Problem:
-Downsamplers were treating reduced reads the same as normal reads,
with occasionally catastrophic results on variant calling when an
entire reduced read happened to get eliminated.
Solution:
-Since reduced reads lack the information we need to do position-based
downsampling on them, best available option for now is to simply
exempt all reduced reads from elimination during downsampling.
Details:
-Add generic capability of exempting items from elimination to
the Downsampler interface via new doNotDiscardItem() method.
Default inherited version of this method exempts all reduced reads
(or objects encapsulating reduced reads) from elimination.
-Switch from interfaces to abstract classes to facilitate this change,
and do some minor refactoring of the Downsampler interface (push
implementation of some methods into the abstract classes, improve
names of the confusing clear() and reset() methods).
-Rewrite TAROrderedReadCache. This class was incorrectly relying
on the ReservoirDownsampler to preserve the relative ordering of
items in some circumstances, which was behavior not guaranteed by
the API and only happened to work due to implementation details
which no longer apply. Restructured this class around the assumption
that the ReservoirDownsampler will not preserve relative ordering
at all.
-Add disclaimer to description of -dcov argument explaining that
coverage targets are approximate goals that will not always be
precisely met.
-Unit tests for all individual downsamplers to verify that reduced
reads are exempted from elimination
We now run Smith-Waterman on the dangling tail against the corresponding reference tail.
If we can generate a reasonable, low entropy alignment then we trigger the merge to the
reference path; otherwise we abort. Also, we put in a check for low-complexity of graphs
and don't let those pass through.
Added tests for this implementation that checks exact SW results and correct edges added.
-- Reuse infrastructure for RODs for reads to implement general IntervalReferenceOrderedView so that both TraverseReads and TraverseActiveRegions can use the same underlying infrastructure
-- TraverseActiveRegions now provides a meaningful RefMetaDataTracker to ActiveRegionWalker.map
-- Cleanup misc. code as it came up
-- Resolves GSA-808: Write general utility code to do rsID allele matching, hook up to UG and HC
The previous behavior is to process reads with N CIGAR operators as they are despite that many of the tools do not actually support such operator and results become unpredictible.
Now if the there is some read with the N operator, the engine returns a user exception. The error message indicates what is the problem (including the offending read and mapping position) and give a couple of alternatives that the user can take in order to move forward:
a) ask for those reads to be filtered out (with --filter_reads_with_N_cigar or -filterRNC)
b) keep them in as before (with -U ALLOW_N_CIGAR_READS or -U ALL)
Notice that (b) does not have any effect if (a) is enacted; i.e. filtering overrides ignoring.
Implementation:
* Added filterReadsWithMCigar argument to MalformedReadFilter with the corresponding changes in the code to get it to work.
* Added ALLOW_N_CIGAR_READS unsafe flag so that N cigar containing reads can be processed as they are if that is what the user wants.
* Added ReadFilterTest class commont parent for ReadFilter test cases.
* Refactor ReadGroupBlackListFilterUnitTest to extend ReadFilterTest and push up some functionality to that class.
* Modified MalformedReadFilterUnitTest to extend ReadFilterTest and to test the new filter functionality.
* Added AllowNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALLOW_N_CIGAR_READS flag is used.
* Added UnsafeNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALL flag is used.
* Updated a broken test case in UnifiedGenotyperIntegrationTest resulting from the new behavior.
* Updated EngineFeaturesIntegrationTest testdata to be compliant with new behavior
- Memoized MathUtil's cumulative binomial probability function.
- Reduced the default size of the read name map in reduced reads and handle its resets more efficiently.
-- This occurred because we were reverting reads with soft clips that would produce reads with negative (or 0) alignment starts. From such reads we could end up with adaptor starts that were negative and that would ultimately produce the "Only one of refStart or refStop must be < 0, not both" error in the FragmentUtils merging code (which would revert and adaptor clip reads).
-- We now hard clip away bases soft clipped reverted bases that fall before the 1-based contig start in revertSoftClippedBases.
-- Replace buggy cigarFromString with proper SAM-JDK call TextCigarCodec.getSingleton().decode(cigarString)
-- Added unit tests for reverting soft clipped bases that create a read before the contig
-- [delivers #50892431]
-- Ultimately this was caused by an underlying bug in the reverting of soft clipped bases in the read clipper. The read clipper would fail to properly set the alignment start for reads that were 100% clipped before reverting, such as 10H2S5H => 10H2M5H. This has been fixed and unit tested.
-- Update 1 ReduceReads MD5, which was due to cases where we were clipping away all of the MATCH part of the read, leaving a cigar like 50H11S and the revert soft clips was failing to properly revert the bases.
-- delivers #50655421
-- Although the original bug report was about SplitSamFile it actually was an engine wide error. The two places in the that provide compression to the BAM write now check the validity of the compress argument via a static method in ReadUtils
-- delivers #49531009
-- This allows us to use -rf ReassignMappingQuality to reassign mapping qualities to 60 *before* the BQSR filters them out with MappingQualityUnassignedFilter.
