Commit Graph

1092 Commits (cfde6e72bf3c839e47f2ef932ceea6a7aeb8c13e)

Author SHA1 Message Date
Mark DePristo 40bc7d6a9c Bugfix for ReferenceConfidenceModel
-- In the case where there's some variation to assembly and evaluate but the resulting haplotypes don't result in any called variants, the reference model would exception out with "java.lang.IllegalArgumentException: calledHaplotypes must contain the refHaplotype".  Now we detect this case and emit the standard no variation output.
-- [delivers #54625060]
2013-08-06 16:00:32 -04:00
Ryan Poplin a46f633bd6 Fix for the VQSR visualization script with the new ordering of annotations. 2013-08-02 19:10:45 -04:00
Mauricio Carneiro 285ab2ac62 Better caching for the HaplotypeCaller
Problem
-------
Caching strategy is incompatible with the current sorting of the haplotypes, and is rendering the cache nearly useless.

Before the PairHMM updates, we realized that a lexicographically sorted list of haplotypes would optimize the use of the cache. This was only true until we've added the initial condition to the first row of the deletion matrix, which depends on the length of the haplotype. Because of that, every time the haplotypes differ in length, the cache has to be wiped. A lexicographic sorting of the haplotypes will put different lengths haplotypes clustered together therefore wasting *tons* of re-compute.

Solution
-------
Very simple. Sort the haplotypes by LENGTH and then in lexicographic order.
2013-08-02 01:27:29 -04:00
Eric Banks 1e396af4d0 Two reduce reads updates/fixes:
1. Removing old legacy code that was capping the positional depth for reduced reads to 127.

Unfortunately this cap affectively performs biased down-sampling and throws off e.g. FS numbers.
Added end to end unit test that depth counts in RR can be higher than max byte.

Some md5s change in the RR tests because depths are now (correctly) no longer capped at 127.

2. Down-sampling in ReduceReads was not safe as it could remove het compressed consensus reads.

Refactored it so that it can only remove non-consensus reads.
2013-08-01 14:34:59 -04:00
Ryan Poplin 4f3411f3d4 Max number of haplotypes to evaluate no longer grows unbounded with the number of samples. This is necessary for multi-sample calling projects with over 100 samples. 2013-07-31 10:48:55 -04:00
Yossi Farjoun 284176cd7b moved SnpEffUtilUnitTest to public tree 2013-07-30 17:51:40 -04:00
droazen b8709b1942 Merge pull request #332 from broadinstitute/st_fpga_hmm
FPGA support for PairHMM
2013-07-30 14:21:21 -07:00
Joseph Rose d2860a5486 Adding a representation of the hierarchy of flags output by snpEff (Yossi) and a stratifier whose output states are coding regions, genes, stop_gain, stop_lost and splice sites, all determined by the snpEff hierarchy (J. Rose) 2013-07-30 15:38:32 -04:00
Mauricio Carneiro 7b731dd596 Removed native method call
and fixed indentation.
2013-07-30 13:59:58 -04:00
Geraldine Van der Auwera edbd17b8e0 Added note of caution to VQSR gatkdocs for option BOTH of recalibration mode 2013-07-26 15:51:29 -04:00
Ryan Poplin f52196496d Merge pull request #347 from broadinstitute/eb_more_dnagling_tail_improvements
More specific fix for the dangling tail edge case with a single leading deletion.
2013-07-26 07:25:47 -07:00
Ryan Poplin 8c205dda1b Automatically order the annotation dimensions in the VQSR by their standard deviation instead of the order they were specified on the command line. 2013-07-26 10:22:43 -04:00
Eric Banks 9372c5ef41 Merge pull request #334 from broadinstitute/mc_generic_input_for_qualify_missing_intervals
QualifyMissingIntervals: support different formats
2013-07-25 12:39:26 -07:00
sathibault 71eb944e62 Adding CnyPairHMMUnitTest 2013-07-25 14:19:50 -05:00
Eric Banks 5dfa863caa Fully stranded implementation of RR (plus bug fix for insertions and het compression).
Now only filtered reads are unstranded.  All consensus reads have strand, so that we
emit 2 consensus reads in general now: one for each strand.

