Commit Graph

920 Commits (d081c19178bfd8fdfb78eaf7643b7179444b16b2)

Author SHA1 Message Date
Eric Banks df189293ce Improve compression in Reduce Reads by incorporating probabilistic model and global het compression
The Problem:
  Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
  regions in an exome) causes RR (with default settings) to consider it a variant region.  This
  seriously hurts compression performance.

The Solution:
  1. We now use a probabilistic model for determining whether we can create a consensus (in other
  words, whether we can error correct a site) instead of the old ratio threshold.  We calculate
  the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
  that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
  2. We also allow het compression globally, not just at known sites.  So if we cannot create a
  consensus at a given site then we try to perform het compression; and if we cannot perform het
  compression that we just don't reduce the variant region.  This way very wonky regions stay
  uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
  locus get het compressed.

Details:
  1. -minvar is now deprecated in favor of -min_pvalue.
  2. Added integration test for bad pvalue input.
  3. -known argument still works to force het compression only at known sites; if it's not included
     then we allow het compression anywhere.  Added unit tests for this.
  4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
     Before finalizing het compression, we now check for insertions or other variant regions (usually due
     to multi-allelics) which can render a region incompressible (and we back out if we find one).  We
     were checking for excessive softclips before, but now we add these tests too.
  5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
     consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
     out instead of backing out all of them.
  6. We no longer create a mini read at the stop of the variant window for het compression.  Instead, we
     allow it to be part of the next global consensus.
  7. The coverage test is no longer run systematically on all integration tests because the quals test
     supercedes it.  The systematic quals test is now much stricter in order to catch bugs and edge cases
     (very useful!).
  8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
     for a consensus was affected by good and bad bases/reads).
  9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
     This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
  10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
     with insertions from a header.

Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
2013-04-16 18:19:06 -04:00
Ryan Poplin e0dfe5ca14 Restore the read filter function in the HaplotypeCaller. 2013-04-16 12:01:30 -04:00
Geraldine Van der Auwera e176fc3af1 Merge pull request #159 from broadinstitute/md_bqsr_ion
Trivial BQSR bug fixes and improvement
2013-04-16 08:54:47 -07:00
Ryan Poplin 936f4da1f6 Merge pull request #166 from broadinstitute/md_hc_persample_haplotypes
Select the haplotypes we move forward for genotyping per sample, not poo...
2013-04-16 08:46:56 -07:00
Mark DePristo 17982bcbf8 Update MD5s for VQSR header change 2013-04-16 11:45:45 -04:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Mark DePristo 5a74a3190c Improvements to the VariantRecalibrator R plots
-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
2013-04-16 09:09:51 -04:00
Mark DePristo 564fe36d22 VariantRecalibrator's VQSR.vcf now contains NEG/POS labels
-- It's useful to know which sites have been used in the training of the model.  The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
2013-04-16 09:09:47 -04:00
Mauricio Carneiro 9bfa5eb70f Quick optimization to the PairHMM
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.

Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
2013-04-14 23:25:33 -04:00
Mark DePristo 3144eae51c UnifiedGenotyper bugfix: don't create haplotypes with 0 bases
-- The PairHMM no longer allows us to create haplotypes with 0 bases.  The UG indel caller used to create such haplotypes.  Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes #47523579]
2013-04-13 14:57:55 -04:00
Mauricio Carneiro f11c8d22d4 Updating java 7 md5's to java 6 md5's 2013-04-13 08:21:48 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 0e627bce93 Slight update to Path SW parameters.
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
2013-04-12 12:43:52 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00
Ryan Poplin a507381a33 Updating BQSR RecalibrationEngine to work correctly with empty BQSR tables.
-- Previously would crash when a scatter/gather interval contained no usable data.
-- Added unit test to cover this case.
2013-04-11 16:27:59 -04:00
Mark DePristo fb86887bf2 Fast algorithm for determining which kmers are good in a read
-- old algorithm was O(kmerSize * readLen) for each read.  New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph.  Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
2013-04-11 09:54:22 -04:00
Mark DePristo bf42be44fc Fast DeBruijnGraph creation using the kmer counter
-- The previous creation algorithm used the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to the graph
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
  update edge count by 1 if kmer1 -> kmer2 already existed in the graph

-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)).  This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap

for each kmer pair 1 and 2 in the hash counter
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
  update edge count by count from map if kmer1 -> kmer2 already existed in the graph

-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
2013-04-10 17:10:59 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mark DePristo b115e5c582 Critical bugfix for CommonSuffixSplitter to avoid infinite loops
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:

X -> A -> B
Y -> A -> B

So that the incoming vertices of B all have the same sequence.  This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph.  Fixed and unit tested

-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging.  So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph.  Equals here means that all vertices have equivalents in both graphs, as do all edges.  If the two graphs are equal we stop simplifying.  It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
2013-04-09 16:19:26 -04:00
Mark DePristo 51954ae3e5 HaplotypeCaller doesn't support EXACT_GENERAL_PLOIDY model
-- HC now throws a UserException if this model is provided.  Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
2013-04-09 15:18:42 -04:00
Mark DePristo 33ecec535d Turn off the LD merging code by default
-- It's just too hard to interpret the called variation when we merge variants via LD.
-- Can now be turned on with -mergeVariantsViaLD
-- Update MD5s
2013-04-09 10:08:06 -04:00
Mark DePristo 21410690a2 Address reviewer comments 2013-04-08 12:48:20 -04:00
Mark DePristo caf15fb727 Update MD5s to reflect new HC algorithms and parameter values 2013-04-08 12:48:16 -04:00
Mark DePristo 6d22485a4c Critical bugfix to ReduceRead functionality of the GATKSAMRecord
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5].  The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding.  Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i.  Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
2013-04-08 12:47:50 -04:00
Mark DePristo 5a54a4155a Change key Haplotype default parameter values
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
2013-04-08 12:47:50 -04:00
Mark DePristo 3a19266843 Fix residual merge conflicts 2013-04-08 12:47:50 -04:00
Mark DePristo 9c7a35f73f HaplotypeCaller no longer creates haplotypes that involve cycles in the SeqGraph
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models.  Allowing cycles can be re-enabled with an HC command line switch.
2013-04-08 12:47:50 -04:00
Mark DePristo 5545c629f5 Rename Utils to GraphUtils to avoid conflicts with the sting.Utils class; fix broken unit test in SharedVertexSequenceSplitterUnitTest 2013-04-08 12:47:49 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo 9b5c55a84a LikelihoodCalculationEngine will now only use reads longer than the minReadLength, which is currently fixed at 20 bp 2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 4d389a8234 Optimizations for HC infrastructure
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
2013-04-08 12:47:49 -04:00
Mark DePristo e916998784 Bugfix for head and tail merging code in SeqGraph
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so.  This would introduce large deletion events at the start / end of the assemblies.  Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
2013-04-08 12:47:48 -04:00
Mark DePristo 2aac9e2782 More efficient ZipLinearChains algorithm
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go.  Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains.  The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 67cd407854 The GenotypingEngine now uses the samples from the mapping of Samples -> PerReadAllele likelihoods instead of passing around a redundant list of samples 2013-04-08 12:47:47 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Eric Banks 6253ba164e Using --keepOriginalAC in SelectVariants was causing it to emit bad VCFs
* This occurred when one or more alleles were lost from the record after selection
  * Discussed here: http://gatkforums.broadinstitute.org/discussion/comment/4718#Comment_4718
  * Added some integration tests for --keepOriginalAC (there were none before)
2013-04-05 00:53:28 -04:00
Eric Banks 7897d52f32 Don't allow users to specify keys and IDs that contain angle brackets or equals signs (not allowed in VCF spec).
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
  * This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
  * Added integration test to confirm failure with User Error
  * Removed illegal header line in KB test VCF that was causing related tests to fail.
2013-04-05 00:52:32 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
Mark DePristo bb42c90f2b Use LinkedHashSets in incoming and outgoing vertex functions in BaseGraph
-- Using a LinkedHashSet changed the md5 for HCTestComplexVariants.
2013-04-02 17:58:20 -04:00
David Roazen b4b58a3968 Fix unprintable character in a comment from the BaseEdge class
Compiler warnings about this were starting to get to me...
2013-04-02 14:24:23 -04:00
Mark DePristo c191d7de8c Critical bugfix for CommonSuffixSplitter
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm.  Created unit test that reproduced the issue, and then fixed the underlying issue.
2013-04-02 09:22:33 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Ryan Poplin f65206e758 Two changes to HC GGA mode to make it more like the UG.
-- Only try to genotype PASSing records in the alleles file
-- Don't attempt to genotype multiple records with the same start location. Instead take the first record and throw a warning message.
2013-04-01 10:20:23 -04:00
Mark DePristo 7c83efc1b9 Merge pull request #135 from broadinstitute/mc_pgtag_fix
Fixing @PG tag uniqueness issue
2013-03-31 11:36:40 -07:00
Eric Banks 7dd58f671f Merge pull request #132 from broadinstitute/gda_filter_unmasked_sites
Added small feature to VariantFiltration to filter sites outside of a gi...
2013-03-31 06:27:26 -07:00
Guillermo del Angel 9686e91a51 Added small feature to VariantFiltration to filter sites outside of a given mask:
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
2013-03-31 08:48:16 -04:00
Eric Banks 8e2094d2af Updated AssessReducedQuals and applied it systematically to all ReduceReads integration tests.
* Moved to protected for packaging purposes.
  * Cleaned up and removed debugging output.
  * Fixed logic for epsilons so that we really only test significant differences between BAMs.
  * Other small fixes (e.g. don't include low quality reduced reads in overall qual).
  * Most RR integration tests now automatically run the quals test on output.
    * A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
2013-03-31 00:27:14 -04:00
Mauricio Carneiro ec475a46b1 Fixing @PG tag uniqueness issue
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".

How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.

Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter

Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31

Issue Tracker:
--------------
[fixes 47100885]
2013-03-30 20:31:33 -04:00
Mauricio Carneiro 68bf470524 making LoglessPairHMM final 2013-03-30 20:00:45 -04:00
Guillermo del Angel 6b8bed34d0 Big bad bug fix: feature added to LeftAlignAndTrimVariants to left align multiallelic records didn't work.
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
2013-03-30 19:31:28 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
Chris Hartl 74a17359a8 MathUtils.randomSubset() now uses Collections.shuffle() (indirectly, through the other methods
that are tested), resulting in slightly different numbers of calls to the RNG, and ultimately
different sets of selected variants.

This commits updates the md5 values for the validation site selector integration test to reflect
these new random subsets of variants that are selected.
2013-03-29 14:52:10 -04:00
Guillermo del Angel 8fbf9c947f Upgrades and changes to LeftAlignVariants, motivated by 1000G consensus indel production:
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
2013-03-29 10:02:06 -04:00
Chris Hartl 73d1c319bf Rarely-occurring logic bugfix for GenotypeConcordance, streamlining and testing of MathUtils
Currently, the multi-allelic test is covering the following case:

Eval   A   T,C
Comp   A   C

reciprocate this so that the reverse can be covered.

Eval   A   C
Comp   A   T,C

And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.

This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:

Eval:   A  G,T      0/0   2/0   2/2   1/1
Comp:   A  C,T      0/0   1/0   0/0   0/0

Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:

Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)

Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.

Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
 - dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
 - vectorSum
 - array shuffle, random subset
 - countOccurances (general forms, the char form is used in the codebase)
 - getNMaxElements
 - array permutation
 - sorted array permutation
 - compare floats
 - sum() (for integer arrays and lists).

Final keyword was extensively added to MathUtils.

The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).

The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.

