eb_rr_multisample_fix
Fix bug in Reduce Reads that arises in multi-sample mode.
2013-05-09 15:31:14 -07:00
Eric Banks 8b9c6aae3e Fix bug in Reduce Reads that arises in multi-sample mode.
* bitset could legitimately be in an unfinished state but we were trying to access it without finalizing.
  * added --cancer_mode argument per Mark's suggestion to force the user to explicitly enable multi-sample mode.
  * tests were easiest to implement as integration tests (this was a really complicated case).
2013-05-08 23:23:51 -04:00
Mark DePristo fa8a47ceef Replace DeBruijnAssembler with ReadThreadingAssembler
Problem
-------
The DeBruijn assembler was too slow.  The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp).  This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.

Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers.  The algorithm operates as follows:

identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
  find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
  for each base in the sequence from the starting vertex kmer:
    look at the existing outgoing nodes of current vertex V.  If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
    If no matching next vertex exists, find a unique vertex with kmer K.  If one exists, merge the sequence into this vertex, and continue
    If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue

This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size.  This allows us to assemble well with even very short kmers.

This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:

-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples.  This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor.  This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization.  This change is essential for us to get good variants from our paths when the kmer size is small.  It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation.  Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary.  This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler

Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations.  This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate.  Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
2013-05-08 21:41:42 -04:00
sathibault d79b5f0931 Adding Convey HC-1 HMM acceleration 2013-05-08 11:01:20 -05:00
Eric Banks d242f1bba3 Secondary alignments were not handled correctly in IndelRealigner
* This is emerging now because BWA-MEM produces lots of reads that are not primary alignments
 * The ConstrainedMateFixingManager class used by IndelRealigner was mis-adjusting SAM flags because it
     was getting confused by these secondary alignments
 * Added unit test to cover this case
2013-05-06 19:09:10 -04:00
Eric Banks b53336c2d0 Added hidden mode for BQSR to force all read groups to be the same one.
* Very useful for debugging sample-specific issues
 * This argument got lost in the transition from BQSR v1 to v2
 * Added unit test to cover this case
2013-05-06 19:09:10 -04:00
Mark DePristo 2bcbdd469f leftAlignCigarSequentially now supports haplotypes with insertions and deletions where the deletion allele was previously removed by the leftAlignSingleIndel during it's cleanup phase. 2013-05-03 09:32:05 -04:00
Eric Banks 58424e56be Setting the reduce reads count tag was all wrong in a previous commit; fixing.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly.  Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.

The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly.  Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).

Also:
1. counts are now maintained as ints whenever possible.  Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
2013-04-30 13:45:42 -04:00
Guillermo del Angel 20d3137928 Fix for indel calling with UG in presence of reduced reads: When a read is long enough so that there's no reference context available, the reads gets clipped so that it falls again within the reference context range. However, the clipping is incorrect, as it makes the read end precisely at the end of the reference context coordinates. This might lead to a case where a read might span beyond the haplotype if one of the candidate haplotypes is shorter than the reference context (As in the case e.g. with deletions). In this case, the HMM will not work properly and the likelihood will be bad, since "insertions" at end of reads when haplotype is done will be penalized and likelihood will be much lower than it should.
-- Added check to see if read spans beyond reference window MINUS padding and event length. This guarantees that read will always be contained in haplotype.
-- Changed md5's that happen when long reads from old 454 data have their likelihoods changed because of the extra base clipping.
2013-04-29 19:33:02 -04:00
Mark DePristo 5dd73ba2d1 Merge pull request #198 from broadinstitute/mc_reduce_reads_ds_doc
Updates GATKDocs for ReduceReads downsampling
2013-04-27 05:49:47 -07:00
Mauricio Carneiro 76e997895e Updates GATKDocs for ReduceReads downsampling
[fixes #48258295]
2013-04-26 23:33:44 -04:00
Guillermo del Angel 4168aaf280 Add feature to specify Allele frequency priors by command line when calling variants.
Use case:
The default AF priors used (infinite sites model, neutral variation) is appropriate in the case where the reference allele is ancestral, and the called allele is a derived allele.
Most of the times this is true but in several population studies and in ancient DNA analyses this might introduce reference biases, and in some other cases it's hard to ascertain what the ancestral allele is (normally requiring to look up homologous chimp sequence).
Specifying no prior is one solution, but this may introduce a lot of artifactual het calls in shallower coverage regions.
With this option, users can specify what the prior for each AC should be according to their needs, subject to the restrictions documented in the code and in GATK docs.
-- Updated ancient DNA single sample calling script with filtering options and other cleanups.
-- Added integration test. Removed old -noPrior syntax.
2013-04-26 19:06:39 -04:00
Eric Banks 021adf4220 WTF - I thought we had disabled the randomized dithering of rank sum tests for integration tests?!
Well, it wasn't done so I went ahead and did so.  Lots of MD5 changes accordingly.
2013-04-26 11:24:05 -04:00
Eric Banks ba2c3b57ed Extended the allele-biased down-sampling functionality to handle reduced reads.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.

