Commit Graph

12566 Commits (d55dddfdbab3a0faac4fa562fbc4090d8b7b331b)

Author SHA1 Message Date
Mark DePristo 776f5a2f6f Merge pull request #164 from broadinstitute/mc_clia_scripts
Clia Scripts
2013-04-12 13:08:18 -07:00
Mauricio Carneiro 09d29e5d0d In HaplotypeCallerScript:
* fix downsampling parameter
   * fix the default value of required fields  (_ instead of .)
   * add support to multiple interval files
2013-04-12 15:54:54 -04:00
Mauricio Carneiro 802ae76905 Script for coverage evaluation of exomes and targeted sequencing projects in the Genomics Platform 2013-04-12 15:54:53 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Ryan Poplin e5b9b6041c Merge pull request #162 from broadinstitute/md_path_sw_update
Slight update to Path SW parameters.
2013-04-12 10:38:26 -07:00
Mark DePristo 0e627bce93 Slight update to Path SW parameters.
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
2013-04-12 12:43:52 -04:00
Ryan Poplin 4ef6e0deb1 Merge pull request #161 from broadinstitute/md_unstable_sw
Slightly improved Smith-Waterman parameter values for HaplotypeCaller Pa...
2013-04-12 07:59:43 -07:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00
Mark DePristo 35293cde49 Merge pull request #160 from broadinstitute/rp_bqsr_gatherer_works_with_empty_tables
Updating BQSR RecalibrationEngine to work correctly with empty BQSR tabl...
2013-04-11 14:07:24 -07:00
Ryan Poplin a507381a33 Updating BQSR RecalibrationEngine to work correctly with empty BQSR tables.
-- Previously would crash when a scatter/gather interval contained no usable data.
-- Added unit test to cover this case.
2013-04-11 16:27:59 -04:00
delangel 44230b97eb Merge pull request #158 from broadinstitute/hc_fast_kmer_graph_creation
Performance improvements for building DeBruijn graphs
2013-04-11 12:09:01 -07:00
Mark DePristo fb86887bf2 Fast algorithm for determining which kmers are good in a read
-- old algorithm was O(kmerSize * readLen) for each read.  New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph.  Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
2013-04-11 09:54:22 -04:00
Mark DePristo bf42be44fc Fast DeBruijnGraph creation using the kmer counter
-- The previous creation algorithm used the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to the graph
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
  update edge count by 1 if kmer1 -> kmer2 already existed in the graph

-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)).  This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap

for each kmer pair 1 and 2 in the hash counter
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
  update edge count by count from map if kmer1 -> kmer2 already existed in the graph

-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
2013-04-10 17:10:59 -04:00
Mark DePristo 7d267639d8 Merge pull request #157 from broadinstitute/rp_smith_waterman_failing_test
Bug fix in SWPairwiseAlignment.
2013-04-10 13:54:25 -07:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Eric Banks 2fb8b61dd0 Merge pull request #152 from broadinstitute/md_commonsuffix_infinite_loop_bugfix
Critical bugfix for CommonSuffixSplitter to avoid infinite loops
2013-04-09 17:43:11 -07:00
droazen 97fd8c5893 Merge pull request #156 from broadinstitute/dr_github_mirror_daemon
Daemon script to continually update local mirrors of our github repositories
2013-04-09 16:56:20 -07:00
David Roazen e187258481 Daemon script to continually update local mirrors of our github repositories
-Bamboo now uses the local mirrors for git checkouts, which should hopefully
 resolve the intermittent long delays we've been seeing in Bamboo during git
 operations

-Use a daemon process rather than a cron job to guarantee strict serial
 execution of the git updates (since the time git update operations
 require can vary). The spawn script for the daemon runs as a cron job
 instead to make sure the daemon is always running and restart it if
 necessary.
2013-04-09 16:49:32 -04:00
Mark DePristo b115e5c582 Critical bugfix for CommonSuffixSplitter to avoid infinite loops
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:

X -> A -> B
Y -> A -> B

So that the incoming vertices of B all have the same sequence.  This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph.  Fixed and unit tested

-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging.  So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph.  Equals here means that all vertices have equivalents in both graphs, as do all edges.  If the two graphs are equal we stop simplifying.  It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
2013-04-09 16:19:26 -04:00
Mark DePristo 0194c9492d Merge pull request #155 from broadinstitute/md_pnrm
HaplotypeCaller doesn't support EXACT_GENERAL_PLOIDY model
2013-04-09 12:20:55 -07:00
Mark DePristo 51954ae3e5 HaplotypeCaller doesn't support EXACT_GENERAL_PLOIDY model
-- HC now throws a UserException if this model is provided.  Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
2013-04-09 15:18:42 -04:00
Mark DePristo 55c9542bfd Merge pull request #154 from broadinstitute/mc_printreads_presorted
Fix PrintReads out of space issue
2013-04-09 11:58:57 -07:00
Ryan Poplin b8bd10469d Merge pull request #153 from broadinstitute/md_hc_ld_merge_off
Turn off the LD merging code by default
2013-04-09 07:12:16 -07:00
Mark DePristo 33ecec535d Turn off the LD merging code by default
-- It's just too hard to interpret the called variation when we merge variants via LD.
-- Can now be turned on with -mergeVariantsViaLD
-- Update MD5s
2013-04-09 10:08:06 -04:00
Mauricio Carneiro 3960733c88 Fix PrintReads out of space issue
Problem:
--------
Print Reads was running out of disk space when using the -BQSR option even for small bam files