In addition, more extensive tests were added for
 - logBinomialCoefficient (Newton's identity should always hold)
 - logFactorial
 - log10sumlog10 and its approximation

All unit tests pass
2013-03-28 23:25:28 -04:00
MauricioCarneiro a2b69790a6 Merge pull request #128 from broadinstitute/eb_rr_polyploid_compression_GSA-639 2013-03-28 06:39:43 -07:00
Mark DePristo fde7d36926 Updating md5s due to changes in assembly graph creation algorithms and default parameter 2013-03-27 15:31:24 -04:00
Mark DePristo 197d149495 Increase the maxNumHaplotypesInPopulation to 25
-- A somewhat arbitrary increase, and will need some evaluation but necessary to get good results on the AFR integrationtest.
2013-03-27 15:31:24 -04:00
Mark DePristo 66910b036c Added new and improved suffix and node merging algorithms
-- These new algorithms are more powerful than the restricted diamond merging algoriths, in that they can merge nodes with multiple incoming and outgoing edges.  Together the splitter + merger algorithms will correctly merge many more cases than the original headless and tailless diamond merger.
-- Refactored haplotype caller infrastructure into graphs package, code cleanup
-- Cleanup new merging / splitting algorithms, with proper docs and unit tests
-- Fix bug in zipping of linear chains.  Because the multiplicity can be 0, protect ourselves with a max function call
-- Fix BaseEdge.max unit test
-- Add docs and some more unit tests
-- Move error correct from DeBruijnGraph to DeBruijnAssembler
-- Replaced uses of System.out.println with logger.info
-- Don't make multiplicity == 0 nodes look like they should be pruned
-- Fix toString of Path
2013-03-27 15:31:18 -04:00
Mark DePristo 39f2e811e5 Increase max cigar elements from SW before failing path creation to 20 from 6
-- This allows more diversity in paths, which is sometimes necessary when we cannot simply graphs that have large bubbles
2013-03-26 14:27:18 -04:00
Mark DePristo b1b615b668 BaseGraph shouldn't implement getEdge -- no idea why I added this 2013-03-26 14:27:18 -04:00
Mark DePristo a97576384d Fix bug in the HC not respecting the requested pruning 2013-03-26 14:27:18 -04:00
Mark DePristo 78c672676b Bugfix for pruning and removing non-reference edges in graph
-- Previous algorithms were applying pruneGraph inappropriately on the raw sequence graph (where each vertex is a single base).  This results in overpruning of the graph, as prunegraph really relied on the zipping of linear chains (and the sharing of weight this provides) to avoid over-pruning the graph.  Probably we should think hard about this.  This commit fixes this logic, so we zip the graph between pruning
-- In this process ID's a fundamental problem with how we were trimming away vertices that occur on a path from the reference source to sink.  In fact, we were leaving in any vertex that happened to be accessible from source, any vertices in cycles, and any vertex that wasn't the absolute end of a chain going to a sink.  The new algorithm fixes all of this, using a BaseGraphIterator that's a general approach to walking the base graph.  Other routines that use the same traversal idiom refactored to use this iterator.  Added unit tests for all of these capabilities.
-- Created new BaseGraphIterator, which abstracts common access patterns to graph, and use this where appropriate
2013-03-26 14:27:18 -04:00
Mark DePristo ad04fdb233 PerReadAlleleLikelihoodMap getMostLikelyAllele returns an MostLikelyAllele objects now
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users.  The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not.  That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves.  There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second.  For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads.   All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event.  In this case our annotations will all fall apart, returning their default values.  Added a JIRA to address this (should be discussed in group meeting)
2013-03-26 14:27:13 -04:00
Mark DePristo 2472828e1c HC bug fixes: no longer create reference graphs with cycles
-- Though not intended, it was possible to create reference graphs with cycles in the case where you started the graph with a homopolymer of length > the kmer.  The previous test would fail to catch this case.  Now its not possible
-- Lots of code cleanup and refactoring in this push.  Split the monolithic createGraphFromSequences into simple calls to addReferenceKmersToGraph and addReadKmersToGraph which themselves share lower level functions like addKmerPairFromSeqToGraph.
-- Fix performance problem with reduced reads and the HC, where we were calling add kmer pair for each count in the reduced read, instead of just calling it once with a multiplicity of count.
-- Refactor addKmersToGraph() to use things like addOrUpdateEdge, now the code is very clear
2013-03-26 10:12:24 -04:00
Mark DePristo 1917d55dc2 Bugfix for DeBruijnAssembler: don't fail when read length > haplotype length
-- The previous version would generate graphs that had no reference bases at all in the situation where the reference haplotype was < the longer read length, which would cause the kmer size to exceed the reference haplotype length.  Now return immediately with a null graph when this occurs as opposed to continuing and eventually causing an error
2013-03-26 10:12:17 -04:00
Mark DePristo 464e65ea96 Disable error correcting kmers by default in the HC
-- The error correction algorithm can break the reference graph in some cases by error correcting us into a bad state for the reference sequence.  Because we know that the error correction algorithm isn't ideal, and worse, doesn't actually seem to improve the calling itself on chr20, I've simply disabled error correction by default and allowed it to be turned on with a hidden argument.
-- In the process I've changed a bit the assembly interface, moving some common arguments us into the LocalAssemblyEngine, which are turned on/off via setter methods.
-- Went through the updated arguments in the HC to be @Hidden and @Advanced as appropriate
-- Don't write out an errorcorrected graph when debugging and error correction isn't enabled
2013-03-26 10:05:17 -04:00
Eric Banks 593d3469d4 Refactored the het (polyploid) consensus creation in ReduceReads.
* It is now cleaner and easier to test; added tests for newly implemented methods.
 * Many fixes to the logic to make it work
   * The most important change was that after triggering het compression we actually need to back it out if it
      creates reads that incorporated too many softclips at any one position (because they get unclipped).
   * There was also an off-by-one error in the general code that only manifested itself with het compression.
 * Removed support for creating a het consensus around deletions (which was broken anyways).
   * Mauricio gave his blessing for this.
 * Het compression now works only against known sites (with -known argument).
    * The user can pass in one or more VCFs with known SNPs (other variants are ignored).
    * If no known SNPs are provided het compression will automatically be disabled.
 * Added SAM tag to stranded (i.e. het compressed) reduced reads to distinguish their
   strandedness from normal reduced reads.
    * GATKSAMRecord now checks for this tag when determining whether or not the read is stranded.
    * This allows us to update the FisherStrand annotation to count het compressed reduced reads
       towards the FS calculation.
    * [It would have been nice to mark the normal reads as unstranded but then we wouldn't be
       backwards compatible.]
    * Updated integration tests accordingly with new het compressed bams (both for RR and UG).
 * In the process of fixing the FS annotation I noticed that SpanningDeletions wasn't handling
   RR properly, so I fixed it too.
    * Also, the test in the UG engine for determining whether there are too many overlapping
       deletions is updated to handle RR.
 * I added a special hook in the RR integration tests to additionally run the systematic
   coverage checking tool I wrote earlier.
    * AssessReducedCoverage is now run against all RR integration tests to ensure coverage is
       not lost from original to reduced bam.
    * This helped uncover a huge bug in the MultiSampleCompressor where it would drop reads
       from all but 1 sample (now fixed).
    * AssessReducedCoverage moved from private to protected for packaging reasons.
 * #resolve GSA-639

At this point, this commit encompasses most of what is needed for het compression to go live.
There are still a few TODO items that I want to get in before the 2.5 release, but I will save
those for a separate branch because as it is I feel bad for the person who needs to review all
these changes (sorry, Mauricio).
2013-03-25 09:34:54 -04:00
Mark DePristo 965043472a Vastly more powerful, cleaner graph simplification approach
-- Generalizes previous node merging and splitting approaches.  Can split common prefixes and suffices among nodes, build a subgraph representing this new structure, and incorporate it into the original graph.  Introduces the concept of edges with 0 multiplicity (for purely structural reasons) as well as vertices with no sequence (again, for structural reasons).  Fully UnitTested.  These new algorithms can now really simplify diamond configurations as well as ones sources and sinks that arrive / depart linearly at a common single root node.
-- This new suite of algorithms is fully integrated into the HC, replacing previous approaches
-- SeqGraph transformations are applied iteratively (zipping, splitting, merging) until no operations can be performed on the graph.  This further simplifies the graphs, as splitting nodes may enable other merging / zip operations to go.
2013-03-23 17:40:55 -04:00
Ryan Poplin c15453542e Merge pull request #124 from broadinstitute/md_hc_lowmapq_read_filter
HC now by default only uses reads with MAPQ >= 20 for assembly and calli...
2013-03-21 12:00:28 -07:00
Mark DePristo 7ae15dadbe HC now by default only uses reads with MAPQ >= 20 for assembly and calling
-- Previously we tried to include lots of these low mapping quality reads in the assembly and calling, but we effectively were just filtering them out anyway while generating an enormous amount of computational expense to handle them, as well as much larger memory requirements.  The new version simply uses a read filter to remove them upfront.  This causes no major problems -- at least, none that don't have other underlying causes -- compared to 10-11mb of the KB
-- Update MD5s to reflect changes due to no longer including mmq < 20 by default
2013-03-21 13:10:50 -04:00
Ryan Poplin b9c331c2fa Bug fix in HC gga mode.
-- Don't try to test alleles which haven't had haplotypes assigned to them
2013-03-21 11:02:41 -04:00
Mark DePristo aa7f172b18 Cap the computational cost of the kmer based error correction in the DeBruijnGraph
-- Simply don't do more than MAX_CORRECTION_OPS_TO_ALLOW = 5000 * 1000 operations to correct a graph.  If the number of ops would exceed this threshold, the original graph is used.
-- Overall the algorithm is just extremely computational expensive, and actually doesn't implement the correct correction.  So we live with this limitations while we continue to explore better algorithms
-- Updating MD5s to reflect changes in assembly algorithms
2013-03-21 09:21:35 -04:00
Mark DePristo d94b3f85bc Increase NUM_BEST_PATHS_PER_KMER_GRAPH in DeBruijnAssembler to 25
-- The value of 11 was too small to properly return a real low-frequency variant in our the 1000G AFR integration test.
2013-03-20 22:54:38 -04:00
Mark DePristo 6d7d21ca47 Bugfix for incorrect branch diamond merging algorithm
-- Previous version was just incorrectly accumulating information about nodes that were completely eliminated by the common suffix, so we were dropping some reference connections between vertices.  Fixed.  In the process simplified the entire algorithm and codebase
-- Resolves https://jira.broadinstitute.org/browse/GSA-884
2013-03-20 22:54:37 -04:00
Mark DePristo 3a8f001c27 Misc. fixes upon pull request review
-- DeBruijnAssemblerUnitTest and AlignmentUtilsUnitTest were both in DEBUG = true mode (bad!)
-- Remove the maxHaplotypesToConsider feature of HC as it's not useful
2013-03-20 22:54:37 -04:00
Mark DePristo d3b756bdc7 BaseVertex optimization: don't clone byte[] unnecessarily
-- Don't clone sequence upon construction or in getSequence(), as these are frequently called, memory allocating routines and cloning will be prohibitively expensive
2013-03-20 22:54:37 -04:00
Mark DePristo 5226b24a11 HaplotypeCaller instructure cleanup and unit testing
-- UnitTest for isRootOfDiamond along with key bugfix detected while testing
-- Fix up the equals methods in BaseEdge.  Now called hasSameSourceAndTarget and seqEquals.  A much more meaningful naming
-- Generalize graphEquals to use seqEquals, so it works equally well with Debruijn and SeqGraphs
-- Add BaseVertex method called seqEquals that returns true if two BaseVertex objects have the same sequence
-- Reorganize SeqGraph mergeNodes into a single master function that does zipping, branch merging, and zipping again, rather than having this done in the DeBruijnAssembler itself
-- Massive expansion of the SeqGraph unit tests.  We now really test out the zipping and branch merging code.
-- Near final cleanup of the current codebase
-- DeBruijnVertex cleanup and optimizations.  Since kmer graphs don't allow sequences longer than the kmer size, the suffix is always a byte, not a byte[].  Optimize the code to make use of this constraint
2013-03-20 22:54:37 -04:00
Mark DePristo 2e36f15861 Update md5s to reflect new downsampling and assembly algorithm output
-- Only minor differences, with improvement in allele discovery where the sites differ.  The test of an insertion at the start of the MT no longer calls a 1 bp indel at position 0 in the genome
2013-03-20 22:54:37 -04:00
Mark DePristo 1fa5050faf Cleanup, unit test, and optimize KBestPaths and Path
-- Split Path from inner class of KBestPaths
-- Use google MinMaxPriorityQueue to track best k paths, a more efficient implementation
-- Path now properly typed throughout the code
-- Path maintains a on-demand hashset of BaseEdges so that path.containsEdge is fast
2013-03-20 22:54:36 -04:00
Mark DePristo 98c4cd060d HaplotypeCaller now uses SeqGraph instead of kmer graph to build haplotypes.
-- DeBruijnAssembler functions are no longer static.  This isn't the right way to unit test your code
-- An a HaplotypeCaller command line option to use low-quality bases in the assembly
-- Refactored DeBruijnGraph and associated libraries into base class
-- Refactored out BaseEdge, BaseGraph, and BaseVertex from DeBruijn equivalents.  These DeBruijn versions now inherit from these base classes.  Added some reasonable unit tests for the base and Debruijn edges and vertex classes.
-- SeqVertex: allows multiple vertices in the sequence graph to have the same sequence and yet be distinct
-- Further refactoring of DeBruijnAssembler in preparation for the full SeqGraph <-> DeBruijnGraph split
-- Moved generic methods in DeBruijnAssembler into BaseGraph
-- Created a simple SeqGraph that contains SeqVertex objects
-- Simple chain zipper for SeqGraph that reproduces the results for the mergeNode function on DeBruijnGraphs
-- A working version of the diamond remodeling algorithm in SeqGraph that converts graphs that look like A -> Xa, A -> Ya, Xa -> Z, Ya -> Z into A -> X -> a, A -Y -> a, a -> Z
-- Allow SeqGraph zip merging of vertices where the in vertex has multiple incoming edges or the out vertex has multiple outgoing edges
-- Fix all unit tests so they work with the new SeqGraph system.  All tests passed without modification.
-- Debugging makes it easier to tell which kmer graph contributes to a haplotype
-- Better docs and unit tests for BaseVertex, SeqVertex, BaseEdge, and KMerErrorCorrector
-- Remove unnecessary printing of cleaning info in BaseGraph
-- Turn off kmer graph creation in DeBruijnAssembler.java
-- Only print SeqGraphs when debugGraphTransformations is set to true
-- Rename DeBruijnGraphUnitTest to SeqGraphUnitTest.  Now builds DeBruijnGraph, converts to SeqGraph, uses SeqGraph.mergenodes and tests for equality.
-- Update KBestPathsUnitTest to use SeqGraphs not DebruijnGraphs
-- DebruijnVertex now longer takes kmer argument -- it's implicit that the kmer length is the sequence.length now
2013-03-20 22:54:36 -04:00
Mark DePristo 0f4328f6fe Basic kmer error correction algorithm xfor the HaplotypeCaller
-- Error correction algorithm for the assembler.  Only error correct reads to others that are exactly 1 mismatch away
-- The assembler logic is now: build initial graph, error correct*, merge nodes*, prune dead nodes, merge again, make haplotypes.  The * elements are new
-- Refactored the printing routines a bit so it's easy to write a single graph to disk for testing.
-- Easier way to control the testing of the graph assembly algorithms
-- Move graph printing function to DeBruijnAssemblyGraph from DeBruijnAssembler
-- Simple protected parsing function for making DeBruijnAssemblyGraph
-- Change the default prune factor for the graph to 1, from 2
-- debugging graph transformations are controllable from command line
2013-03-20 22:54:36 -04:00
Mark DePristo 53a904bcbd Bugfix for HaplotypeCaller: GSA-822 for trimming softclipped reads
-- Previous version would not trim down soft clip bases that extend beyond the active region, causing the assembly graph to go haywire.  The new code explicitly reverts soft clips to M bases with the ever useful ReadClipper, and then trims.  Note this isn't a 100% fix for the issue, as it's possible that the newly unclipped bases might in reality extend beyond the active region, should their true alignment include a deletion in the reference.  Needs to be fixed.  JIRA added