This involved some refactoring of the sliding window which cleaned it up a lot.

Also included is a bug fix:
insertions downstream of a variant region weren't triggering a stop to the compression.
2013-07-25 14:48:53 -04:00
Eric Banks 0a2b5ddadf More specific fix for the dangling tail edge case with a single leading deletion.
The previous fix was too general (and therefore incorrect) and caused the HC to exception out.
Added "unit" test for this exact case.
2013-07-25 12:24:46 -04:00
Mauricio Carneiro 31ab0824b1 quick indentation fixes to FPGA code 2013-07-24 14:09:49 -04:00
Eric Banks 6df43f730a Fixing ReadBackedPileup to represent mapping qualities as ints, not (signed) bytes.
Having them as bytes caused problems for downstream programmers who had data with high MQs.
2013-07-23 23:47:15 -04:00
Guillermo del Angel 9dd109b79a Last feature request from Reich/Paavo labs: the allSitePLs feature in UG worked but not quite filled requirements. What's needed is the ability to have all 10 PLs for EVERY site, regardless of whether they are variant or not. Previous version only emitted the 10 PLs in reference sites. Problem is that, if all PLs are emitted in all sites and every single site is quad-allelic (only way to have the PLs printed out in a valid way) then the ability to filter variants and to use the INFO fields may be compromised.
So, compromise solution is to go back to having biallelic PLs but emit a new FORMAT field, called APL, which has the 10 values, but all other statistics and regular PLs are computed as before.
Note that integration test had to be disabled, as the BCF2 codec apparently doesn't support writing into genotype fields other than PL,DP,AD,GQ,FT and GT.
2013-07-18 12:54:52 -04:00
Scott Thibault 5d198d3400 Added write to likelihoods.txt for batch hmm 2013-07-15 10:16:39 -05:00
sathibault 0a8f75b953 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
2013-07-15 08:17:32 -05:00
Mauricio Carneiro 8c07614321 QualifyMissingIntervals: support different formats
Problem
-------
Qualify Missing Intervals only accepted GATK formatted interval files for it's coding sequence and bait parameters.

Solution
-------
There is no reason for such limitation, I erased all the code that did the parsing and used IntervalUtils to parse it (therefore, now it handles any type of interval file that the GATK can handle).

ps: Also added an average depth column to the output
2013-07-12 17:32:53 -04:00
Yossi Farjoun afcf7b96db - Added per-sample AlleleBiasedDownsampling capability to HaplotypeCaller
- Added integration test to show that providing a contamination value and providing same value via a file results in the same VCF

- overrode default contamination value in test
2013-07-12 16:22:02 -04:00
Eric Banks b16c7ce050 A whole slew of improvements to the Haplotype Caller and related code.
1. Some minor refactorings and claenup (e.g. removing unused imports) throughout.

2. Updates to the KB assessment functionality:
   a. Exclude duplicate reads when checking to see whether there's enough coverage to make a call.
   b. Lower the threshold on FS for FPs that would easily be filtered since it's only single sample calling.

3. Make the HC consistent in how it treats the pruning factor.  As part of this I removed and archived
   the DeBruijn assembler.

4. Improvements to the likelihoods for the HC
   a. We now include a "tristate" correction in the PairHMM (just like we do with UG).  Basically, we need
      to divide e by 3 because the observed base could have come from any of the non-observed alleles.
   b. We now correct overlapping read pairs.  Note that the fragments are not merged (which we know is
      dangerous).  Rather, the overlapping bases are just down-weighted so that their quals are not more
      than Q20 (or more specifically, half of the phred-scaled PCR error rate); mismatching bases are
      turned into Q0s for now.
   c. We no longer run contamination removal by default in the UG or HC.  The exome tends to have real
      sites with off kilter allele balances and we occasionally lose them to contamination removal.