-- delivers #50222251
-Throw a UserException if a Locus or ActiveRegion walker is run with -dcov < 200,
since low dcov values can result in problematic downsampling artifacts for locus-based
traversals.
-Read-based traversals continue to have no minimum for -dcov, since dcov for read traversals
controls the number of reads per alignment start position, and even a dcov value of 1 might
be safe/desirable in some circumstances.
-Also reorganize the global downsampling defaults so that they are specified as annotations
to the Walker, LocusWalker, and ActiveRegionWalker classes rather than as constants in the
DownsamplingMethod class.
-The default downsampling settings have not been changed: they are still -dcov 1000
for Locus and ActiveRegion walkers, and -dt NONE for all other walkers.
Don't map class to counts in the ReadMetrics (necessitating 2 HashMap lookups for every increment).
Instead, wrap the ReadFilters with a counting version and then set those counts only when updating global metrics.
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion. This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element. New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set. Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
1. Don't clone the dataSource's metrics object (because then the engine won't continue to get updated counts)
2. Use the dataSource's metrics object in the CountingFilteringIterator and not the first shard's object!
3. Synchronize ReadMetrics.incrementMetrics to prevent race conditions.
Also:
* Make sure users realize that the read counts are approximate in the print outs.
* Removed a lot of unused cruft from the metrics object while I was in there.
* Added test to make sure that the ReadMetrics read count does not overflow ints.
* Added unit tests for traversal metrics (reads, loci, and active region traversals); these test counts of reads and records.
-- [Delivers #49876703]
-- Add integration test and test file
-- Update SymbolicAlleles combine variant tests, which was turning unfiltered records into PASS!
- Converted my old GATKBAMIndexText (within PileupWalkerIntegrationTest) to use a dataProvider
- Added two integration tests to test -outputInsertLength option
-- The previous implementation of the maxRuntime would require us to wait until all of the work was completed within a shard, which can be a substantial amount of work in the case of a locus walker with 16kb shards.
-- This implementation ensures that we exit from the traversal very soon after the max runtime is exceeded, without completely all of our work within the shard. This is done by updating all of the traversal engines to return false for hasNext() in the nano scheduled input provider. So as soon as the timeout is exceeeded, we stop generating additional data to process, and we only have to wait until the currently executing data processing unit (locus, read, active region) completes.
-- In order to implement this timeout efficiently at this fine scale, the progress meter now lives in the genome analysis engine, and the exceedsTimeout() call in the engine looks at a periodically updated runtime variable in the meter. This variable contains the elapsed runtime of the engine, but is updated by the progress meter daemon thread so that the engine doesn't call System.nanotime() in each cycle of the engine, which would be very expense. Instead we basically wait for the daemon to update this variable, and so our precision of timing out is limited by the update frequency of the daemon, which is on the order of every few hundred milliseconds, totally fine for a timeout.
-- Added integration tests to ensure that subshard timeouts are working properly
-- Previously we used the LocusShardBalancer for the haplotype caller, which meant that TraverseActiveRegions saw its shards grouped in chunks of 16kb bits on the genome. These locus shards are useful when you want to use the HierarchicalMicroScheduler, as they provide fine-grained accessed to the underlying BAM, but they have two major drawbacks (1) we have to fairly frequently reset our state in TAR to handle moving between shard boundaries and (2) with the nano scheduled TAR we end up blocking at the end of each shard while our threads all finish processing.
-- This commit changes the system over to using an ActiveRegionShardBalancers, that combines all of the shard data for a single contig into a single combined shard. This ensures that TAR, and by extensions the HaplotypeCaller, gets all of the data on a single contig together so the the NanoSchedule runs efficiently instead of blocking over and over at shard boundaries. This simple change allows us to scale efficiently to around 8 threads in the nano scheduler:
-- See https://www.dropbox.com/s/k7f280pd2zt0lyh/hc_nano_linear_scale.pdf
-- See https://www.dropbox.com/s/fflpnan802m2906/hc_nano_log_scale.pdf
-- Misc. changes throughout the codebase so we Use the ActiveRegionShardBalancer where appropriate.
-- Added unit tests for ActiveRegionShardBalancer to confirm it does the merging as expected.
-- Fix bad toString in FilePointer
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
-- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
-- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
* A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
right thing for indels at the edges of the alignments.
* Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
* Lots of systematic testing added for this implementation.
* NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
-Diff engine output is now included in the actual exception message thrown as a
result of an MD5 mismatch, which allows it to be conveniently viewed on the
main page of a build in Bamboo.
Minor Additional Improvements:
-WalkerTestSpec now auto-detects test class name via new JVMUtils.getCallingClass()
method, and the test class name is now included as a regular part of integration
test output for each test.
-Fix race condition in MD5DB.ensureMd5DbDirectory()
-integrationtests dir is now cleaned by "ant clean"
GSA-915 #resolve
Problem
-------
The DeBruijn assembler was too slow. The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp). This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.
Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers. The algorithm operates as follows:
identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
for each base in the sequence from the starting vertex kmer:
look at the existing outgoing nodes of current vertex V. If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
If no matching next vertex exists, find a unique vertex with kmer K. If one exists, merge the sequence into this vertex, and continue
If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue
This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size. This allows us to assemble well with even very short kmers.
This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:
-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples. This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor. This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization. This change is essential for us to get good variants from our paths when the kmer size is small. It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation. Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary. This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler
Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations. This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate. Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
Only try to clip adaptors when both reads of the pair are on opposite strands
-- Read pairs that have unusual alignments, such as two reads both oriented like:
<-----
<-----
where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs. This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
-- Previous version would trim down 2M2D2M into 2M if you asked for the first 2 bases, but this can result in incorrect alignment of the bases to the reference as the bases no longer span the full reference interval expected. Fixed and added unit tests
-Changes in Java 7 related to comparators / sorting produce a large number
of innocuous differences in our test output. Updating expectations now
that we've moved to using Java 7 internally.
-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
intermittent failures.
This class, being unused, was no longer getting packaged into the
GATK release jar by bcel, and so attempting to run its unit test
on the release jar was producing an error.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly. Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.
The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly. Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).
Also:
1. counts are now maintained as ints whenever possible. Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts. Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly. Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.
Added lots of unit tests for new functionality.
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences. If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference. Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
-Acquire file locks in a background thread with a timeout of 30 seconds,
and throw a UserException if a lock acquisition call times out
* should solve the locking issue for most people provided they
RETRY failed farm jobs
* since we use NON-BLOCKING lock acquisition calls, any call that
takes longer than a second or two indicates a problem with the
underlying OS file lock support
* use daemon threads so that stuck lock acquisition tasks don't
prevent the JVM from exiting
-Disable both auto-index creation and file locking for integration tests
via a hidden GATK argument --disable_auto_index_creation_and_locking_when_reading_rods
* argument not safe for general use, since it allows reading from
an index file without first acquiring a lock
* this is fine for the test suite, since all index files already
exist for test files (or if they don't, they should!)
-Added missing indices for files in private/testdata
-Had to delete most of RMDTrackBuilderUnitTest, since it mostly tested auto-index
creation, which we can't test with locking disabled, but I replaced the deleted
tests with some tests of my own.
-Unit test for FSLockWithShared to test the timeout feature
* Moved redundant code out of UGEngine
* Added overloaded methods that assume p=0.5 for speed efficiency
* Added unit test for the binomialCumulativeProbability method
-- Add pair cleaning feature. Reads in query-name sorted order are required and pairs need to appear consecutively, but if -cleanPairs option is set, a malformed pair where second read is missing is just skipped instead of erroring out.
-- Add integration tests
-- Move walker to public
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble. The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls. I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.
-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all
General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly. Depreciated old call to inline constants. This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default. Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
-- Add a maximum per sample and overall maximum number of reads held in memory by the ART at any one time. Does this in a new TAROrderedReadCache data structure that uses a reservior downsampler to limit the total number of reads to a constant amount. This constant is set to be by default 3000 reads * nSamples to a global maximum of 1M reads, all controlled via the ActiveRegionTraversalParameters annotation.
-- Added an integration test and associated excessively covered BAM excessiveCoverage.1.121484835.bam (private/testdata) that checks that the system is operating correctly.
-- #resolves GSA-921
-- This method provides client with the current number of elements, without having to retreive the underlying list<T>. Added unit tests for LevelingDownsampler and ReservoirDownsampler as these are the only two complex ones. All of the others are trivially obviously correct.
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5]. The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding. Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i. Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension). Radically speeds up calculations when using large active region extensions. The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible. The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter. The previous error corrector was just broken (conceptually) and was disabled by default in the engine. Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator. For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed. Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well. Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp. In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M. The new code supports this. UnitTested and documented as well. LDMerger handles case where merging two alleles results in a no-op event. Merging CA/C + A/AA -> CAA/CAA -> no op. Handles this case by removing the two events. UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right). Here's the new algorithm:
* Compute probability that two variants are in phase with each other and that no
* compound hets exist in the population.
*
* Implemented as a likelihood ratio test of the hypothesis:
*
* x11 and x22 are the only haplotypes in the populations
*
* vs.
*
* all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
*
* Now, since we have to have both variants in the population, we exclude the x11 & x11 state. So the
* p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
*
* Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
*
* - P(x11 & x12 & x21) -- we have hom-ref and both hets
* - P(x22 & x12 & x21) -- we have hom-alt and both hets
* - P(x22 & x12) -- one haplotype is 22 and the other is het 12
* - P(x22 & x21) -- one haplotype is 22 and the other is het 21
-A UserException is now thrown if either the fai or dict file for the
reference does not exist, with pointers to instructions for creating
these files.
-Gets rid of problematic file locking that was causing intermittent
errors on our farm.
-Integration tests to verify that correct exceptions are thrown in
the case of a missing fai / dict file.
GSA-866 #resolve