Added lots of unit tests for new functionality.
2013-04-26 11:23:17 -04:00
Eric Banks 379a9841ce Various bug fixes for recent Reduce Reads additions plus solution implemented for low MQ reads.
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions.  Then we get the
best of both worlds.  As a note, coverage refers to just the individual base counts and not the entire pileup.

2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.

3. Each consensus keeps track of its own number of softclipped bases.  There was no reason that that number
should be shared between them.

4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now.  Don't lose that
information.  Maybe we'll decide to change this in the future, but for now we are conservative.

5. Also implemented various small performance optimizations based on profiling.

Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
2013-04-24 18:18:50 -04:00
MauricioCarneiro 45fec382e7 Merge pull request #180 from broadinstitute/mc_diagnosetargets_missing_targets
DiagnoseTargets Global Refactor
2013-04-24 14:54:55 -07:00
Mauricio Carneiro 367f0c0ac1 Split class names into stratification and metrics
Calling everything statistics was very confusing. Diagnose Targets stratifies the data three ways: Interval, Sample and Locus. Each stratification then has it's own set of metrics (plugin system) to calculate -- LocusMetric, SampleMetric, IntervalMetric.

 Metrics are generalized by the Metric interface. (for generic access)
 Stratifications are generalized by the AbstractStratification abstract class. (to aggressively limit code duplication)
2013-04-24 14:15:49 -04:00
Ryan Poplin 80131ac996 Adding the 1000G_phase1.snps.high_confidence callset to the GATK resource bundle for use in the April 2013 updated best practices. 2013-04-24 11:41:32 -04:00
Guillermo del Angel 2ab270cf3f Corner case fix to General Ploidy SNP likelihood model.
-- In case there are no informative bases in a pileup but pileup isn't empty (like when all bases have Q < min base quality) the GLs were still computed (but were all zeros) and fed to the exact model. Now, mimic case of diploid Gl computation where GLs are only added if # good bases > 0
-- I believe general case where only non-informative GLs are fed into AF calc model is broken and yields bogus QUAL, will investigate separately.
2013-04-23 21:13:18 -04:00
Mauricio Carneiro 8f8f339e4b Abstract class for the statistics
Addressing the code duplication issue raised by Mark.
2013-04-23 18:02:27 -04:00
Mauricio Carneiro 38662f1d47 Limiting access to the DT classes
* Make most classes final, others package local
    * Move to diagnostics.diagnosetargets package
    * Aggregate statistics and walker classes on the same package for simplified visibility.
    * Make status list a LinkedList instead of a HashSet
2013-04-23 14:01:43 -04:00
Ryan Poplin cb4ec3437a After debate reverting SW parameter changes temporarily while we explore global SW plans. 2013-04-23 13:32:06 -04:00
Mauricio Carneiro fdd16dc6f9 DiagnoseTargets refactor
A plugin enabled implementation of DiagnoseTargets

Summarized Changes:
-------------------
   * move argument collection into Thresholder object
   * make thresholder object private member of all statistics classes
   * rework the logic of the mate pairing thresholds
   * update unit and integration tests to reflect the new behavior
   * Implements Locus Statistic plugins
   * Extend Locus Statistic plugins to determine sample status
   * Export all common plugin functionality into utility class
   * Update tests accordingly

[fixes #48465557]
2013-04-22 23:53:10 -04:00
Mauricio Carneiro eb6308a0e4 General DiagnoseTargets documentation cleanup
* remove interval statistic low_median_coverage -- it is already captured by low coverage and coverage gaps.
   * add gatkdocs to all the parameters
   * clean up the logic on callable status a bit (still need to be re-worked into a plugin system)
   * update integration tests
2013-04-22 23:53:09 -04:00
Mauricio Carneiro b3c0abd9e8 Remove REF_N status from DiagnoseTargets
This is not really feasible with the current mandate of this walker. We would have to traverse by reference and that would make the runtime much higher, and we are not really interested in the status 99% of the time anyway. There are other walkers that can report this, and just this, status more cheaply.