5. Improved the dangling tail merging implementation.
2013-07-12 10:09:10 -04:00
sathibault 23fe3e449a Revert "Fixed batching bug."
This reverts commit 3e56c83d0eec7c374e5f187d1ef124d42ecc071e.
2013-07-11 11:30:37 -05:00
sathibault 7458b59bb3 Fixed batching bug. 2013-07-11 11:08:46 -05:00
Menachem Fromer a8ea57df9e Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-07-10 16:44:35 -04:00
Guillermo del Angel aba55dbb23 Moved some HC parameters related to active region extensions to command line arguments so that they're more easily modified. Some of these parameters need tinkering in order to call some large indels. See GSA-891 and subtasks for particular examples thereof. 2013-07-10 14:31:10 -04:00
Eric Banks 73fc7f6ab1 Reduce Reads output should never be expected to be sorted (hence the need to sort on disk) but for some reason it was with -nwayout mode. 2013-07-08 10:33:36 -04:00
Eric Banks 5f5c90e65c Fix bug introduced recently in the VariantAnnotator where only the last -comp was being annotated at a site.
Trivial fix, added integration test to cover it.
2013-07-05 00:04:52 -04:00
Mark DePristo 5f34054cc1 Remove filtering of MAPQ 0 reads from CalledHaplotypeBAMWriter 2013-07-02 15:46:49 -04:00
Mark DePristo ed0b1c5aba Fix bug in ReadThreadingAssembler in cycle failures causing NPE 2013-07-02 15:46:48 -04:00
Mark DePristo e3e8631ff5 Working version of HaplotypeCaller ReferenceConfidenceModel that accounts for indels as well as SNP confidences
-- Assembly graph building now returns an object that describes whether the graph was successfully built and has variation, was succesfully built but didn't have variation, or truly failed in construction.  Fixing an annoying bug where you'd prefectly assembly the sequence into the reference graph, but then return a null graph because of this, and you'd increase your kmer because it null was also used to indicate assembly failure
--
-- Output format looks like:
20      10026072        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026073        .       A       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,119
20      10026074        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,121
20      10026075        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,119
20      10026076        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026077        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026078        .       C       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:5,0:5:15:0,15,217
20      10026079        .       A       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:6,0:6:18:0,18,240
20      10026080        .       G       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:6,0:6:18:0,18,268
20      10026081        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:7,0:7:21:0,21,267

We use a symbolic allele to indicate that the site is hom-ref, and because we have an ALT allele we can provide AD and PL field values.  Currently these are calculated as ref vs. any non-ref value (mismatch or insertion) but doesn't yet account properly for alignment uncertainty.
-- Can we enabled for single samples with --emitRefConfidence (-ERC).
-- This is accomplished by realigning the each read to its most likley haplotype, and then evaluting the resulting pileups over the active region interval.  The realignment is done by the HaplotypeBAMWriter, which now has a generalized interface that lets us provide a ReadDestination object so we can capture the realigned reads
-- Provide access to the more raw LocusIteratorByState constructor so we can more easily make them programmatically without constructing lots of misc. GATK data structures.  Moved the NO_DOWNSAMPLING constant from LIBSDownsamplingInfo to LocusIteratorByState so clients can use it without making LIBSDownsamplingInfo a public class.
-- Includes GVCF writer
-- Add 1 mb of WEx data to private/testdata
-- Integration tests for reference model output for WGS and WEx data
-- Emit GQ block information into VCF header for GVCF mode
-- OutputMode from StandardCallerArgumentCollection moved to UnifiedArgumentCollection as its no longer relevant for HC
-- Control max indel size for the reference confidence model from the command line.  Increase default to 10
-- Don't use out_mode in HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest
-- Unittests for ReferenceConfidenceModel
-- Unittests for new MathUtils functions
2013-07-02 15:46:38 -04:00
Mark DePristo 41aba491c0 Critical bugfix for adapter clipping in HaplotypeCaller
-- The previous code would adapter clip before reverting soft clips, so because we only clip the adapter when it's actually aligned (i.e., not in the soft clips) we were actually not removing bases in the adapter unless at least 1 bp of the adapter was aligned to the reference.  Terrible.
-- Removed the broken logic of determining whether a read adaptor is too long.
-- Doesn't require isProperPairFlag to be set for a read to be adapter clipped
-- Update integration tests for new adapter clipping code
2013-07-02 15:46:36 -04:00
Scott Thibault 82dcdc01c0 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java
2013-06-28 10:13:05 -05:00
Scott Thibault e691fa3e19 FPGA null pointer bug fix 2013-06-28 08:52:09 -05:00
Ryan Poplin 825b603acb Merge pull request #298 from broadinstitute/md_likelihood_rank_sum
Md likelihood rank sum
2013-06-27 11:14:25 -07:00
Mark DePristo a514dd0643 Merge pull request #307 from broadinstitute/eb_rr_off_by_one_error
Proper fix for previous RR -cancer_mode fix.
2013-06-26 13:02:23 -07:00
Eric Banks 876e40466a Proper fix for previous RR -cancer_mode fix.
I "fixed" this once before but instead of testing with unit tests I used integration tests.
Bad decision.