-- See https://jira.broadinstitute.org/browse/GSA-822
-- #resolve #fix GSA-822
2013-03-20 22:54:36 -04:00
Mark DePristo ffea6dd95f HaplotypeCaller now has the ability to only consider the best N haplotypes for genotyping
-- Added a -dontGenotype mode for testing assembly efficiency
-- However, it looks like this has a very negative impact on the quality of the results, so the code should be deleted
2013-03-20 22:54:36 -04:00
Mark DePristo a783f19ab1 Fix for potential HaplotypeCaller bug in annotation ordering
-- Annotations were being called on VariantContext that might needed to be trimmed.  Simply inverted the order of operations so trimming occurs before the annotations are added.
-- Minor cleanup of call to PairHMM in LikelihoodCalculationEngine
2013-03-20 22:54:35 -04:00
Eric Banks 1fae750ebe Merge pull request #120 from broadinstitute/aw_reduce_reads_clear_name_cache
Clear ReduceReads name cache after each set of reads produced by ReduceR...
2013-03-20 19:47:42 -07:00
Guillermo del Angel ea01dbf130 Fix to issue encountered when running HaplotypeCaller in GGA mode with data from other 1000G callers.
In particular, someone produced a tandem repeat site with 57 alt alleles (sic) which made the caller blow up.
Inelegant fix is to detect if # of alleles is > our max cached capacity, and if so, emit an informative warning and skip site.
-- Added unit test to UG engine to cover this case.
-- Commit to posterity private scala script currently used for 1000G indel consensus (still very much subject to changes).
GSA-878 #resolve
2013-03-20 14:30:37 -04:00
Geraldine Van der Auwera 95a9ed853d Made some documentation updates & fixes
--Mostly doc block tweaks
	--Added @DocumentedGATKFeature to some walkers that were undocumented because they were ending up in "uncategorized". Very important for GSA: if a walker is in public or protected, it HAS to be properly tagged-in. If it's not ready for the public, it should be in private.
2013-03-20 06:15:20 -04:00
Alec Wysoker bccc9d79e5 Clear ReduceReads name cache after each set of reads produced by ReduceReadsStash.
Name cache was filling up with names of all reads in entire file, which for large file eventually
consumes all of memory.  Only keep read name cache for the reads that are together in one variant
region, so that a pair of reads within the same variant region will still be joined via read name.
Otherwise the ability to connect a read to its mate is lost.

Update MD5s in integration test to reflect altered output.
Add new integration test that confirms that pair within variant region is joined by read name.
2013-03-19 14:12:33 -04:00
Ryan Poplin 0cf5d30dac Bug fix in assembly for edge case in which the extendPartialHaplotype function was filling in deletions in the middle of haplotypes. 2013-03-15 14:20:25 -04:00
Ryan Poplin b8991f5e98 Fix for edge case bug of trying to create insertions/deletions on the edge of contigs.
-- Added integration test using MT that previously failed
2013-03-15 12:32:13 -04:00
Mark DePristo 2d35065238 QualityByDepth remaps QD values > 40 to a gaussian around 30
-- This is a temporarily fix / hack to deal with the very high QD values that are generated by the haplotype caller when nearby events occur within reads.  In that case, the QUAL field can be many fold higher than normal, and results in an inflated QD value.  This hack projects such high QD values back into the good range (as these are good variants in general) so they aren't filtered away by VQSR.
-- The long-term solution to this problem is to move the HaplotypeCaller to the full bubble calling algorithm
-- Update md5s
2013-03-14 16:09:41 -04:00
droazen 0fd9f0e77c Merge pull request #104 from broadinstitute/eb_fix_output_annotation_GSA-837
Fixed the logic of the @Output annotation and its interaction with 'required'
2013-03-14 12:52:00 -07:00
Ryan Poplin 38914384d1 Changing CALLED_IN_DB_UNKNOWN_STATUS to count as TRUE_POSITIVEs in the simplified stats for AssessNA12878. 2013-03-14 14:44:18 -04:00
Geraldine Van der Auwera 61349ecefa Cleaned up annotations
- Moved AverageAltAlleleLength, MappingQualityZeroFraction and TechnologyComposition to Private
  - VariantType, TransmissionDisequilibriumTest, MVLikelihoodRatio and GCContent are no longer Experimental
  - AlleleBalanceBySample, HardyWeinberg and HomopolymerRun are Experimental and available to users with a big bold caveat message
  - Refactored getMeanAltAlleleLength() out of AverageAltAlleleLength into GATKVariantContextUtils in order to make QualByDepth independent of where AverageAltAlleleLength lives
  - Unrelated change, bundled in for convenience: made HC argument includeUnmappedreads @Hidden
  - Removed unnecessary check in AverageAltAlleleLength
2013-03-14 14:26:48 -04:00
Eric Banks 7cab709a88 Fixed the logic of the @Output annotation and its interaction with 'required'.
ALL GATK DEVELOPERS PLEASE READ NOTES BELOW:

I have updated the @Output annotation to behave differently and to include a 'defaultToStdout' tag.
  * The 'defaultToStdout' tags lets walkers specify whether to default to stdout if -o is not provided.
  * The logic for @Output is now:
    * if required==true then -o MUST be provided or a User Error is generated.
    * if required==false and defaultToStdout==true then the output is assigned to stdout if no -o is provided.
      * this is the default behavior (i.e. @Output with no modifiers).
    * if required==false and defaultToStdout==false then the output object is null.
      * use this combination for truly optional outputs (e.g. the -badSites option in AssessNA12878).

  * I have updated walkers so that previous behavior has been maintained (as best I could).
    * In general, all @Outputs with default long/short names have required=false.
    * Walkers with nWayOut options must have required==false and defaultToStdout==false (I added checks for this)
  * I added unit tests for @Output changes with David's help (thanks!).
  * #resolve GSA-837
2013-03-14 11:58:51 -04:00
Mark DePristo b5b63eaac7 New GATKSAMRecord concept of a strandless read, update to FS
-- Strandless GATK reads are ones where they don't really have a meaningful strand value, such as Reduced Reads or fragment merged reads.  Added GATKSAMRecord support for such reads, along with unit tests
-- The merge overlapping fragments code in FragmentUtils now produces strandless merged fragments
-- FisherStrand annotation generalized to treat strandless as providing 1/2 the representative count for both strands.  This means that that merged fragments are properly handled from the HC, so we don't hallucinate fake strand-bias just because we managed to merge a lot of reads together.
-- The previous getReducedCount() wouldn't work if a read was made into a reduced read after getReducedCount() had been called.  Added new GATKSAMRecord method setReducedCounts() that does the right thing.  Updated SlidingWindow and SyntheticRead to explicitly call this function, and so the readTag parameter is now gone.
-- Update MD5s for change to FS calculation.  Differences are just minor updates to the FS
2013-03-13 11:16:36 -04:00
MauricioCarneiro 4403e3572a Merge pull request #94 from broadinstitute/gg_gatkdoc_docfixes_GSATDG-111 2013-03-12 13:02:35 -07:00
MauricioCarneiro 3a16ba04d4 Merge pull request #97 from broadinstitute/eb_refactor_sliding_window
Refactoring of SlidingWindow class in RR to reduce complexity and fix important bug
2013-03-12 12:27:26 -07:00
Geraldine Van der Auwera f972963918 Fixed issues raised by Appistry QA (mostly small fixes, corrections & clarifications to GATKDocs)
GATK-73 updated docs for bqsr args
GATK-9 differentiate CountRODs from CountRODsByRef
GATK-76 generate GATKDoc for CatVariants
GATK-4 made resource arg required
GATK-10 added -o, some docs to CountMales; some docs to CountLoci
GATK-11 fixed by MC's -o change; straightened out the docs.
GATK-77 fixed references to wiki
GATK-76 Added Ami's doc block
GATK-14 Added note that these annotations can only be used with VariantAnnotator
GATK-15 specified required=false for two arguments
GATK-23 Added documentation block
GATK-33 Added documentation
GATK-34 Added documentation
GATK-32 Corrected arg name and docstring in DiffObjects
GATK-32 Added note to DO doc about reference (required but unused)
GATK-29 Added doc block to CountIntervals
GATK-31 Added @Output PrintStream to enable -o
GATK-35 Touched up docs
GATK-36 Touched up docs, specified verbosity is optional
GATK-60 Corrected GContent annot module location in gatkdocs
GATK-68 touched up docs and arg docstrings
GATK-16 Added note of caution about calling RODRequiringAnnotations as a group
GATK-61 Added run requirements (num samples, min genotype quality)
Tweaked template and generic doc block formatting (h2 to h3 titles)
GATK-62 Added a caveat to HR annot
Made experimental annotation hidden
GATK-75 Added setup info regarding BWA
GATK-22 Clarified some argument requirements
GATK-48 Clarified -G doc comments
GATK-67 Added arg requirement
GATK-58 Added annotation and usage docs
GSATDG-96 Corrected doc
Updated MD5 for DiffObjectsIntegrationTests (only change is link in table title)
2013-03-12 10:57:14 -04:00
Eric Banks 05e69b6294 Refactoring of SlidingWindow class in RR to reduce complexity and fix important bug.
* Allow RR to write its BAM to stdout by setting required=true for @Output.
  * Fixed bug in sliding window where a break in coverage after a long stretch without
     a variant region was causing a doubling of all the reads before the break.
  * Refactored SlidingWindow.updateHeaderCounts() into 3 separate tested methods.
  * Refactored polyploid consensus code out of SlidingWindow.compressVariantRegion().
2013-03-12 09:06:55 -04:00
Ryan Poplin c96fbcb995 Use the indel heterozygosity prior when calling indels with the HC 2013-03-11 14:12:43 -04:00
Guillermo del Angel 695723ba43 Two features useful for ancient DNA processing.
Ancient DNA sequencing data is in many ways different from modern data, and methods to analyze it need to be adapted accordingly.
Feature 1: Read adaptor trimming. Ancient DNA libraries typically have very short inserts (in the order of 50 bp), so typical Illumina libraries sequenced in, say, 100bp HiSeq will have a large adaptor component being read after the insert.
If this adaptor is not removed, data will not be aligneable. There are third party tools that remove adaptor and potentially merge read pairs, but are cumbersome to use and require precise knowledge of the library construction and adaptor sequence.
-- New walker ReadAdaptorTrimmer walks through paired end data, computes pair overlap and trims auto-detected adaptor sequence.
-- Unit tests added for trimming operation.
-- Utility walker (may be retired later) DetailedReadLengthDistribution computes insert size or read length distribution stratified by read group and mapping status and outputs a GATKReport with data.
-- Renamed MaxReadLengthFilter to ReadLengthFilter and added ability to specify minimum read length as a filter (may be useful if, as a consequence of adaptor trimming, we're left with a lot of very short reads which will map poorly and will just clutter output BAMs).