[fixes #48442663]
2013-04-22 23:53:09 -04:00
Mauricio Carneiro 2b923f1568 fix for DiagnoseTargets multiple filter output
Problem
-------
Diagnose targets is outputting both LOW_MEDIAN_COVERAGE and NO_READS when no reads are covering the interval

Solution
--------
Only allow low median coverage check if there are reads

[fixes #48442675]
2013-04-22 23:53:09 -04:00
Mauricio Carneiro cf7afc1ad4 Fixed "skipped intervals" bug on DiagnoseTargets
Problem
-------
Diagnose targets was skipping intervals when they were not covered by any reads.

Solution
--------
Rework the interval iteration logic to output all intervals as they're skipped over by the traversal, as well as adding a loop on traversal done to finish outputting intervals past the coverage of teh BAM file.

Summarized Changes
------------------
   * Outputs all intervals it iterates over, even if uncovered
   * Outputs leftover intervals in the end of the traversal
   * Updated integration tests

[fixes #47813825]
2013-04-22 23:53:09 -04:00
Mark DePristo be66049a6f Bugfix for CommonSuffixSplitter
-- The problem is that the common suffix splitter could eliminate the reference source vertex when there's an incoming node that contains all of the reference source vertex bases and then some additional prefix bases.  In this case we'd eliminate the reference source vertex.  Fixed by checking for this condition and aborting the simplification
-- Update MD5s, including minor improvements
2013-04-21 19:37:01 -04:00
Mark DePristo f0e64850da Two sensitivity / specificity improvements to the haplotype caller
-- Reduce the min read length to 10 bp in the filterNonPassingReads in the HC.  Now that we filter out reads before genotyping, we have to be more tolerant of shorter, but informative, reads, in order to avoid a few FNs in shallow read data
-- Reduce the min usable base qual to 8 by default in the HC.  In regions with low coverage we sometimes throw out our only informative kmers because we required a contiguous run of bases with >= 16 QUAL.  This is a bit too aggressive of a requirement, so I lowered it to 8.
-- Together with the previous commit this results in a significant improvement in the sensitivity and specificity of the caller

 NA12878 MEM chr20:10-11
 Name    VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
 branch  SNPS                  1216               0               2            194                        0
 branch  INDELS                 312               2              13             71                        7
 master  SNPS                  1214               0               4            194                        1
 master  INDELS                 309               2              16             71                       10

-- Update MD5s in the integration tests to reflect these two new changes
2013-04-17 12:32:31 -04:00
Eric Banks 5bce0e086e Refactored binomial probability code in MathUtils.
* Moved redundant code out of UGEngine
  * Added overloaded methods that assume p=0.5 for speed efficiency
  * Added unit test for the binomialCumulativeProbability method
2013-04-16 18:19:07 -04:00
Eric Banks df189293ce Improve compression in Reduce Reads by incorporating probabilistic model and global het compression
The Problem:
  Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
  regions in an exome) causes RR (with default settings) to consider it a variant region.  This
  seriously hurts compression performance.

The Solution:
  1. We now use a probabilistic model for determining whether we can create a consensus (in other
  words, whether we can error correct a site) instead of the old ratio threshold.  We calculate
  the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
  that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
  2. We also allow het compression globally, not just at known sites.  So if we cannot create a
  consensus at a given site then we try to perform het compression; and if we cannot perform het
  compression that we just don't reduce the variant region.  This way very wonky regions stay
  uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
  locus get het compressed.

Details:
  1. -minvar is now deprecated in favor of -min_pvalue.
  2. Added integration test for bad pvalue input.
  3. -known argument still works to force het compression only at known sites; if it's not included
     then we allow het compression anywhere.  Added unit tests for this.
  4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
     Before finalizing het compression, we now check for insertions or other variant regions (usually due
     to multi-allelics) which can render a region incompressible (and we back out if we find one).  We
     were checking for excessive softclips before, but now we add these tests too.
  5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
     consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
     out instead of backing out all of them.
  6. We no longer create a mini read at the stop of the variant window for het compression.  Instead, we
     allow it to be part of the next global consensus.
  7. The coverage test is no longer run systematically on all integration tests because the quals test
     supercedes it.  The systematic quals test is now much stricter in order to catch bugs and edge cases
     (very useful!).
  8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
     for a consensus was affected by good and bad bases/reads).
  9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
     This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
  10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
     with insertions from a header.

Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
2013-04-16 18:19:06 -04:00
Ryan Poplin e0dfe5ca14 Restore the read filter function in the HaplotypeCaller. 2013-04-16 12:01:30 -04:00
Geraldine Van der Auwera e176fc3af1 Merge pull request #159 from broadinstitute/md_bqsr_ion
Trivial BQSR bug fixes and improvement
2013-04-16 08:54:47 -07:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Mark DePristo 5a74a3190c Improvements to the VariantRecalibrator R plots
-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
2013-04-16 09:09:51 -04:00
Mark DePristo 564fe36d22 VariantRecalibrator's VQSR.vcf now contains NEG/POS labels
-- It's useful to know which sites have been used in the training of the model.  The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
2013-04-16 09:09:47 -04:00
Mauricio Carneiro 9bfa5eb70f Quick optimization to the PairHMM
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.

Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
2013-04-14 23:25:33 -04:00
Mark DePristo 3144eae51c UnifiedGenotyper bugfix: don't create haplotypes with 0 bases
-- The PairHMM no longer allows us to create haplotypes with 0 bases.  The UG indel caller used to create such haplotypes.  Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes #47523579]
2013-04-13 14:57:55 -04:00
Mark DePristo 0e627bce93 Slight update to Path SW parameters.
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
2013-04-12 12:43:52 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00
Ryan Poplin a507381a33 Updating BQSR RecalibrationEngine to work correctly with empty BQSR tables.
-- Previously would crash when a scatter/gather interval contained no usable data.
-- Added unit test to cover this case.
2013-04-11 16:27:59 -04:00
Mark DePristo fb86887bf2 Fast algorithm for determining which kmers are good in a read
-- old algorithm was O(kmerSize * readLen) for each read.  New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph.  Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
2013-04-11 09:54:22 -04:00
Mark DePristo bf42be44fc Fast DeBruijnGraph creation using the kmer counter
-- The previous creation algorithm used the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to the graph
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
  update edge count by 1 if kmer1 -> kmer2 already existed in the graph

-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)).  This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap

for each kmer pair 1 and 2 in the hash counter
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
  update edge count by count from map if kmer1 -> kmer2 already existed in the graph

-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
2013-04-10 17:10:59 -04:00
Mark DePristo b115e5c582 Critical bugfix for CommonSuffixSplitter to avoid infinite loops
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:

X -> A -> B
Y -> A -> B

So that the incoming vertices of B all have the same sequence.  This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph.  Fixed and unit tested

-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging.  So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph.  Equals here means that all vertices have equivalents in both graphs, as do all edges.  If the two graphs are equal we stop simplifying.  It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
2013-04-09 16:19:26 -04:00
Mark DePristo 51954ae3e5 HaplotypeCaller doesn't support EXACT_GENERAL_PLOIDY model
-- HC now throws a UserException if this model is provided.  Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
2013-04-09 15:18:42 -04:00
Mark DePristo 33ecec535d Turn off the LD merging code by default
-- It's just too hard to interpret the called variation when we merge variants via LD.
-- Can now be turned on with -mergeVariantsViaLD
-- Update MD5s
2013-04-09 10:08:06 -04:00
Mark DePristo 21410690a2 Address reviewer comments 2013-04-08 12:48:20 -04:00
Mark DePristo 6d22485a4c Critical bugfix to ReduceRead functionality of the GATKSAMRecord
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5].  The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding.  Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i.  Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
2013-04-08 12:47:50 -04:00
Mark DePristo 5a54a4155a Change key Haplotype default parameter values
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
2013-04-08 12:47:50 -04:00
Mark DePristo 3a19266843 Fix residual merge conflicts 2013-04-08 12:47:50 -04:00
Mark DePristo 9c7a35f73f HaplotypeCaller no longer creates haplotypes that involve cycles in the SeqGraph
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models.  Allowing cycles can be re-enabled with an HC command line switch.
2013-04-08 12:47:50 -04:00
Mark DePristo 5545c629f5 Rename Utils to GraphUtils to avoid conflicts with the sting.Utils class; fix broken unit test in SharedVertexSequenceSplitterUnitTest 2013-04-08 12:47:49 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo 9b5c55a84a LikelihoodCalculationEngine will now only use reads longer than the minReadLength, which is currently fixed at 20 bp 2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 4d389a8234 Optimizations for HC infrastructure
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
2013-04-08 12:47:49 -04:00
Mark DePristo e916998784 Bugfix for head and tail merging code in SeqGraph
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so.  This would introduce large deletion events at the start / end of the assemblies.  Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
2013-04-08 12:47:48 -04:00
Mark DePristo 2aac9e2782 More efficient ZipLinearChains algorithm
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go.  Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains.  The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 67cd407854 The GenotypingEngine now uses the samples from the mapping of Samples -> PerReadAllele likelihoods instead of passing around a redundant list of samples 2013-04-08 12:47:47 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
Mark DePristo bb42c90f2b Use LinkedHashSets in incoming and outgoing vertex functions in BaseGraph
-- Using a LinkedHashSet changed the md5 for HCTestComplexVariants.
2013-04-02 17:58:20 -04:00
David Roazen b4b58a3968 Fix unprintable character in a comment from the BaseEdge class
Compiler warnings about this were starting to get to me...
2013-04-02 14:24:23 -04:00
Mark DePristo c191d7de8c Critical bugfix for CommonSuffixSplitter
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm.  Created unit test that reproduced the issue, and then fixed the underlying issue.
2013-04-02 09:22:33 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Ryan Poplin f65206e758 Two changes to HC GGA mode to make it more like the UG.
-- Only try to genotype PASSing records in the alleles file
-- Don't attempt to genotype multiple records with the same start location. Instead take the first record and throw a warning message.
2013-04-01 10:20:23 -04:00
Mark DePristo 7c83efc1b9 Merge pull request #135 from broadinstitute/mc_pgtag_fix
Fixing @PG tag uniqueness issue
2013-03-31 11:36:40 -07:00
Eric Banks 8e2094d2af Updated AssessReducedQuals and applied it systematically to all ReduceReads integration tests.
* Moved to protected for packaging purposes.
  * Cleaned up and removed debugging output.
  * Fixed logic for epsilons so that we really only test significant differences between BAMs.
  * Other small fixes (e.g. don't include low quality reduced reads in overall qual).
  * Most RR integration tests now automatically run the quals test on output.
    * A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
2013-03-31 00:27:14 -04:00
Mauricio Carneiro ec475a46b1 Fixing @PG tag uniqueness issue
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".