The proper fix is in now, with a bonafide unit test included.
2013-06-26 14:48:09 -04:00
Eric Banks f242be12c0 Make this walker @Hidden 2013-06-26 11:45:21 -04:00
Mark DePristo ff76d0c877 Merge pull request #304 from broadinstitute/eb_rr_header_negative_fix_again
Fixing the 'header is negative' problem in Reduce Reads... again.
2013-06-24 11:55:52 -07:00
Eric Banks 165b936fcd Fixing the 'header is negative' problem in Reduce Reads... again.
Previous fixes and tests only covered trailing soft-clips.  Now that up front
hard-clipping is working properly though, we were failing on those in the tool.

Added a patch for this as well as a separate test independent of the soft-clips
to make sure that it's working properly.
2013-06-24 14:06:21 -04:00
Valentin Ruano-Rubio b97f9a487d Merged bug fix from Stable into Unstable 2013-06-24 14:00:01 -04:00
Mark DePristo 191e4ca251 Merge pull request #300 from broadinstitute/mc_move_qualify_intervals_to_protected
Few bug fixes to this tool now that it is in protected
2013-06-24 09:35:45 -07:00
Valentin Ruano-Rubio 3e5ff6095f Added the pertinent DocumentedGATKFeature annotation ot AnalyzeCovariates 2013-06-21 17:02:26 -04:00
Eric Banks d976aae2b1 Another fix for the Indel Realigner that arises because of secondary alignments.
This time we don't accidentally drop reads (phew), but this bug does cause us not to
update the alignment start of the mate.  Fixed and added unit test to cover it.
2013-06-21 16:59:22 -04:00
Mark DePristo 8caf39cb65 Experimental LikelihoodRankSum annotation
-- Added experimental LikelihoodRankSum, which required slightly more detailed access to the information managed by the base class, so added an overloaded getElementForRead also provides access to the MostLikelyAllele class
-- Added base class default implementation of getElementForPileupElement() which returns null, indicating that the pileup version isn't supported.
-- Added @Override to many of the RankSum classes for safety's sake

-- Updates to GeneralCallingPipeline: annotate sites with dbSNP IDs,
-- R script to assess the value of annotations for VQSR
2013-06-21 13:57:11 -04:00
Mark DePristo f726d8130a VariantRecalibrator bugfix for bad log10sumlog10 values
-- The VR, when the model is bad, may evaluate log10sumlog10 where some of the values in the vector are NaN. This case is now trapped in VR and handled as previously -- indicating that the model has failed and evaluation continues.
2013-06-21 12:28:53 -04:00
Mark DePristo dee51c4189 Error out when NCT and BAMOUT are used with the HaplotypeCaller
-- Currently we don't support writing a BAM file from the haplotype caller when nct is enabled.  Check in initialize if this is the case, and throw a UserException
2013-06-21 09:25:57 -04:00
Mark DePristo fdfe4e41d5 Better GATK version and command line output
-- Previous version emitted command lines that look like:

##HaplotypeCaller="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] ..."

the new version provides additional information on when the GATK was run and the GATK version in a nicer format:

 ##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] read_buffer_size=null phone_home=AWS ...">

 -- Additionally, the command line options are emitted sequentially in the file, so you can see a running record of how a VCF was produced, such as this example from the integration test:

 ##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="lots of stuff">
 ##GATKCommandLine=<ID=SelectVariants,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:16:23 EDT 2013",Epoch=1371741383277,CommandLineOptions="lots of stuff">

 -- Removed the ProtectedEngineFeaturesIntegrationTest
 -- Actual unit tests for these features!
2013-06-20 11:19:13 -04:00
sathibault 3db8908ae8 Remove debug print statement 2013-06-20 08:28:58 -05:00
Mark DePristo 0672ac5032 Fix public / protected dependency 2013-06-19 19:42:09 -04:00
Valentin Ruano-Rubio 1f8282633b Removed plots generation from the BaseRecalibration software
Improved AnalyzeCovariates (AC) integration test.
Renamed AC test files ending with .grp to .table

Implementation:

* Removed RECAL_PDF/CSV_FILE from RecalibrationArgumentCollection (RAC). Updated rest of the code accordingly.
* Fixed BQSRIntegrationTest to work with new changes
2013-06-19 14:47:56 -04:00
Valentin Ruano-Rubio 08f92bb6f9 Added AnalyzeCovariates tool to generate BQSR assessment quality plots.
Implemtation details:

* Added tool class *.AnalyzeCovariates
* Added convenient addAll method to Utils to be able to add elements of an array.
* Added parameter comparison methods to RecalibrationArgumentCollection class in order to verify that multiple imput recalibration report are compatible and comparable.
* Modified the BQSR.R script to handle up to 3 different recalibration tables (-BQSR, -before and -after) and removed some irrelevant arguments (or argument values) from the output.
* Added an integration test class.
2013-06-19 14:38:02 -04:00
Guillermo del Angel f176c854c6 Swapping in logless Pair HMM for default usage with UG:
-- Changed default HMM model.
-- Removed check.
-- Changed md5's: PL's in the high 100s change by a point or two due to new implementation.
-- Resulting performance improvement is about 30 to 50% less runtime when using -glm INDEL.
2013-06-18 10:06:27 -04:00
Ryan Poplin 8511c4385c Adding new pruning parameter to ReadThreadingAssembler
-- numPruningSamples allows one to specify that the minPruning factor must be met by this many samples for a path to be considered good (e.g. seen twice in three samples). By default this is just one sample.
-- adding unit test to test this new functionality
2013-06-17 16:46:40 -04:00
Guillermo del Angel f6025d25ae Feature requested by Reich lab and Paavo lab in Leipzig for ancient DNA processing:
-- When doing cross-species comparisons and studying population history and ancient DNA data, having SOME measure of confidence is needed at every single site that doesn't depend on the reference base, even in a naive per-site SNP mode. Old versions of GATK provided GQ and some wrong PL values at reference sites but these were wrong. This commit addresses this need by adding a new UG command line argument, -allSitePLs, that, if enabled will:
a) Emit all 3 ALT snp alleles in the ALT column.
b) Emit all corresponding 10 PL values.
It's up to the user to process these PL values downstream to make sense of these. Note that, in order to follow VCF spec, the QUAL field in a reference call when there are non-null ALT alleles present will be zero, so QUAL will be useless and filtering will need to be done based on other fields.
-- Tweaks and fixes to processing pipelines for Reich lab.
2013-06-17 13:21:09 -04:00
delangel 485ceb1e12 Merge pull request #283 from broadinstitute/md_beagleoutput
Simpler FILTER and info field encoding for BeagleOutputToVCF
2013-06-17 09:31:03 -07:00
Eric Banks e48f754478 Fixes to several of the annotations for reduced reads (and other issues).
1. Have the RMSMappingQuality annotation take into account the fact that reduced reads represent multiple reads.