Feature 2: Unbiased site QUAL estimation: many times ancestral allele status is not known and VCF fields like QUAL, QD, GQ, etc. are affected by the pop. gen. prior at a site. This might introduce subtle biases in studies where a species is aligned against the reference of another species, so an option for UG and HC not to apply such prior is introduced.
-- Added -noPrior argument to StandardCallerArgumentCollection.
-- Added option not to fill priors is such argument is set.
-- Added an integration test.
2013-03-09 18:18:13 -05:00
Yossi Farjoun baad965a57 - Changed loadContaminationFile file parser to delimit by tab only. This allows spaces in sampleIDs, which apparently are allowed.
- This was needed since samples with spaces in their names are regularly found in the picard pipeline.
- Modified the tests to account for this (removed spaces from the good tests, and changed the failing tests accordingly)
- Cleaned up the unit tests using a @DataProvider (I'm in love...).
- Moved AlleleBiasedDownsamplingUtilsUnitTest to public to match location of class it is testing (due to the way bamboo operates)
2013-03-07 13:04:24 -05:00
Eric Banks 3759d9dd67 Added the functionality to impose a relative ordering on ReadTransformers in the GATK engine.
* ReadTransformers can say they must be first, must be last, or don't care.
  * By default, none of the existing ones care about ordering except BQSR (must be first).
    * This addresses a bug reported on the forum where BAQ is incorrectly applied before BQSR.
  * The engine now orders the read transformers up front before applying iterators.
  * The engine checks for enabled RTs that are not compatible (e.g. both must be first) and blows up (gracefully).
  * Added unit tests.
2013-03-06 12:38:59 -05:00
Eric Banks 78721ee09b Added new walker to split MNPs into their allelic primitives (SNPs).
* Can be extended to complex alleles at some point.
  * Currently only works for bi-allelics (documented).
  * Added unit and integration tests.
2013-03-05 23:16:42 -05:00
Eric Banks bbbaf9ad20 Revert push from stable (I forgot that pushing from stable overwrites current unstable changes) 2013-03-05 09:06:02 -05:00
Eric Banks a037423225 Merged bug fix from Stable into Unstable 2013-03-05 09:03:48 -05:00
Eric Banks 7e1bfd6a7c Included an accidental change from unstable into the previous push 2013-03-05 09:03:31 -05:00
Eric Banks bd4e4f4ee3 Merged bug fix from Stable into Unstable 2013-03-04 23:24:44 -05:00
Eric Banks b715218bfe Fix for mismatching indel quals erro: need to adjust for softclips just like we do for bases and normal quals. 2013-03-04 23:23:18 -05:00
Ryan Poplin ce7554e9d6 Merged bug fix from Stable into Unstable 2013-03-04 12:36:04 -05:00
Ryan Poplin 0697594778 Active regions that don't contain any usable reads should just be skipped over instead of throwing an IllegalStateException. 2013-03-04 12:35:40 -05:00
Mark DePristo 42d3919ca4 Expanded functionality for writing BAMs from HaplotypeCaller
-- The new code includes a new mode to write out a BAM containing reads realigned to the called haplotypes from the HC, which can be easily visualized in IGV.
-- Previous functionality maintained, with bug fixes
-- Haplotype BAM writing code now lives in utils
-- Created a base class that includes most of the functionality of writing reads realigned to haplotypes onto haplotypes.
-- Created two subclasses, one that writes all haplotypes (previous functionality) and a CalledHaplotypeBAMWriter that will only write reads aligned to the actually called haplotypes
-- Extended PerReadAlleleLikelihoodMap.getMostLikelyAllele to optionally restrict set of alleles to consider best
-- Massive increase in unit tests in AlignmentUtils, along with several new powerful functions for manipulating cigars
-- Fix bug in SWPairwiseAlignment that produces cigar elements with 0 size, and are now fixed with consolidateCigar in AlignmentUtils
-- HaplotypeCaller now tracks the called haplotypes in the GenotypingEngine, and returns this information to the HC for use in visualization.
-- Added extensive docs to HaplotypeCaller on how to use this capability
-- BUGFIX -- don't modify the read bases in GATKSAMRecord in LikelihoodCalculationEngine in the HC
-- Cleaned up SWPairwiseAlignment.  Refactored out the big main and supplementary static methods.  Added a unit test with a bug TODO to fix what seems to be an edge case bug in SW
-- Integration test to make sure we can actually write a BAM for each mode.  This test only ensures that the code runs and doesn't exception out.  It doesn't actually enforce any MD5s
-- HaplotypeBAMWriter also left aligns indels in the reads, as SW can return a random placement of a read against the haplotype.  Calls leftAlign to make the alignments more clear, with unit test of real read to cover this case
-- Writes out haplotypes for both all haplotype and called haplotype mode
-- Haplotype writers now get the active region call, regardless of whether an actual call was made.  Only emitting called haplotypes is moved down to CalledHaplotypeBAMWriter
2013-03-03 12:07:29 -05:00
David Roazen c5c99c8339 Split long-running integration test classes into multiple classes
This is to facilitate the current experiment with class-level test
suite parallelism. It's our hope that with these changes, we can get
the runtime of the integration test suite down to 20 minutes or so.

-UnifiedGenotyper tests: these divided nicely into logical categories
 that also happened to distribute the runtime fairly evenly

-UnifiedGenotyperPloidy: these had to be divided arbitrarily into two
 classes in order to halve the runtime

-HaplotypeCaller: turns out that the tests for complex and symbolic
 variants make up half the runtime here, so merely moving these into
 a separate class was sufficient

-BiasedDownsampling: most of these tests use excessively large intervals
 that likely can't be reduced without defeating the goals of the tests. I'm
 disabling these tests for now until they can either be redesigned to use smaller
 intervals around the variants of interest, or refactored into unit tests
 (creating a JIRA for Yossi for this task)
2013-03-01 13:55:23 -05:00
depristo cac3f80c64 Merge pull request #73 from broadinstitute/eb_remove_nested_hashmap_GSA-732
Replace uses of NestedHashMap with NestedIntegerArray.
2013-02-28 05:19:56 -08:00
Eric Banks d2904cb636 Update docs for RTC. 2013-02-27 14:56:44 -05:00
Eric Banks 69b8173535 Replace uses of NestedHashMap with NestedIntegerArray.
* Removed from codebase NestedHashMap since it is unused and untested.
 * Integration tests change because the BQSR CSV is now sorted automatically.
 * Resolves GSA-732
2013-02-27 14:03:39 -05:00
Alec Wysoker c8368ae2a5 Eliminate 7-element arrays in BaseCounts and BaseAndQualsCount and replace with in-line primitive attributes. This is ugly but reduces heap overhead, and changes are localized. When used in conjunction with Mauricio's FastUtil changes it saves and additional 9% or so of execution time. 2013-02-27 12:49:56 -05:00
David Roazen 752f4335a5 Merged bug fix from Stable into Unstable 2013-02-27 05:20:41 -05:00
David Roazen 2a7af43164 Fix improper dependencies in QScripts used by pipeline tests, and attempt to fix the flawed MisencodedBaseQualityUnitTest
-Some QScripts used by public pipeline tests unnecessarily used the (now protected) UnifiedGenotyper.
 Changed them to use PrintReads instead.

-Moved ExampleUnifiedGenotyperPipelineTest to protected

-Attempt to fix the flawed and sporadically failing MisencodedBaseQualityUnitTest:

   After looking at this class a bit, I think the problem was the use of global arrays for the quals
   shared across all reads in all tests (BAMRecord class definitely does not make a separate copy for
   each read!). One test (testFixBadQuals) modifies the bad quals array, and if this happens to run
   before the testBadQualsThrowsError test the bad quals array will have been "fixed" and no exception
   will be thrown.
2013-02-27 04:45:53 -05:00
David Roazen 6466463d5a Merged bug fix from Stable into Unstable 2013-02-26 21:54:54 -05:00
David Roazen 12a3d7ecad Fix licenses on files modified in 2.4-1 2013-02-26 21:53:17 -05:00
David Roazen a53b4a7521 Merged bug fix from Stable into Unstable 2013-02-26 21:41:13 -05:00
David Roazen 65d31ba4ad Fix runtime public -> protected dependencies in the test suite
-replace unnecessary uses of the UnifiedGenotyper by public integration tests
 with PrintReads

-move NanoSchedulerIntegrationTest to protected, since it's completely dependent
 on the UnifiedGenotyper
2013-02-26 21:19:12 -05:00
depristo 93205154b5 Merge pull request #63 from broadinstitute/eb_fix_pairhmm_unittest_GSA-776
Eb fix pairhmm unittest gsa 776
2013-02-26 11:56:58 -08:00
Eric Banks 734353e9df Merge pull request #60 from broadinstitute/mc_fastutil_GSATDG-83
Brought all of ReduceReads to fastutils
2013-02-26 11:56:41 -08:00
David Roazen 8b29030467 Change default downsampling coverage target for the HaplotypeCaller to 250
-was previously set to 30, which seems far too aggressive given that with
 ActiveRegionWalkers, as with LocusWalkers, this limits the depth of any
 pileup returned by LIBS

-250 is a more conservative default used by the UG

-can adjust down/up later based on further experiments (GSA-699 will
 remain open)

-verified with Ryan that all integration test differences are either
 innocent or represent an improvement

GSA-699
2013-02-26 09:33:25 -05:00
Eric Banks 396b7e0933 Fixed the intermittent PairHMM unit test failure.
The issue here is that the OptimizedLikelihoodTestProvider uses the same basic underlying class as the
BasicLikelihoodTestProvider and we were using the BasicTestProvider functionality to pull out tests of
that class; so if the optimized tests were run first we were unintentionally running those same tests
again with the basic ones (but expecting different results).
2013-02-25 15:05:13 -05:00
Eric Banks 7519484a38 Refactored PairHMM.initialize to first take haplotype max length and then the read max length so that it is consistent with other PairHMM methods. 2013-02-25 15:04:23 -05:00
Ryan Poplin 89e2943dd1 The maximum kmer length is derived from the reads.
-- This is done to take advantage of longer reads which can produce less ambiguous haplotypes
-- Integration tests change for HC and BiasedDownsampling
2013-02-25 14:40:25 -05:00
Mauricio Carneiro 0ff3343282 Addressing Eric's comments
-- added @param docs to the new variables
-- made all variables final
-- switched to string builder instead of String for performance.