How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.

Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter

Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31

Issue Tracker:
--------------
[fixes 47100885]
2013-03-30 20:31:33 -04:00
Mauricio Carneiro 68bf470524 making LoglessPairHMM final 2013-03-30 20:00:45 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
MauricioCarneiro a2b69790a6 Merge pull request #128 from broadinstitute/eb_rr_polyploid_compression_GSA-639 2013-03-28 06:39:43 -07:00
Mark DePristo 197d149495 Increase the maxNumHaplotypesInPopulation to 25
-- A somewhat arbitrary increase, and will need some evaluation but necessary to get good results on the AFR integrationtest.
2013-03-27 15:31:24 -04:00
Mark DePristo 66910b036c Added new and improved suffix and node merging algorithms
-- These new algorithms are more powerful than the restricted diamond merging algoriths, in that they can merge nodes with multiple incoming and outgoing edges.  Together the splitter + merger algorithms will correctly merge many more cases than the original headless and tailless diamond merger.
-- Refactored haplotype caller infrastructure into graphs package, code cleanup
-- Cleanup new merging / splitting algorithms, with proper docs and unit tests
-- Fix bug in zipping of linear chains.  Because the multiplicity can be 0, protect ourselves with a max function call
-- Fix BaseEdge.max unit test
-- Add docs and some more unit tests
-- Move error correct from DeBruijnGraph to DeBruijnAssembler
-- Replaced uses of System.out.println with logger.info
-- Don't make multiplicity == 0 nodes look like they should be pruned
-- Fix toString of Path
2013-03-27 15:31:18 -04:00
Mark DePristo 39f2e811e5 Increase max cigar elements from SW before failing path creation to 20 from 6
-- This allows more diversity in paths, which is sometimes necessary when we cannot simply graphs that have large bubbles
2013-03-26 14:27:18 -04:00
Mark DePristo b1b615b668 BaseGraph shouldn't implement getEdge -- no idea why I added this 2013-03-26 14:27:18 -04:00
Mark DePristo a97576384d Fix bug in the HC not respecting the requested pruning 2013-03-26 14:27:18 -04:00
Mark DePristo 78c672676b Bugfix for pruning and removing non-reference edges in graph
-- Previous algorithms were applying pruneGraph inappropriately on the raw sequence graph (where each vertex is a single base).  This results in overpruning of the graph, as prunegraph really relied on the zipping of linear chains (and the sharing of weight this provides) to avoid over-pruning the graph.  Probably we should think hard about this.  This commit fixes this logic, so we zip the graph between pruning
-- In this process ID's a fundamental problem with how we were trimming away vertices that occur on a path from the reference source to sink.  In fact, we were leaving in any vertex that happened to be accessible from source, any vertices in cycles, and any vertex that wasn't the absolute end of a chain going to a sink.  The new algorithm fixes all of this, using a BaseGraphIterator that's a general approach to walking the base graph.  Other routines that use the same traversal idiom refactored to use this iterator.  Added unit tests for all of these capabilities.
-- Created new BaseGraphIterator, which abstracts common access patterns to graph, and use this where appropriate
2013-03-26 14:27:18 -04:00
Mark DePristo ad04fdb233 PerReadAlleleLikelihoodMap getMostLikelyAllele returns an MostLikelyAllele objects now
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users.  The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not.  That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves.  There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second.  For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads.   All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event.  In this case our annotations will all fall apart, returning their default values.  Added a JIRA to address this (should be discussed in group meeting)
2013-03-26 14:27:13 -04:00
Mark DePristo 2472828e1c HC bug fixes: no longer create reference graphs with cycles
-- Though not intended, it was possible to create reference graphs with cycles in the case where you started the graph with a homopolymer of length > the kmer.  The previous test would fail to catch this case.  Now its not possible