2. The rank sume tests should not be using reduced reads (because they do not represent distinct observations).

3. Fixed a massive bug in the BaseQualityRankSumTest annotation!  It was not using the base qualities but rather
the read likelihoods?!

Added a unit test for Rank Sum Tests to prove that the distributions are correctly getting assigned appropriate p-values.
Also, and just as importantly, the test shows that using reduced reads in the rank sum tests skews the results and
makes insignificant distributions look significant (so it can falsely cause the filtering of good sites).

Also included in this commit is a massive refactor of the RankSumTest class as requested by the reviewer.
2013-06-16 01:18:20 -04:00
Mark DePristo 1677a0a458 Simpler FILTER and info field encoding for BeagleOutputToVCF
-- Previous version created FILTERs for each possible alt allele when that site was set to monomorphic by BEAGLE.  So if you had a A/C SNP in the original file and beagle thought it was AC=0, then you'd get a record with BGL_RM_WAS_A in the FILTER field.  This obviously would cause problems for indels, as so the tool was blowing up in this case.  Now beagle sets the filter field to BGL_SET_TO_MONOMORPHIC and sets the info field annotation OriginalAltAllele to A instead.  This works in general with any type of allele.
 -- Here's an example output line from the previous and current versions:
 old: 20    64150   rs7274499       C       .       3041.68 BGL_RM_WAS_A    AN=566;DB;DP=1069;Dels=0.00;HRun=0;HaplotypeScore=238.33;LOD=3.5783;MQ=83.74;MQ0=0;NumGenotypesChanged=1;OQ=1949.35;QD=10.95;SB=-6918.88
 new: 20    64062   .       G       .       100.39  BGL_SET_TO_MONOMORPHIC  AN=566;DP=1108;Dels=0.00;HRun=2;HaplotypeScore=221.59;LOD=-0.5051;MQ=85.69;MQ0=0;NumGenotypesChanged=1;OQ=189.66;OriginalAltAllele=A;QD=15.81;SB=-6087.15
-- update MD5s to reflect these changes
-- [delivers #50847721]
2013-06-14 15:56:13 -04:00
Mark DePristo dd5674b3b8 Add genotyping accuracy assessment to AssessNA12878
-- Now table looks like:

Name     VariantType  AssessmentType           Count
variant  SNPS         TRUE_POSITIVE              1220
variant  SNPS         FALSE_POSITIVE                0
variant  SNPS         FALSE_NEGATIVE                1
variant  SNPS         TRUE_NEGATIVE               150
variant  SNPS         CALLED_NOT_IN_DB_AT_ALL       0
variant  SNPS         HET_CONCORDANCE          100.00
variant  SNPS         HOMVAR_CONCORDANCE        99.63
variant  INDELS       TRUE_POSITIVE               273
variant  INDELS       FALSE_POSITIVE                0
variant  INDELS       FALSE_NEGATIVE               15
variant  INDELS       TRUE_NEGATIVE                79
variant  INDELS       CALLED_NOT_IN_DB_AT_ALL       2
variant  INDELS       HET_CONCORDANCE           98.67
variant  INDELS       HOMVAR_CONCORDANCE        89.58