Solution:
---------
Configure setupWriter to expect pre sorted reads
2013-04-09 08:19:52 -04:00
droazen ae0612b6e8 Merge pull request #150 from broadinstitute/md_hc_excessive_coverage
Make ActiveRegionTraversal robust to excessive coverage
2013-04-08 13:40:39 -07:00
Mark DePristo 1b36db8940 Make ActiveRegionTraversal robust to excessive coverage
-- Add a maximum per sample and overall maximum number of reads held in memory by the ART at any one time.  Does this in a new TAROrderedReadCache data structure that uses a reservior downsampler to limit the total number of reads to a constant amount.  This constant is set to be by default 3000 reads * nSamples to a global maximum of 1M reads, all controlled via the ActiveRegionTraversalParameters annotation.
-- Added an integration test and associated excessively covered BAM excessiveCoverage.1.121484835.bam (private/testdata) that checks that the system is operating correctly.
-- #resolves GSA-921
2013-04-08 15:48:19 -04:00
Mark DePristo 317dc4c323 Add size() method to Downsampler interface
-- This method provides client with the current number of elements, without having to retreive the underlying list<T>.  Added unit tests for LevelingDownsampler and ReservoirDownsampler as these are the only two complex ones.  All of the others are trivially obviously correct.
2013-04-08 15:48:13 -04:00
Ryan Poplin 0c2f795fa5 Merge pull request #147 from broadinstitute/md_hc_symbolic_allele
Large number of fundamental improvements to the HaplotypeCaller
2013-04-08 10:29:07 -07:00
Mark DePristo 469dc7f22c Update KMerErrorCorrectorUnitTest license text 2013-04-08 12:48:20 -04:00
Mark DePristo 21410690a2 Address reviewer comments 2013-04-08 12:48:20 -04:00
Mark DePristo caf15fb727 Update MD5s to reflect new HC algorithms and parameter values 2013-04-08 12:48:16 -04:00
Mark DePristo 6d22485a4c Critical bugfix to ReduceRead functionality of the GATKSAMRecord
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5].  The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding.  Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i.  Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
2013-04-08 12:47:50 -04:00
Mark DePristo 3097936a3d Update GeneralCallingPipeline
-- Bugfix to puts all files in the subdirectory, regardless of whether the outputDir is provided with a ending / or not
-- UG now runs single threaded in GeneralCallingPipeline
-- GCP HC only needs 2 GB now
2013-04-08 12:47:50 -04:00
Mark DePristo 5a54a4155a Change key Haplotype default parameter values
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
2013-04-08 12:47:50 -04:00
Mark DePristo 3a19266843 Fix residual merge conflicts 2013-04-08 12:47:50 -04:00
Mark DePristo 9c7a35f73f HaplotypeCaller no longer creates haplotypes that involve cycles in the SeqGraph
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models.  Allowing cycles can be re-enabled with an HC command line switch.
2013-04-08 12:47:50 -04:00
Mark DePristo 5545c629f5 Rename Utils to GraphUtils to avoid conflicts with the sting.Utils class; fix broken unit test in SharedVertexSequenceSplitterUnitTest 2013-04-08 12:47:49 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo 9b5c55a84a LikelihoodCalculationEngine will now only use reads longer than the minReadLength, which is currently fixed at 20 bp 2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 4d389a8234 Optimizations for HC infrastructure
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
2013-04-08 12:47:49 -04:00
Mark DePristo e916998784 Bugfix for head and tail merging code in SeqGraph
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so.  This would introduce large deletion events at the start / end of the assemblies.  Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
2013-04-08 12:47:48 -04:00
Mark DePristo 2aac9e2782 More efficient ZipLinearChains algorithm
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go.  Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains.  The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
2013-04-08 12:47:48 -04:00
Mark DePristo 7105ad65a6 Remove the capability of EventMap to emit symbolic alleles for unassembled events
-- These events always occur on the very edge of the haplotypes, and are intrinsically dodgy.  So instead of emitting them and then potentially having to deal with merging real basepair events into them we just no longer emit those events.
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 167cd49e71 Added -forceActive argument to ActiveRegionWalkers
-- Causes the ART tool to treat all bases as active.   Useful for debugging
2013-04-08 12:47:48 -04:00
Mark DePristo 8656bd5e29 Haplotype now consolidates cigars in setCigar
-- This fixes edge base bugs where non-consolidated cigars are causing problems in users of the Haplotype object.  Input arguments are now checks (let's see if we blow up)
2013-04-08 12:47:47 -04:00