GSATDG-83
2013-02-25 13:33:47 -05:00
Mauricio Carneiro 9e5a31b595 Brought all of ReduceReads to fastutils
-- Added unit tests to ReduceReads name compression
-- Updated reduce reads walker for unit testing

GSATDG-83
2013-02-23 22:53:23 -05:00
Ryan Poplin 6a639c8ffc Replace Smith-Waterman alignment with the bubble traversal.
-- Instead of doing a full SW alignment against the reference we read off bubbles from the assembly graph.
-- Smith-Waterman is run only on the base composition of the bubbles which drastically reduces runtime.
-- Refactoring graph functions into a new DeBruijnAssemblyGraph class.
-- Bug fix in path.getBases().
-- Adding validation code to the assembly engine.
-- Renaming SimpleDeBruijnAssembler to match the naming of the new Assembly graph class.
-- Adding bug fixes, docs and unit tests for DeBruijnAssemblyGraph and KBestPaths classes.
-- Added ability to ignore bubbles that are too divergent from the reference
-- Max kmer can't be bigger than the extension size.
-- Reverse the order that we create the assembly graphs so that the bigger kmers are used first.
-- New algorithm for determining unassembled insertions based on the bubble traversal instead of the full SW alignment.
-- Don't need the full read span reference loc for anything any more now that we clip down to the extended loc for both assembly and likelihood evaluation.
-- Updating HaplotypeCaller and BiasedDownsampling integration tests.
-- Rebased everything into one commit as requested by Eric
-- improvements to the bubble traversal are coming as a separate push
2013-02-22 15:42:16 -05:00
Mauricio Carneiro e3f01673e1 Implementation of the find and diagnose Queue script
-- Added 'uncovered intervals' output for FindCoveredIntervals
-- updated scala script to make use of it.
2013-02-22 10:19:01 -05:00
Ryan Poplin 62e14f5b58 Bug fix in LikelihoodCalculationEngine: Mapping quality was being cast to a byte and overflowing for reads with large mapping quality scores. 2013-02-21 14:34:17 -05:00
Eric Banks 6996a953a8 Haplotype/Allele based optimizations for the HaplotypeCaller that knock off nearly 20% of the total runtime (multi-sample).
These 2 changes improve runtime performance almost as much as Ryan's previous attempt (with ID-based comparisons):
* Don't unnecessarily overload Allele.getBases() in the Haplotype class.
  * Haplotype.getBases() was calling clone() on the byte array.
* Added a constructor to Allele (and Haplotype) that takes in an Allele as input.
  * It makes a copy of he given allele without having to go through the validation of the bases (since the Allele has already been validated).
  * Rev'ed the variant jar accordingly.

For the reviewer: all tests passed before rebasing, so this should be good to go as far as correctness.
2013-02-21 10:14:11 -05:00
Eric Banks 551d33686c Merge pull request #47 from broadinstitute/aw_reduceread_perf_1_GSA-761
Reduce memory footprint of SyntheticRead by replacing several Lists with...
2013-02-20 04:49:07 -08:00
Eric Banks 9dfdb9528b Merge pull request #49 from broadinstitute/gda_hidden_ug_args
Hide arguments related to reference sample operation in UG - for interna...
2013-02-19 16:18:32 -08:00
Eric Banks 0055a6f1cd Merge pull request #45 from broadinstitute/mc_fix_indelrealigner_GSA-774
Fix to the Indel Realigner bug described in GSA-774
2013-02-19 16:16:48 -08:00
Guillermo del Angel 5a0a9bc488 Hide arguments related to reference sample operation in UG - for internal use only until paper is published and docs are polished. 2013-02-19 19:06:42 -05:00
Mauricio Carneiro 371ea2f24c Fixed IndelRealigner reference length bug (GSA-774)
-- modified ReadBin GenomeLoc to keep track of softStart() and softEnd() of the reads coming in, to make sure the reference will always be sufficient even if we want to use the soft-clipped bases
-- changed the verification from readLength to aligned bases to allow reads with soft-clipped bases
-- switched TreeSet -> PriorityQueue in the ConstrainedMateFixer as some different reads can be considered equal by picard's SAMRecordCoordinateComparator (the Set was replacing them)
-- pulled out ReadBin class so it can be testable
-- added unit tests for ReadBin with soft-clips
-- added tests for getMismatchCount (AlignmentUtils) to make sure it works with soft-clipped reads

GSA-774 #resolve
2013-02-19 16:00:36 -05:00
Alec Wysoker ab75e053da Reduce memory footprint of SyntheticRead by replacing several Lists with a single List of a small private static
class that contains the attributes that were scattered across the several Lists.
2013-02-19 15:33:33 -05:00
Ryan Poplin c025e84c8b Fix for calculating read pos rank sum test with reads that are informative but don't actually overlap the variant due to some hard clipping.
-- Updated a few integration tests for HC, UG, and UG general ploidy
2013-02-19 14:09:24 -05:00
Mark DePristo be45edeff2 ActivityProfile and ActiveRegions respects engine interval boundaries
-- Active regions are created as normal, but they are split and trimmed to the engine intervals when added to the traversal, if there are intervals present.
-- UnitTests for ActiveRegion.splitAndTrimToIntervals
-- GenomeLocSortedSet.getOverlapping uses binary search to efficiently in ~ log N time find overlapping intervals
-- UnitTesting overlap function in GenomeLocSortedSet
-- Discovered fundamental implementation bug in that adding genome locs out of order (elements on 20 then on 19) produces an invalid GenomeLocSortedSet.  Created a JIRA to address this: https://jira.broadinstitute.org/browse/GSA-775
-- Constructor that takes a collection of genome locs now sorts its input and merges overlapping intervals
-- Added docs for the constructors in GLSS
-- Update HaplotypeCaller MD5s, which change because ActiveRegions are now restricted to the engine intervals, which changes slightly the regions in the tests and so the reads in the regions, and thus the md5s
-- GenomeAnalysisEngineUnitTest needs to provide non-null genome loc parser
2013-02-18 10:40:25 -05:00
Ryan Poplin b7e9c342c7 Reducing the size of the reference padding in the HaplotypeCaller. 2013-02-17 11:09:00 -05:00
Mark DePristo 73a363b166 Update MD5s due to new QualityUtils calculations
-- Increase the allowed runtime of one UG integration test
-- The GGA indels mode runs two UG commands, and was barely under the 10 minute limit before.  Some updates can push this right over the edge.  Increased limit
-- CalibrateGenotypeLikelihoods runs on a small data set now, so it's faster
-- Updating MD5s due to more correct quality utils.  DuplicatesWalkers quality estimates have changed.  One UG test has different FS and rank sum tests because the conversion to phred scores are slightly (second decimal place) different
2013-02-16 07:31:38 -08:00
Mark DePristo 3231031c1a Bugfix for FisherStrand
-- FisherStrand pValues can sum to slightly greater than 1.0, so they need to be capped to convert to a Phred-scaled quality score
2013-02-16 07:31:38 -08:00
Mark DePristo 9a29d6d4be Fix an catastrophic bug (WoW!) in the reference calculation of the UG
-- The UG was using MathUtils binomial probability backward, so that the estimated confidence was always NaN, and was as a side effect other utils converted this to a meaningless 0.0.  This is all because there wasn't a unit test.
-- I've fixed the calculation, so it's now log10 based, uses robust MathUtils and QualityUtils functions to compute probabilities, and added a unit test.
2013-02-16 07:31:38 -08:00
Mark DePristo 9e28d1e347 Cleanup and unit tests for QualityUtils
-- Fixed a few conversion bugs with edge case quals (ones that were very high)
-- Fixed a critical bug in the conversion of quals that was causing near capped quals to fall below their actual value.  Will undoubtedly need to fix md5s
-- More precise prob -> qual calculations for very high confidence events in phredScaleCorrectRate, trueProbToQual, and errorProbToQual.  Very likely to improve accuracy of many calculations in the GATK
-- Added errorProbToQual and trueProbToQual calculations that accept an integer cap, and perform the (tricky) conversion from int to byte correctly.
-- Full docs and unit tests for phredScaleCorrectRate and phredScaleErrorRate.
-- Renamed probToQual to trueProbToQual
-- Added goodProbability and log10OneMinusX to MathUtils
-- Went through the GATK and cleaned up many uses of QualityUtils
-- Cleanup constants in QualityUtils
-- Added full docs for all of the constants
-- Rename MAX_QUAL_SCORE to MAX_SAM_QUAL_SCORE for clarity
-- Moved MAX_GATK_USABLE_Q_SCORE to RecalDatum, as it's s BQSR specific feature
-- Convert uses of QualityUtils.errorProbToQual(1-x) to QualityUtils.trueProbToQual(x)
-- Cleanup duplicate quality score routines in MathUtils.  Moved and renamed MathUtils.log10ProbabilityToPhredScale => QualityUtils.phredScaleLog10ErrorRate. Removed 3 routines from MathUtils, and remapped their usages into the better routines in QualityUtils
2013-02-16 07:31:37 -08:00
MauricioCarneiro d80b99143f Merge pull request #37 from broadinstitute/rp_left_alignment_hc_contract_GSA-771 2013-02-15 08:32:45 -08:00
MauricioCarneiro 1dd284a5bb Merge pull request #39 from broadinstitute/tj_printreads_tag_for_bqsr_GSA-720
PrintReads writes a header when used with -BQSR
2013-02-15 07:18:28 -08:00
MauricioCarneiro b58a0eca6b Merge pull request #33 from broadinstitute/gg_more_gatkdocs_tweaks_GSATDG-62
Refactored GATKDocs categories some more ( GSATDG-62 )
2013-02-14 22:35:07 -08:00
Tad Jordan 6cb80591e3 PrintReads writes a header when used with -BQSR 2013-02-14 22:19:14 -05:00
Guillermo del Angel b18f216033 Updated md5's from BiasedDownsamplerIntegrationTest that changed due to changes in HaplotypeCaller - changing HashMaps to LinkedHashMaps changed ordering of reads presented to BiasedDownSampler which changed reads chosen, thereby marginally changing PL's and some site info. 2013-02-14 20:18:49 -05:00
Ryan Poplin 871c8b3866 No need to consider haplotypes which Smith-Waterman aligns off the end of the large padded reference. 2013-02-14 11:18:10 -05:00
Geraldine Van der Auwera 6208742f7c Refactored GATKDocs categories some more ( GSATDG-62 )
-- Renamed ValidatePileup to CheckPileup since validation is reserved word
-- Renamed AlignmentValidation to CheckAlignment (same as above)
-- Refactored category definitions to use constants defined in HelpConstants
-- Fixed a couple of minor typos and an example error
-- Reorganized the GATKDocs index template to use supercategories
-- Refactored integration tests for renamed walkers (my earlier refactoring had screwed them up or not carried over)
2013-02-13 16:49:18 -05:00
depristo 357d196dad Merge pull request #32 from broadinstitute/yf_per-sample-downsampling_GSA_765
Fixed md5s for the per-sample downsampling IntegrationTests that were disabled.
2013-02-13 10:08:11 -08:00
Yossi Farjoun 6d12e5a54f Fixed md5s for the per-sample downsampling IntegrationTests that were disabled.
- got md5s from a interim version that does not have the per-sample downsampling hookedup
- added an integration test that forces the result from flat-downsampling to equal that which results from an equivalent flat contamination file
2013-02-13 12:49:39 -05:00
Guillermo del Angel 4308b27f8c Fixed non-determinism in HaplotypeCaller and some UG calls -
-- HaplotypeCaller and PerReadAlleleLikelihoodMap should use LinkedHashMaps instead of plain HashMaps. That way the ordering when traversing alleles is maintained. If the JVM traverses HashMaps with random ordering, different reads (with same likelihood) may be removed by contamination checker, and different alleles may be picked if they have same likelihoods for all reads.
-- Put in some GATKDocs and contracts in HaplotypeCaller files (far from done, code is a beast)
-- Update md5's due to different order of iteration in LinkedHashMaps instead of HashMaps inside HaplotypeCaller  (due to change in PerReadAlleleLikelihoodMap that also slightly modifies reads chosen by per-read downsampling).
-- Reenabled testHaplotypeCallerMultiSampleGGAMultiAllelic test
-- Added some defensive argument checks into HaplotypeCaller public functions (not intended to be done yet).
2013-02-12 15:43:29 -05:00
Geraldine Van der Auwera dff5ef562b Reorganized walker categories in GATKDocs (@DocumentedGATKFeature details)
-- Sorted out contents of BAM Processing vs. Diagnostics & QC Tools
-- Moved two validation-related walkers from Diagnostics & QC to Validation Utilities
-- Reworded some category names and descriptions to be more explicit and user-friendly
2013-02-12 13:36:15 -05:00
Ryan Poplin 3f2f837b6a Optimization to ReadPosRankSumTest: Don't do the work of parsing through the cigar string for non-informative reads. 2013-02-11 11:36:09 -05:00
Mark DePristo b4417dff5b Updating MD5s due to changes in HMM
-- New HMM has two impacts on MD5s.  First, all indel calls with UG and all calls by HC no longer have the HaplotypeScore computed.  This is for the good, especially given the computational cost of this annotationa and unclear value for HC.  Second, the BaseQualityRankSum values are changing by tiny amounts because of the changes in the HMM likelihoods.
-- Disabled three tests from Yossi that cause strange MD5 differences with calls for HC, created a JIRA for him to enable and fix
-- Disabled the non-deterministic GGA test.  Assigned JIRA to Guillermo
-- With this push I expect all integration tests to pass
2013-02-09 19:19:28 -05:00
Mark DePristo 35139cf990 HaplotypeScore only annotates SNPs
-- The new HMM new edge conditions the likelihoods are offset by log10(n possible starts) so the results don't really mean "fits the haplotype well" any longer.  This results in grossly inflated HaplotypeScores for indels and with the HaplotypeCaller.  So I'm simply not going to emit this annotation value any longer for indels and for the HC
2013-02-09 19:19:28 -05:00
Mark DePristo e40d83f00e Final version of PairHMMs with correct edge conditions
-- Uses 1/N for N potential start sites as the probability of starting at any one of the potential start sites
-- Add flag that says to use the original edge condition, respected by all subclasses.  This brings the new code back to the original state, but with all of the cleanup I've done
-- Only test configurations where the read length <= haplotype length.  I think this is actually the contract, but we'll talk about this tomorrow
-- Fix egregious bug with the myLog10SumLog10 function doing the exact opposite of the requested arguments, so that doExact really meant don't do exact
-- PairHMM now exposes computeReadLikelihoodGivenHaplotypeLog10 but subclasses must overload subComputeReadLikelihoodGivenHaplotypeLog10.  This protected function does the work, and the public function will do argument and result QC
-- Have to be more tolerant of reference (approximate) HMM.  All unit tests from the original HMM implementations pass now
-- Added locs of docs
-- Generalize unit tests with multiple equivalent matches of read to haplotype
-- Added runtime argument checking for initial and computeReadLikelihoodGivenHaplotypeLog10
-- Functions to dumpMatrices for debugging
-- Fix nasty bug (without original unit tests) in LoglessPairHMM
-- Max read and haplotype lengths only worked in previous code if they were exactly equal to the provided read and haplotype sizes.  Fixed bug.  Added unit test to ensure this doesn't break again.
-- Added dupString(string, n) method to Utils
-- Added TODOs for next commit.  Need to compute number of potential start sites not in initialize but in the calc routine since this number depends not on the max sizes but the actual read sizes
-- Unit tests for the hapStartIndex functionality of PairHMM
-- Moved computeFirstDifferingPosition to PairHMM, and added unit tests
-- Added extensive unit tests for the hapStartIndex functionality of computeReadLikelihoodGivenHaplotypeLog10
-- Still TODOs left in the code that I'll fix up
-- Logless now compute constants, if they haven't been yet initialized, even if you forgot to say so
-- General: the likelihood penalty for potential start sites is now properly computed against the actual read and reference bases, not the maximum.  This involved moving some initialize() code into the computeLikelihoods function.  That's ok because all of the potential log10 functions are actually going to cached versions, so the slowdown is minimal
-- Added some unit tests to ensure that common errors (providing haplotypes too long, reads too long, not initializing the HMM) are captured as errors
2013-02-09 19:19:22 -05:00
Mark DePristo 09595cdeb9 Remove ExactPairHMM and OriginalPairHMM, everyone just uses Log10PairHMM with appropriate arguments 2013-02-09 13:06:54 -05:00
Mark DePristo 2d802e17a4 Delete the CachingPairHMM 2013-02-09 13:06:54 -05:00
Mark DePristo 7dcafe8b81 Preliminary version of LoglessCachingPairHMM that avoids positive likelihoods
-- Would have been squashed but could not because of subsequent deletion of Caching and Exact/Original PairHMMs
-- Actual working unit tests for PairHMMUnitTest
-- Fixed incorrect logic in how I compared hmm results to the theoretical and exact results
-- PairHMM has protected variables used throughout the subclasses
2013-02-09 13:06:54 -05:00
Mark DePristo 7fb620dce7 Generalize and fixup ContigComparator
-- Now uses a SAMSequenceDictionary to do the comparison of contigs (which is the right way to do it)
-- Added unit tests
2013-02-09 09:52:13 -05:00
Mauricio Carneiro d004bfbe6f walker to calculate per base coverage distribution
-- Base distribution optionally includes deletions
-- Implemented an optional filtered coverage distribution option
-- Integration tests added for every feature of the traversal