-- Rewrite / refactored parts of subsetDiploidAlleles in GATKVariantContextUtils to have a BEST_MATCH assignment method that does it's best to simply match the genotype after subsetting to a set of alleles.  So if the original GT was A/B and you subset to A/B it remains A/B but if you subset to A/C you get A/A.  This means that het-alt B/C genotypes become A/B and A/C when subsetting to bi-allelics which is the convention in the KB.  Add lots of unit tests for this functions (from 0 previously)
-- BadSites in Assessment now emits TP sites with discordant genotypes with the type GENOTYPE_DISCORDANCE and tags the expected genotype in the info field as ExpectedGenotype, such as this record:

20      10769255        .       A       ATGTG   165.73  .       ExpectedGenotype=HOM_VAR;SupportingCallsets=ebanks,depristo,CEUTrio_best_practices;WHY=GENOTYPE_DISCORDANCE     GT:AD:DP:GQ:PL  0/1:1,9:10:6:360,0,6

Indicating that the call was a HET but the expected result was HOM_VAR
-- Forbid subsetting of diploid genotypes to just a single allele.
-- Added subsetToRef as a separate specific function.  Use that in the DiploidExactAFCalc in the case that you need to reduce yourself to ref only. Preserves DP in the genotype field when this is possible, so a few integration tests have changed for the UG
2013-06-13 15:05:32 -04:00
Mark DePristo 33720b83eb No longer merge overlapping fragments from HaplotypeCaller
-- Merging overlapping fragments turns out to be a bad idea.  In the case where you can safely merge the reads you only gain a small about of overlapping kmers, so the potential gains are relatively small.  That's in contrast to the very large danger of merging reads inappropriately, such as when the reads only overlap in a repetitive region, and you artificially construct reads that look like the reference but actually may carry a larger true insertion w.r.t. the reference.  Because this problem isn't limited to repetitive sequeuence, but in principle could occur in any sequence, it's just not safe to do this merging.  Best to leave haplotype construction to the assembly graph.
2013-06-13 15:05:32 -04:00
Mark DePristo c837d67b2f Merge pull request #273 from broadinstitute/rp_readIsPoorlyModelled
Relaxing the constraints on the readIsPoorlyModelled function.
2013-06-13 08:40:24 -07:00
Ryan Poplin f44efc27ae Relaxing the constraints on the readIsPoorlyModelled function.
-- Turns out we were aggressively throwing out borderline-good reads.
2013-06-13 11:06:23 -04:00
Ryan Poplin d5f0848bd5 HC bam writer now sets the read to MQ0 if it isn't informative
-- Makes visualization of read evidence easier in IGV.
2013-06-13 10:11:54 -04:00
sathibault 336050ab71 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java
2013-06-13 07:28:24 -05:00
Ryan Poplin d1f397c711 Fixing bug with dangling tails in which the tail connects all the way back to the reference source node.
-- List of vertices can't contain a source node.
2013-06-12 12:23:01 -04:00
Ryan Poplin e1fd3dff9a Merge pull request #268 from broadinstitute/eb_calling_accuracy_improvements_to_HC
Eb calling accuracy improvements to hc
2013-06-11 11:18:51 -07:00
Eric Banks 2c3c680eb7 Misc changes and cleanup from all previous commits in this push.
1. By default, do not include the UG CEU callset for assessment.
2. Updated md5s that are different now with all the HC changes.
2013-06-11 12:53:11 -04:00
Eric Banks dadcfe296d Reworking of the dangling tails merging code.
We now run Smith-Waterman on the dangling tail against the corresponding reference tail.
If we can generate a reasonable, low entropy alignment then we trigger the merge to the
reference path; otherwise we abort.  Also, we put in a check for low-complexity of graphs
and don't let those pass through.