-- Lots of code cleanup and refactoring in this push.  Split the monolithic createGraphFromSequences into simple calls to addReferenceKmersToGraph and addReadKmersToGraph which themselves share lower level functions like addKmerPairFromSeqToGraph.
-- Fix performance problem with reduced reads and the HC, where we were calling add kmer pair for each count in the reduced read, instead of just calling it once with a multiplicity of count.
-- Refactor addKmersToGraph() to use things like addOrUpdateEdge, now the code is very clear
2013-03-26 10:12:24 -04:00
Mark DePristo 1917d55dc2 Bugfix for DeBruijnAssembler: don't fail when read length > haplotype length
-- The previous version would generate graphs that had no reference bases at all in the situation where the reference haplotype was < the longer read length, which would cause the kmer size to exceed the reference haplotype length.  Now return immediately with a null graph when this occurs as opposed to continuing and eventually causing an error
2013-03-26 10:12:17 -04:00
Mark DePristo 464e65ea96 Disable error correcting kmers by default in the HC
-- The error correction algorithm can break the reference graph in some cases by error correcting us into a bad state for the reference sequence.  Because we know that the error correction algorithm isn't ideal, and worse, doesn't actually seem to improve the calling itself on chr20, I've simply disabled error correction by default and allowed it to be turned on with a hidden argument.
-- In the process I've changed a bit the assembly interface, moving some common arguments us into the LocalAssemblyEngine, which are turned on/off via setter methods.
-- Went through the updated arguments in the HC to be @Hidden and @Advanced as appropriate
-- Don't write out an errorcorrected graph when debugging and error correction isn't enabled
2013-03-26 10:05:17 -04:00
Eric Banks 593d3469d4 Refactored the het (polyploid) consensus creation in ReduceReads.
* It is now cleaner and easier to test; added tests for newly implemented methods.
 * Many fixes to the logic to make it work
   * The most important change was that after triggering het compression we actually need to back it out if it
      creates reads that incorporated too many softclips at any one position (because they get unclipped).
   * There was also an off-by-one error in the general code that only manifested itself with het compression.
 * Removed support for creating a het consensus around deletions (which was broken anyways).
   * Mauricio gave his blessing for this.
 * Het compression now works only against known sites (with -known argument).
    * The user can pass in one or more VCFs with known SNPs (other variants are ignored).
    * If no known SNPs are provided het compression will automatically be disabled.
 * Added SAM tag to stranded (i.e. het compressed) reduced reads to distinguish their
   strandedness from normal reduced reads.
    * GATKSAMRecord now checks for this tag when determining whether or not the read is stranded.
    * This allows us to update the FisherStrand annotation to count het compressed reduced reads
       towards the FS calculation.
    * [It would have been nice to mark the normal reads as unstranded but then we wouldn't be
       backwards compatible.]
    * Updated integration tests accordingly with new het compressed bams (both for RR and UG).
 * In the process of fixing the FS annotation I noticed that SpanningDeletions wasn't handling
   RR properly, so I fixed it too.
    * Also, the test in the UG engine for determining whether there are too many overlapping
       deletions is updated to handle RR.
 * I added a special hook in the RR integration tests to additionally run the systematic
   coverage checking tool I wrote earlier.
    * AssessReducedCoverage is now run against all RR integration tests to ensure coverage is
       not lost from original to reduced bam.
    * This helped uncover a huge bug in the MultiSampleCompressor where it would drop reads
       from all but 1 sample (now fixed).
    * AssessReducedCoverage moved from private to protected for packaging reasons.
 * #resolve GSA-639