This walker is specially fast for the task due to the ability to calculate uncovered bases without having to visit the loci. This capability should be made generic in the future for the advantage of DiagnoseTargets and DepthOfCoverage.
GSATDG-45 #resolve
2013-02-07 16:33:05 -05:00
Mauricio Carneiro 5f49c95cc1 Added distance across contigs calculation to GenomeLocs
-- distance across contigs is calculated given a sequence dictionary (from SAMFileHeader)
-- unit test added
GSATDG-45
2013-02-07 16:31:41 -05:00
depristo cd4aec177a Merge pull request #20 from broadinstitute/aw_reduceread_perf_1_GSA-761
Aw reduceread perf 1 gsa 761
2013-02-07 12:11:05 -08:00
Eric Banks 9826192854 Added contracts, docs, and tests for several methods in AlignmentUtils. There are over 74K tests being run now for this class!
* AlignmentUtils.getMismatchCount()
* AlignmentUtils.calcAlignmentByteArrayOffset()
* AlignmentUtils.readToAlignmentByteArray().
* AlignmentUtils.leftAlignIndel()
2013-02-07 13:04:24 -05:00
Alec Wysoker e88bc753aa Replace with map.containsKey followed by map.get with map.get followed by null check. 2013-02-07 11:58:41 -05:00
Alec Wysoker 72e496d6f3 Eliminate unnecessary zeroing out of primitive arrays immediately after new. 2013-02-07 11:57:43 -05:00
Eric Banks 481982202d Fixing the failing RR integration tests.
* After consulting Tim/David/Mauricio we determined that the md5 changes were due to different encodings of binary arrays in samjdk
   * However, it made no functional difference to the results (confirmed by Eric) so we agreed to update md5s
 * Also, the header of one of the test bams was malformed but old picard jar didn't perform checks so it only started failing now
   * Fixed the bam
2013-02-06 12:40:56 -05:00
Mark DePristo 59df329776 Fast path for biallelic variants in IndependentAllelesDiploidExactAFCalc
-- If the VariantContext is a bi-allelic variant already, don't split up the VC (it doesn't do anything) and then combine it back together.  This saves us a lot of work on average
-- Be more protective of calls to AFCalc with a VariantContext that might only have ref allele, throwing an exception
2013-02-06 10:34:09 -05:00
eitanbanks 584899329c Merge pull request #13 from broadinstitute/dr_variant_migration_GSA-692
Replace org.broadinstitute.variant with jar built from the Picard repo
2013-02-06 07:22:30 -08:00
Eric Banks 562f2406d7 Added check that BaseRecalibrator is not being run on a reduced bam.
- Throws user exception if it is.
 - Can be turned off with --allow_bqsr_on_reduced_bams_despite_repeated_warnings argument.
 - Added test to check this is working.
 - Added docs to BQSRReadTransformer explaining why this check is not performed on PrintReads end.
 - Added small bug fix to GenomeAnalysisEngine that I uncovered in this process.
 - Added comment about not changing the program record name, as per reviewer comments.
 - Removed unused variable.
2013-02-06 10:14:27 -05:00
Eric Banks 4e5ff3d6f1 Bug fix for NPE in HC with --dbsnp argument.
- I had added the framework in the VA engine but should not have hooked it up to the HC yet since the RefMetaDataTracker is always null.
 - Added contracts and docs to the relevant methods in the VA engine so that this doesn't happen in the future.
2013-02-05 21:59:19 -05:00
Eric Banks e7c35a907f Fixes to BQSR for the --maximum_cycle_value argument.
- It's now written into the recal report so that it can be used in the PrintReads step.
  - Note that we also now write the --deletions_default_quality value which accidentally wasn't being written before!
  - Added tests to make sure that the value of the --maximum_cycle_value is being used properly by PR with -BQSR.
(This is my last non-branch commit; all future pushes will follow new GATK practices)
2013-02-05 17:38:03 -05:00
David Roazen e7e76ed76e Replace org.broadinstitute.variant with jar built from the Picard repo
The migration of org.broadinstitute.variant into the Picard repo is
complete. This commit deletes the org.broadinstitute.variant sources
from our repo and replaces it with a jar built from a checkout of the
latest Picard-public svn revision.
2013-02-05 17:24:25 -05:00
Ryan Poplin cb2dd470b6 Moving the random number generator over to using GenomeAnalysisEngine.getRandomGenerator in the logless versus exact pair hmm unit test. We don't believe this will fix the problem with the non-deterministic test failures but it will give us more information the next time it fails. 2013-02-05 12:56:20 -05:00
MauricioCarneiro 050c4794a5 Merge pull request #11 from yfarjoun/per_sample2
-Added Per-Sample Contamination Removal to UnifiedGenotyper: Added an @A...
2013-02-05 08:04:29 -08:00
Eric Banks 23c6aee236 Added in some basic unit tests for polyploid consensus creation in RR.
- Uncovered small bug in the fix that I added yesterday, which is now fixed properly.
- Uncovered massive general bug: polyploid consensus is totally busted for deletions (because of call to read.getReadBases()[readPos]).
  - Need to consult Mauricio on what to do here (are we supporting het compression for deletions?  (Insertions are definitely not supported)
2013-02-05 10:35:45 -05:00
Yossi Farjoun de03f17be4 -Added Per-Sample Contamination Removal to UnifiedGenotyper: Added an @Advanced option to the StandardCallerArgumentCollection, a file which should
contain two columns, Sample (String) and Fraction (Double) that form the Sample-Fraction map for the per-sample AlleleBiasedDownsampling.
-Integration tests to UnifiedGenotyper (Using artificially contaminated BAMs created from a mixure of two broadly concented samples) were added
-includes throwing an exception in HC if called using per-sample contamination file (not implemented); tested in a new integration test.
-(Note: HaplotypeCaller already has "Flat" contamination--using the same fraction for all samples--what it doesn't have is
   _per-sample_ AlleleBiasedDownsampling, which is what has been added here to the UnifiedGenotyper.
-New class: DefaultHashMap (a Defaulting HashMap...) and new function: loadContaminationFile (which reads a Sample-Fraction file and returns a map).
-Unit tests to the new class and function are provided.
-Added tests to see that malformed contamination files are found and that spaces and tabs are now read properly.
-Merged the integration tests that pertain to biased downsampling, whether HaplotypeCaller or unifiedGenotyper, into a new IntegrationTest class.
2013-02-04 18:24:36 -05:00
Eric Banks 70f3997a38 More RR tests and fixes.
* Fixed implementation of polyploid (het) compression in RR.
  * The test for a usable site was all wrong.  Worked out details with Mauricio to get it right.
  * Added comprehensive unit tests in HeaderElement class to make sure this is done right.
  * Still need to add tests for the actual polyploid compression.
  * No longer allow non-diploid het compression; I don't want to test/handle it, do you?
* Added nearly full coverage of tests for the BaseCounts class.
2013-02-04 15:55:15 -05:00
Ryan Poplin 79ef41e7b1 Added some docs, unit test, and contracts to SimpleDeBruijnAssembler.
-- Testing that cycles in the reference graph fail graph construction appropriately.
-- Minor bug fix in assembly with reduced reads.

Added some docs and contracts to SimpleDeBruijnAssembler

Added a unit test to SimpleDeBruijnAssembler
2013-02-04 15:17:22 -05:00
Geraldine Van der Auwera 43e3a040b6 Updated UnifiedGenotyper GATKDoc (note on ploidy model) 2013-02-04 14:18:56 -05:00
Chris Hartl 41a030f4b7 Apparently I'm a failure at rebasing...there should have been only one commit message to write. But whatever, here it is again:
Part 1 of Variant Annotator Unit tests: PerReadAlleleLikelihoodMap

 - Added contract enforcement for public methods
 - Refactored the conversion from read -> (allele -> likelihood) to allele -> list[read] into its own method
 - added method documentation for non getters/setters
 - finals, finals everywhere
 - Add in a unit test for the PerReadAlleleLikelihoodMap. Complete coverage except for .clear() and a method that is a straight call into a separately-tested utility class.
2013-02-04 14:16:28 -05:00
Ryan Poplin d9fd89ecaa Somehow these md5 updates got lost in my previous git rebase disaster. Sorry for the trouble. 2013-02-04 13:26:18 -05:00
Eric Banks 2d518f3063 More RR-related updates and tests.
- ReduceReads by default now sets up-front ReadWalker downsampling to 40x per start position.
   - This is the value I used in my tests with Picard to show that memory issues pretty much disappeared.
   - This should hopefully take care of the memory issues being reported on the forum.
- Added javadocs to SlidingWindow (the main RR class) to follow GATK conventions.
- Added more unit tests to increase coverage of BaseCounts class.
- Added more unit tests to test I/D operators in the SlidingWindow class.
2013-02-04 12:57:43 -05:00
Guillermo del Angel 971ded341b Swap java Random generator for GATK one to ensure test determinism 2013-02-04 10:57:34 -05:00
Guillermo del Angel f31bf37a6f First step in better BQSR unit tests for covariates (not done yet): more test coverage in basic covariates, test logging several read groups/read lengths and more combinations simultaneously.
Add basic Javadocs headers for PerReadAlleleLikehoodMap.
2013-02-03 15:31:30 -05:00
Eric Banks 03df5e6ee6 - Added more comprehensive tests for consensus creation to RR. Still need to add tests for I/D ops.
- Added RR qual correctness tests (note that this is a case where we don't add code coverage but still need to test critical infrastructure).
- Also added minor cleanup of BaseUtils
2013-02-01 15:37:19 -05:00
Ryan Poplin 2fee000dba Adding unit tests for KBestPaths class and fixing edge case bugs. 2013-02-01 13:51:31 -05:00
David Roazen c6581e4953 Update MD5s to reflect version number change in the BAM header
I've confirmed via a script that all of these differences only
involve the version number bump in the BAM headers and nothing
else:

< @HD   VN:1.0  GO:none SO:coordinate
---
> @HD   VN:1.4  GO:none SO:coordinate
2013-02-01 13:51:31 -05:00
Guillermo del Angel a520058ef6 Add option to specify maximum STR length to RepeatCovariates from command line to ease testing 2013-02-01 13:51:31 -05:00
Mark DePristo 22f7fe0d52 Expanded unit tests for AlignmentUtils
-- Added JIRA entries for the remaining capabilities to be fixed up and unit tested
2013-02-01 13:51:31 -05:00
Ryan Poplin ac033ce41a Intermediate commit of new bubble assembly graph traversal algorithm for the HaplotypeCaller. Adding functionality for a path from an assembly graph to calculate its own cigar string from each of the bubbles instead of doing a massive Smith-Waterman alignment between the path's full base composition and the reference. 2013-01-31 11:32:19 -05:00
Ryan Poplin 495bca3d1a Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-31 10:12:26 -05:00
Ryan Poplin ca6968d038 Use base List and Map types in the GenotypingEngineUnitTest. 2013-01-31 10:12:18 -05:00
Eric Banks 75ceddf9e5 Adding new unit tests for RR. These tests took a frustratingly long time to get to pass, but now we have a framework for
testing the adding of reads into the SlidingWindow plus consensus creation.  Will flesh these out more after I take care of
some other items on my plate.
2013-01-31 09:46:38 -05:00
Ryan Poplin bb29bd7df7 Use base List and Map types in the HaplotypeCaller when possible. 2013-01-30 17:09:27 -05:00
Ryan Poplin 5f4a063def Breaking up my massive commits into smaller pieces that I can successfully merge and digest. This one enables downsampling in the HaplotypeCaller (by lowering the default dcov to 20) and removes my long-standing, temporary region-based downsampling. 2013-01-30 16:14:07 -05:00
David Roazen 591df2be44 Move additional VariantContext utility methods back to the GATK
Thanks to Eric for his feedback
2013-01-30 13:58:17 -05:00
Ryan Poplin ff8ba03249 Updating BQSR integration test md5s to reflect the updates to the hierarchicalBayesianQualityEstimate function 2013-01-30 13:30:18 -05:00
Ryan Poplin 85dabd321f Adding unit tests for hierarchicalBayesianQualityEstimate function 2013-01-30 13:26:07 -05:00
Ryan Poplin 07fe3dd1ef Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-30 13:19:24 -05:00
David Roazen 9985f82a7a Move BaseUtils back to the GATK by request, along with associated utility methods 2013-01-30 13:09:44 -05:00
Ryan Poplin 2967776458 The Empirical quality column in the recalibration report can't be compared in the BQSRGatherer because the value is calculated using the Bayesian estimate with different priors. This value should never be used from a recalibration report anyway except during plotting. 2013-01-30 12:28:14 -05:00
Eric Banks d067c7f136 Resolving merge conflicts 2013-01-30 10:47:59 -05:00
Eric Banks 9025567cb8 Refactoring the SimpleGenomeLoc into the now public utility UnvalidatingGenomeLoc and the RR-specific FinishedGenomeLoc.
Moved the merging utility methods into GenomeLoc and moved the unit tests around accordingly.
2013-01-30 10:45:29 -05:00
Mark DePristo 4852c7404e GenomeLocs are already comparable, so I'm removing the less complete GenomeLocComparator class and updating ReduceReads and CompressionStash to use built-in comparator 2013-01-30 10:12:27 -05:00
Ryan Poplin 59311aeea2 Getting back null values from the tables is perfectly reasonable if those covariates don't appear in your table. Need to handle them gracefully. 2013-01-30 10:06:14 -05:00
Ryan Poplin e7d7d70247 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-30 10:01:06 -05:00
Mark DePristo 92c5635e19 Cleanup, document, and unit test ActiveRegion
-- All functions tested.  In the testing / review I discovered several bugs in the ActiveRegion routines that manipulate reads.  New version should be correct
-- Enforce correct ordering of supporting states in constructor
-- Enforce read ordering when adding reads to an active region in add
-- Fix bug in HaplotypeCaller map with new updating read spans.  Now get the full span before clipping down reads in map, so that variants are correctly placed w.r.t. the full reference sequence
-- Encapsulate isActive field with an accessor function
-- Make sure that all state lists are unmodifiable, and that the docs are clear about this
-- ActiveRegion equalsExceptReads is for testing only, so make it package protected
-- ActiveRegion.hardClipToRegion must resort reads as they can become out of order
-- Previous version of HC clipped reads but, due to clipping, these reads could no longer overlap the active region.  The old version of HC kept these reads, while the enforced contracts on the ActiveRegion detected this was a problem and those reads are removed.  Has a minor impact on PLs and RankSumTest values
-- Updating HaplotypeCaller MD5s to reflect changes to ActiveRegions read inclusion policy
2013-01-30 09:47:12 -05:00
Mauricio Carneiro 3d9a83c759 BaseCoverageDistributions should be 'by reference'
otherwise we miss all the 0 coverage spots.
2013-01-29 22:37:44 -05:00
Mauricio Carneiro 29fd536c28 Updating licenses manually
Please check that your commit hook is properly pointing at ../../private/shell/pre-commit

Conflicts:
	public/java/test/org/broadinstitute/variant/VariantBaseTest.java
2013-01-29 17:27:53 -05:00
David Roazen a536e1da84 Move some VCF/VariantContext methods back to the GATK based on feedback
-Moved some of the more specialized / complex VariantContext and VCF utility
 methods back to the GATK.

-Due to this re-shuffling, was able to return things like the Pair class back
 to the GATK as well.
2013-01-29 16:56:55 -05:00
Eric Banks e4ec899a87 First pass at adding unit tests for the RR framework: I have added 3 tests and all 3 uncovered RR bugs!
One of the fixes was critical: SlidingWindow was not converting between global and relative positions correctly.
Besides not being correct, it was resulting in a massive slow down of the RR traversal.
That fix definitely breaks at least one of the integration tests, but it's not worth changing md5s now because I'll be
changing things all over RR for the next few days, so I am going to let that test fail indefinitely until I can confirm
general correctness of the tool.
2013-01-29 15:51:07 -05:00
Ryan Poplin cba89e98ad Refactoring the Bayesian empirical quality estimates to be in a single unit-testable function. 2013-01-29 15:50:46 -05:00
Guillermo del Angel 1d5b29e764 Unit tests for repeat covariates: generate 100 random reads consisting of tandem repeat units of random content and size, and check that covariates match expected values at all positions in reads.
Fixed corner case where value of covariate at border between 2 tandem repeats of different length/content wasn't consistent
2013-01-29 15:23:02 -05:00
Guillermo del Angel c11197e361 Refactored repeat covariates to eliminate duplicated code - now all inherit from basic RepeatCovariate abstract class. Comprehensive unit tests coming... 2013-01-29 10:10:24 -05:00
Ryan Poplin 35543b9cba updating BQSR integration test values for the PR half of BQSR. 2013-01-29 09:47:57 -05:00
Ryan Poplin bf25196a0b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-28 22:33:13 -05:00
Ryan Poplin 1f254d29df Don't set the empirical quality when reading in the recal table because then we won't be using the new quality estimates for the prior since the value is cached. 2013-01-28 22:16:43 -05:00
Guillermo del Angel ff799cc79a Fixed bad merge 2013-01-28 20:04:25 -05:00
Guillermo del Angel 5995f01a01 Big intermediate commit (mostly so that I don't have to go again through merge/rebase hell) in expanding BQSR capabilities. Far from done yet:
a) Add option to stratify CalibrateGenotypeLikelihoods by repeat - will add integration test in next push.
b) Simulator to produce BAM files with given error profile - for now only given SNP/indel error rate can be given. A bad context can be specified and if such context is present then error rate is increased to given value.
c) Rewrote RepeatLength covariate to do the right thing - not fully working yet, work in progress.
d) Additional experimental covariates to log repeat unit and combined repeat unit+length. Needs code refactoring/testing
2013-01-28 19:55:46 -05:00
Ryan Poplin d665a8ba0c The Bayesian calculation of Qemp in the BQSR is now hierarchical. This fixes issues in which the covariate bins were very sparse and the prior estimate being used was the original quality score. This resulted in large correction factors for each covariate which breaks the equation. There is also now a new option, qlobalQScorePrior, which can be used to ignore the given (very high) quality scores and instead use this value as the prior. 2013-01-28 15:56:33 -05:00
Ryan Poplin aab160372a No need to sort the BQSR tables by default. 2013-01-28 11:26:01 -05:00
David Roazen f63f27aa13 org.broadinstitute.variant refactor, part 2
-removed sting dependencies from test classes
-removed org.apache.log4j dependency
-misc cleanup
2013-01-28 09:03:46 -05:00
Mauricio Carneiro 1aee8f205e Tool to calculate per base coverage distribution
GSATDG-29 #resolve
2013-01-27 23:38:46 -05:00
Mark DePristo 804caf7a45 HaplotypeCaller Optimization: return a inactive (p = 0.0) activity if the context has no bases in the pileup
-- Allows us to avoid doing a lot of misc. work to set up the genotype when we don't have any data to genotype.  Valuable in the case where we are passing through large regions without any data
2013-01-27 14:10:06 -05:00
Ami Levy-Moonshine b4447cdca2 In cases where one uses VariantContextUtils.GenotypeMergeType.REQUIRE_UNIQUE we used to verify that the samples names are unique in VariantContextUtils.simpleMerge for each VCs. It couse to a bug that was reported on the forum (when a VCs had 2 VC from the same sample).
Now we will check it only in CombineVariants.init using the headers. A new function was added to SamplesUtils with unitTests in CVunitTest.java.
2013-01-25 15:49:51 -05:00
Mark DePristo 3f95f39be3 Updating HC md5s for new cutting algorithm and default band pass filter parameters 2013-01-25 11:07:29 -05:00
Eric Banks f7b80116d6 Don't let users play with the different exact model implementations. 2013-01-25 10:52:02 -05:00
Eric Banks 6dd0e1ddd6 Pulled out the --regenotype functionality from SelectVariants into its own tool: RegenotypeVariants.
This allows us to move SelectVariants into the public suite of tools now.
2013-01-25 09:42:04 -05:00
Mark DePristo 592f90aaef ActivityProfile now cuts intelligently at the best local minimum when in a larger than max size active region
-- This new algorithm is essential to properly handle activity profiles that have many large active regions generated from lots of dense variant events.  The new algorithm passes unit tests and passes visualize visual inspection of both running on 1000G and NA12878
-- Misc. commenting of the code
-- Updated ActiveRegionExtension to include a min active region size
-- Renamed ActiveRegionExtension to ActiveRegionTraversalParameters, as it carries more than just the traversal extension now
2013-01-24 13:48:00 -05:00
Eric Banks 6790e103e0 Moving lots of walkers back from protected to public (along with several of the VA annotations).
Let's see whether Mauricio's automatic git hook really works!
2013-01-24 11:42:49 -05:00
Chris Hartl a3b98daf1a Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-23 14:49:34 -05:00
Chris Hartl 7fcfa4668c Since GenotypeConcordance is now a standalone walker, remove the old GenotypeConcordance evaluation module and the associated integration tests. 2013-01-23 14:47:23 -05:00
Mark DePristo 8026199e4c Updating md5s for CountReadsInActiveRegions and HaplotypeCaller to reflect new activity profile mechanics
-- In this process I discovered a few missed sites in the old code.  The new approach actually produces better HC results than the previous version.
2013-01-23 13:46:01 -05:00
Mark DePristo 8d9b0f1bd5 Restructure ActivityProfiler into root class ActivityProfile and derived class BandPassActivityProfile
-- Required before I jump in an redo the entire activity profile so it's can be run imcrementally
-- This restructuring makes the differences between the two functionalities clearer, as almost all of the functionality is in the base class. The only functionality provided by the BandPassActivityProfile is isolated to a finalizeProfile function overloaded from the base class.
-- Renamed ActivityProfileResult to ActivityProfileState, as this is a clearer indication of its actual functionality.  Almost all of the misc. walker changes are due to this name update
-- Code cleanup and docs for TraverseActiveRegions
-- Expanded unit tests for ActivityProfile and ActivityProfileState
2013-01-23 13:45:21 -05:00
Chris Hartl c500e1d8ac Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-22 15:31:30 -05:00
Chris Hartl d33c755aea Adding docs. 2013-01-22 15:29:33 -05:00
Chris Hartl 7060e01a8e Fix for broken unit test plus some minor changes to comments. Unit tests were broken by my pulling the site status utility function into the enum. Thankfully the unit tests caught my silly duplication of a line. 2013-01-22 15:14:41 -05:00
Mauricio Carneiro 7b8b064165 Last manual license update (hopefully)
if everyone updates their git hook accordingly, this will be the last time I have to manually run the script.