At this point, this commit encompasses most of what is needed for het compression to go live.
There are still a few TODO items that I want to get in before the 2.5 release, but I will save
those for a separate branch because as it is I feel bad for the person who needs to review all
these changes (sorry, Mauricio).
2013-03-25 09:34:54 -04:00
Mark DePristo 965043472a Vastly more powerful, cleaner graph simplification approach
-- Generalizes previous node merging and splitting approaches.  Can split common prefixes and suffices among nodes, build a subgraph representing this new structure, and incorporate it into the original graph.  Introduces the concept of edges with 0 multiplicity (for purely structural reasons) as well as vertices with no sequence (again, for structural reasons).  Fully UnitTested.  These new algorithms can now really simplify diamond configurations as well as ones sources and sinks that arrive / depart linearly at a common single root node.
-- This new suite of algorithms is fully integrated into the HC, replacing previous approaches
-- SeqGraph transformations are applied iteratively (zipping, splitting, merging) until no operations can be performed on the graph.  This further simplifies the graphs, as splitting nodes may enable other merging / zip operations to go.
2013-03-23 17:40:55 -04:00
Ryan Poplin c15453542e Merge pull request #124 from broadinstitute/md_hc_lowmapq_read_filter
HC now by default only uses reads with MAPQ >= 20 for assembly and calli...
2013-03-21 12:00:28 -07:00
Mark DePristo 7ae15dadbe HC now by default only uses reads with MAPQ >= 20 for assembly and calling
-- Previously we tried to include lots of these low mapping quality reads in the assembly and calling, but we effectively were just filtering them out anyway while generating an enormous amount of computational expense to handle them, as well as much larger memory requirements.  The new version simply uses a read filter to remove them upfront.  This causes no major problems -- at least, none that don't have other underlying causes -- compared to 10-11mb of the KB
-- Update MD5s to reflect changes due to no longer including mmq < 20 by default
2013-03-21 13:10:50 -04:00
Ryan Poplin b9c331c2fa Bug fix in HC gga mode.
-- Don't try to test alleles which haven't had haplotypes assigned to them
2013-03-21 11:02:41 -04:00
Mark DePristo aa7f172b18 Cap the computational cost of the kmer based error correction in the DeBruijnGraph
-- Simply don't do more than MAX_CORRECTION_OPS_TO_ALLOW = 5000 * 1000 operations to correct a graph.  If the number of ops would exceed this threshold, the original graph is used.
-- Overall the algorithm is just extremely computational expensive, and actually doesn't implement the correct correction.  So we live with this limitations while we continue to explore better algorithms
-- Updating MD5s to reflect changes in assembly algorithms
2013-03-21 09:21:35 -04:00
Mark DePristo d94b3f85bc Increase NUM_BEST_PATHS_PER_KMER_GRAPH in DeBruijnAssembler to 25
-- The value of 11 was too small to properly return a real low-frequency variant in our the 1000G AFR integration test.
2013-03-20 22:54:38 -04:00
Mark DePristo 6d7d21ca47 Bugfix for incorrect branch diamond merging algorithm
-- Previous version was just incorrectly accumulating information about nodes that were completely eliminated by the common suffix, so we were dropping some reference connections between vertices.  Fixed.  In the process simplified the entire algorithm and codebase
-- Resolves https://jira.broadinstitute.org/browse/GSA-884
2013-03-20 22:54:37 -04:00
Mark DePristo 3a8f001c27 Misc. fixes upon pull request review
-- DeBruijnAssemblerUnitTest and AlignmentUtilsUnitTest were both in DEBUG = true mode (bad!)
-- Remove the maxHaplotypesToConsider feature of HC as it's not useful
2013-03-20 22:54:37 -04:00
Mark DePristo d3b756bdc7 BaseVertex optimization: don't clone byte[] unnecessarily
-- Don't clone sequence upon construction or in getSequence(), as these are frequently called, memory allocating routines and cloning will be prohibitively expensive
2013-03-20 22:54:37 -04:00
Mark DePristo 5226b24a11 HaplotypeCaller instructure cleanup and unit testing
-- UnitTest for isRootOfDiamond along with key bugfix detected while testing
-- Fix up the equals methods in BaseEdge.  Now called hasSameSourceAndTarget and seqEquals.  A much more meaningful naming
-- Generalize graphEquals to use seqEquals, so it works equally well with Debruijn and SeqGraphs
-- Add BaseVertex method called seqEquals that returns true if two BaseVertex objects have the same sequence
-- Reorganize SeqGraph mergeNodes into a single master function that does zipping, branch merging, and zipping again, rather than having this done in the DeBruijnAssembler itself
-- Massive expansion of the SeqGraph unit tests.  We now really test out the zipping and branch merging code.
-- Near final cleanup of the current codebase
-- DeBruijnVertex cleanup and optimizations.  Since kmer graphs don't allow sequences longer than the kmer size, the suffix is always a byte, not a byte[].  Optimize the code to make use of this constraint