GSATDG-5
2013-01-18 16:13:07 -05:00
Ami Levy-Moonshine 0fb7b73107 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-18 15:03:42 -05:00
Ami Levy-Moonshine 826c29827b change the default VCFs gatherer of the GATK (not just the UG) 2013-01-18 15:03:12 -05:00
Eric Banks cac439bc5e Optimized the Allele Biased Downsampling: now it doesn't re-sort the pileup but just removes reads from the original one.
Added a small fix that slightly changed md5s.
2013-01-18 11:17:31 -05:00
Chris Hartl 08d2da9057 Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-18 10:28:45 -05:00
Chris Hartl bf5748a538 Forgot to actually put in the md5. Also with the new change to record pairing and filtering, the multiple-records integration test changed: the indel records (T/TG | T/TGACA) are matched up (rather than left separate) resulting in properly identifying mismatching alleles, rather than HET-UNAVAILABLE and UNAVAILABLE-HET. Very nice. 2013-01-18 10:25:36 -05:00
Chris Hartl 91030e9afa Bugfix: records that get paired up during the resolution of multiple-records-per-site were not going into genotype-level filtering. Caught via testing.
Testing for moltenized output, and for genotype-level filtering. This tool is now fully functional. There are three todo items:

1) Docs
2) An additional output table that gives concordance proportions normalized by records in both eval and comp (not just total in eval or total in comp)
3) Code cleanup for table creation (putting a table together the way I do takes -way- too many lines of code)
2013-01-18 09:49:48 -05:00
Eric Banks 39c73a6cf5 1. Ryan and I noticed that the FisherStrand annotation was completely busted for indels with reduced reads; fixed.
2. While making the previous fix and unifying FS for SNPs and indels, I noticed that FS was slightly broken in the general case for indels too; fixed.
3. I also fixed a minor bug in the Allele Biased Downsampling code for reduced reads.
2013-01-18 03:35:48 -05:00
Eric Banks 6a903f2c23 I finally gave up on trying to get the Haplotype/Allele merging to work in the HaplotypeCaller.
I've resigned myself instead to create a mapping from Allele to Haplotype.  It's cheap so not a big deal, but really shouldn't be necessary.
Ryan and I are talking about refactoring for GATK2.5.
2013-01-18 01:21:08 -05:00
Eric Banks 6db3e473af Better error message for bad qual 2013-01-17 10:30:04 -05:00
Eric Banks 953592421b I think we got out of sync with the HC tests as we were clobbering each other's changes. Only differences here are to some RankSumTest values. 2013-01-17 09:19:21 -05:00
Eric Banks ded659232b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 22:49:56 -05:00
Eric Banks a623cca89a Bug fix for HaplotypeCaller, as reported on the forum: when reduced reads didn't completely overlap a deletion call,
we were incorrectly trying to find the reference position of a base on the read that didn't exist.
Added integration test to cover this case.
2013-01-16 22:47:58 -05:00
Eric Banks dbb69a1e10 Need to use ints for quals in HaplotypeScore instead of bytes because of overflow (they are summed when haplotypes are combined) 2013-01-16 22:33:16 -05:00
Chris Hartl e15d4ad278 Addition of moltenize argument for moltenized tabular output. NRD/NRS not moltenized because there are only two columns. 2013-01-16 18:00:23 -05:00
Mark DePristo 3c476a92a2 Add dummy functionality (currently throws an error) to allow HC to include unmapped reads during assembly and calling 2013-01-16 16:25:36 -05:00
Eric Banks 4cf34ee9da Bug fix to FisherStrand: do not let it output INFINITY. This all needs to be unit tested, but that's coming on the horizon. 2013-01-16 15:35:04 -05:00
Mark DePristo 2a42b47e4a Massive expansion of ActiveRegionTraversal unit tests, resulting in several bugfixes to ART
-- UnitTests now include combinational tiling of reads within and spanning shard boundaries
-- ART now properly handles shard transitions, and does so efficiently without requiring hash sets or other collections of reads
-- Updating HC and CountReadsInActiveRegions integration tests
2013-01-16 15:30:00 -05:00
Eric Banks e47a389b26 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 14:59:11 -05:00
Eric Banks d18dbcbac1 Added tests for changing IUPAC bases to Ns, for failing on bad ref bases, and for the HaplotypeCaller not failing when running over a region with an IUPAC base.
Out of curiosity, why does Picard's IndexedFastaSequenceFile allow one to query for start position 0?  When doing so, that base is a line feed (-1 offset to the first base in the contig) which is an illegal base (and which caused me no end of trouble)...
2013-01-16 14:55:33 -05:00
Khalid Shakir 4ffb43079f Re-committing the following changes from Dec 18:
Refactored interval specific arguments out of GATKArgumentCollection into InvtervalArgumentCollection such that it can be used in other CommandLinePrograms.
Updated SelectHeaders to print out full interval arguments.
Added RemoteFile.createUrl(Date expiration) to enable creation of presigned URLs for download over http: or file:.
2013-01-16 12:43:15 -05:00
Eric Banks 445735a4a5 There was no reason to be sharing the Haplotype infrastructure between the HaplotypeCaller and the HaplotypeScore annotation since they were really looking for different things.
Separated them out, adding efficiencies for the HaplotypeScore version.
2013-01-16 11:10:13 -05:00
Eric Banks 392b5cbcdf The CachingIndexedFastaSequenceFile now automatically converts IUPAC bases to Ns and errors out on other non-standard bases.
This way walkers won't see anything except the standard bases plus Ns in the reference.
Added option to turn off this feature (to maintain backwards compatibility).

As part of this commit I cleaned up the BaseUtils code by adding a Base enum and removing all of the static indexes for
each of the bases.  This uncovered a bug in the way the DepthOfCoverage walker counts deletions (it was counting Ns instead!) that isn't covered by tests.  Fortunately that walker is being deprecated soon...
2013-01-16 10:22:43 -05:00
Eric Banks 4fb3e48099 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 00:13:38 -05:00
Eric Banks 0d282a7750 Bam writing from HaplotypeCaller seems to be working on all my test cases. Note that it's a hidden debugging option for now.
Please let me know if you notice any bad behavior with it.
2013-01-16 00:12:02 -05:00
Chris Hartl 327169b283 Refactor the method that identifies the site overlap type into the type enum class (so it can be used elsewhere potentially).
Completed todo item: for sites like

(eval)
20   12345   A    C
20   12345   A    AC

(comp)
20   12345   A    C
20   12345   A    ACCC

the records will be matched by the presence of a non-empty intersection of alleles. Any leftover records are then paired with an empty variant context (as though the call was unique). This has one somewhat counterintuitive feature, which is that normally

(eval)
20  12345  A   AC
(comp)
20  12345  A   ACCC

would be classified as 'ALLELES_DO_NOT_MATCH' (and not counted in genotype tables), in the presence of the SNP, they're counted as EVAL_ONLY and TRUTH_ONLY respectively.

+ integration test
2013-01-15 12:13:45 -05:00
Eric Banks d3baa4b8ca Have Haplotype extend the Allele class.
This way, we don't need to create a new Allele for every read/Haplotype pair to be placed in the PerReadAlleleLikelihoodMap (very inefficient).  Also, now we can easily get the Haplotype associated with the best allele for a given read.
2013-01-15 11:36:20 -05:00
Mark DePristo 3c37ea014b Retire original TraverseActiveRegion, leaving only the new optimized version
-- Required some updates to MD5s, which was unexpected, and will be sorted out later with more detailed unit tests
2013-01-15 10:24:45 -05:00
Eric Banks 94800771e3 1. Initial implementation of bam writing for the HaplotypeCaller with -bam argument; currently only assembled haplotypes are emitted.
2. Framework is set up in the VariantAnnotator for the HaplotypeCaller to be able to call in to annotate dbSNP plus comp RODs.  Until the HC uses meta data though, this won't work.
2013-01-15 10:19:18 -05:00
Chris Hartl 682c59ff04 Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-14 13:27:34 -05:00
Chris Hartl 61bc334df1 Ensure output table formatting does not contain NaNs. For (0 eval ref calls)/(0 comp ref calls), set the proportion to 0.00.
Added integration tests (checked against manual tabulation)
2013-01-14 09:21:30 -05:00
Ryan Poplin a7fe334a3f calculating the md5s for the new tests. 2013-01-11 15:43:52 -05:00
Ryan Poplin 65afec2a53 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-11 15:22:52 -05:00
Mark DePristo 85b529cced Updating MD5s in HC and UG that changed due to new LIBS
-- Resolved what was clearly a bug in UG (GGA mode was returning a neighboring, equivalent indel site that wasn't in input list.  Not ideal)
-- Trivial read count differences in HC
2013-01-11 15:17:19 -05:00
Mark DePristo 8b83f4d6c7 Near final cleanup of PileupElement
-- All functions documented and unit tested
-- New constructor interface
-- Cleanup some uses of old / removed functionality
2013-01-11 15:17:17 -05:00
Mark DePristo fb9eb3d4ee PileupElement and LIBS cleanup
-- function to create pileup elements in AlignmentStateMachine and LIBS
-- Cleanup pileup element constructors, directing users to LIBS.createPileupFromRead() that really does the right thing
2013-01-11 15:17:17 -05:00
Mark DePristo cc1d259cac Implement get Length and Bases of OfImmediatelyFollowingIndel in PileupElement
-- Added unit tests for this behavior.  Updated users of this code
2013-01-11 15:17:17 -05:00
Mark DePristo 2c38310868 Create LIBS using new AlignmentStateMachine infrastructure
-- Optimizations to AlignmentStateMachine
-- Properly count deletions.  Added unit test for counting routines
-- AlignmentStateMachine.java is no longer recursive
-- Traversals now use new LIBS, not the old one
2013-01-11 15:17:17 -05:00
Mark DePristo b53286cc3c HaplotypeCaller mode to skip assembly and genotyping for performance testing
-- Added HCPerformance evaluation Qscript
-- Added some docs about one of the HC integration tests
-- HaplotypeCaller / ART performance evaluation script
2013-01-11 15:17:16 -05:00
Ryan Poplin e952296c10 Adding HC GGA integration test to cover duplicated input alleles. 2013-01-11 15:01:27 -05:00
Ryan Poplin 7f7f40f851 Adding additional HC GGA integration tests to cover more complicated input alleles. 2013-01-11 14:36:21 -05:00
Eric Banks 85baf71b39 Merged bug fix from Stable into Unstable 2013-01-11 11:05:27 -05:00
Eric Banks d78539774f Another RR bug: off by one error led to ArrayIndexOutOfBoundsException when working with multiple samples and the variant region ended 1 base after the end of the last read for a given sample. 2013-01-11 11:05:09 -05:00
Eric Banks 79b93f659c Merged bug fix from Stable into Unstable 2013-01-11 09:20:13 -05:00
Eric Banks 67fafbb625 Forgot an include 2013-01-11 09:19:46 -05:00
Eric Banks 6bf0cc32f9 When reducing multiple samples it is possible to try to close a region that for a given sample has no reads. Currently we'd NPE. Fixed. 2013-01-11 09:16:19 -05:00
Eric Banks e7906713d9 Moving some random walkers back to public as requested by Mark. Mauricio will the licenses get updated automatically? 2013-01-11 02:03:43 -05:00
Eric Banks 3a51823c2a Clean up imports 2013-01-10 23:35:01 -05:00