2013-03-20 22:54:37 -04:00
Mark DePristo 1fa5050faf Cleanup, unit test, and optimize KBestPaths and Path
-- Split Path from inner class of KBestPaths
-- Use google MinMaxPriorityQueue to track best k paths, a more efficient implementation
-- Path now properly typed throughout the code
-- Path maintains a on-demand hashset of BaseEdges so that path.containsEdge is fast
2013-03-20 22:54:36 -04:00
Mark DePristo 98c4cd060d HaplotypeCaller now uses SeqGraph instead of kmer graph to build haplotypes.
-- DeBruijnAssembler functions are no longer static.  This isn't the right way to unit test your code
-- An a HaplotypeCaller command line option to use low-quality bases in the assembly
-- Refactored DeBruijnGraph and associated libraries into base class
-- Refactored out BaseEdge, BaseGraph, and BaseVertex from DeBruijn equivalents.  These DeBruijn versions now inherit from these base classes.  Added some reasonable unit tests for the base and Debruijn edges and vertex classes.
-- SeqVertex: allows multiple vertices in the sequence graph to have the same sequence and yet be distinct
-- Further refactoring of DeBruijnAssembler in preparation for the full SeqGraph <-> DeBruijnGraph split
-- Moved generic methods in DeBruijnAssembler into BaseGraph
-- Created a simple SeqGraph that contains SeqVertex objects
-- Simple chain zipper for SeqGraph that reproduces the results for the mergeNode function on DeBruijnGraphs
-- A working version of the diamond remodeling algorithm in SeqGraph that converts graphs that look like A -> Xa, A -> Ya, Xa -> Z, Ya -> Z into A -> X -> a, A -Y -> a, a -> Z
-- Allow SeqGraph zip merging of vertices where the in vertex has multiple incoming edges or the out vertex has multiple outgoing edges
-- Fix all unit tests so they work with the new SeqGraph system.  All tests passed without modification.
-- Debugging makes it easier to tell which kmer graph contributes to a haplotype
-- Better docs and unit tests for BaseVertex, SeqVertex, BaseEdge, and KMerErrorCorrector
-- Remove unnecessary printing of cleaning info in BaseGraph
-- Turn off kmer graph creation in DeBruijnAssembler.java
-- Only print SeqGraphs when debugGraphTransformations is set to true
-- Rename DeBruijnGraphUnitTest to SeqGraphUnitTest.  Now builds DeBruijnGraph, converts to SeqGraph, uses SeqGraph.mergenodes and tests for equality.
-- Update KBestPathsUnitTest to use SeqGraphs not DebruijnGraphs
-- DebruijnVertex now longer takes kmer argument -- it's implicit that the kmer length is the sequence.length now
2013-03-20 22:54:36 -04:00
Mark DePristo 0f4328f6fe Basic kmer error correction algorithm xfor the HaplotypeCaller
-- Error correction algorithm for the assembler.  Only error correct reads to others that are exactly 1 mismatch away
-- The assembler logic is now: build initial graph, error correct*, merge nodes*, prune dead nodes, merge again, make haplotypes.  The * elements are new
-- Refactored the printing routines a bit so it's easy to write a single graph to disk for testing.
-- Easier way to control the testing of the graph assembly algorithms
-- Move graph printing function to DeBruijnAssemblyGraph from DeBruijnAssembler
-- Simple protected parsing function for making DeBruijnAssemblyGraph
-- Change the default prune factor for the graph to 1, from 2
-- debugging graph transformations are controllable from command line
2013-03-20 22:54:36 -04:00
Mark DePristo 53a904bcbd Bugfix for HaplotypeCaller: GSA-822 for trimming softclipped reads
-- Previous version would not trim down soft clip bases that extend beyond the active region, causing the assembly graph to go haywire.  The new code explicitly reverts soft clips to M bases with the ever useful ReadClipper, and then trims.  Note this isn't a 100% fix for the issue, as it's possible that the newly unclipped bases might in reality extend beyond the active region, should their true alignment include a deletion in the reference.  Needs to be fixed.  JIRA added

-- See https://jira.broadinstitute.org/browse/GSA-822
-- #resolve #fix GSA-822
2013-03-20 22:54:36 -04:00
Mark DePristo ffea6dd95f HaplotypeCaller now has the ability to only consider the best N haplotypes for genotyping
-- Added a -dontGenotype mode for testing assembly efficiency
-- However, it looks like this has a very negative impact on the quality of the results, so the code should be deleted
2013-03-20 22:54:36 -04:00
Mark DePristo a783f19ab1 Fix for potential HaplotypeCaller bug in annotation ordering
-- Annotations were being called on VariantContext that might needed to be trimmed.  Simply inverted the order of operations so trimming occurs before the annotations are added.
-- Minor cleanup of call to PairHMM in LikelihoodCalculationEngine
2013-03-20 22:54:35 -04:00
Eric Banks 1fae750ebe Merge pull request #120 from broadinstitute/aw_reduce_reads_clear_name_cache
Clear ReduceReads name cache after each set of reads produced by ReduceR...
2013-03-20 19:47:42 -07:00