Added tests for this implementation that checks exact SW results and correct edges added.
2013-06-11 12:53:04 -04:00
Guillermo del Angel 55d5f2194c Read Error Corrector for haplotype assembly
Principle is simple: when coverage is deep enough, any single-base read error will look like a rare k-mer but correct sequence will be supported by many reads to correct sequences will look like common k-mers. So, algorithm has 3 main steps:
1. K-mer graph buildup.
For each read in an active region, a map from k-mers to the number of times they have been seen is built.
2. Building correction map.
All "rare" k-mers that are sparse (by default, seen only once), get mapped to k-mers that are good (by default, seen at least 20 times but this is a CL argument), and that lie within a given Hamming distance (by default, =1). This map can be empty (i.e. k-mers can be uncorrectable).
3. Correction proposal
For each constituent k-mer of each read, if this k-mer is rare and maps to a good k-mer, get differing base positions in k-mer and add these to a list of corrections for each base in each read. Then, correct read at positions where correction proposal is unanimous and non-empty.

The algorithm defaults are chosen to be very stringent and conservative in the correction: we only try to correct singleton k-mers, we only look for good k-mers lying at Hamming distance = 1 from them, and we only correct a base in read if all correction proposals are congruent.

By default, algorithm is disabled but can be enabled in HaplotypeCaller via the -readErrorCorrect CL option. However, at this point it's about 3x-10x more expensive so it needs to be optimized if it's to be used.
2013-06-11 12:26:24 -04:00
Eric Banks c0030f3f2d We no longer subset down to the best N haplotypes for the GL calculation.
I explain in comments within the code that this was causing problems with the marginalization over events.
2013-06-11 11:51:26 -04:00
Eric Banks c0e3874db0 Change the HC's phredScaledGlobalReadMismappingRate from 60 to 45, because Ryan and Mark told me to. 2013-06-11 11:51:26 -04:00
Eric Banks 77868d034f Do not allow the use of Ns in reads for graph construction.
Ns are treated as wildcards in the PairHMM so creating haplotypes with Ns gives them artificial advantages over other ones.
This was the cause of at least one FN where there were Ns at a SNP position.
2013-06-11 11:51:26 -04:00
Eric Banks e4e7d39e2c Fix FN problem stemming from sequence graphs that contain cycles.
Problem:
The sequence graphs can get very complex and it's not enough just to test that any given read has non-unique kmers.
Reads with variants can have kmers that match unique regions of the reference, and this causes cycles in the final
sequence graph.  Ultimately the problem is that kmers of 10/25 may not be large enough for these complex regions.

Solution:
We continue to try kmers of 10/25 but detect whether cycles exist; if so, we do not use them.  If (and only if) we
can't get usable graphs from the 10/25 kmers, then we start iterating over larger kmers until we either can generate
a graph without cycles or attempt too many iterations.
2013-06-11 11:51:26 -04:00
Ryan Poplin 58e354176e Minor changes to docs in the graph pruning. 2013-06-11 10:33:22 -04:00
Mark DePristo 1c03ebc82d Implement ActiveRegionTraversal RefMetaDataTracker for map call; HaplotypeCaller now annotates ID from dbSNP
-- Reuse infrastructure for RODs for reads to implement general IntervalReferenceOrderedView so that both TraverseReads and TraverseActiveRegions can use the same underlying infrastructure
-- TraverseActiveRegions now provides a meaningful RefMetaDataTracker to ActiveRegionWalker.map
-- Cleanup misc. code as it came up
-- Resolves GSA-808: Write general utility code to do rsID allele matching, hook up to UG and HC
2013-06-10 16:20:31 -04:00
Mark DePristo 0d593cff70 Refactor rsID and overlap detection in VariantOverlapAnnotator utility class
-- Variants will be considered matching if they have the same reference allele and at least 1 common alternative allele.  This matching algorithm determines how rsID are added back into the VariantContext we want to annotate, and as well determining the overlap FLAG attribute field.
-- Updated VariantAnnotator and VariantsToVCF to use this class, removing its old stale implementation
-- Added unit tests for this VariantOverlapAnnotator class
-- Removed GATKVCFUtils.rsIDOfFirstRealVariant as this is now better to use VariantOverlapAnnotator
-- Now requires strict allele matching, without any option to just use site annotation.
2013-06-10 15:51:13 -04:00
Mauricio Carneiro 1d67d07cf1 better docs for Qualify Missing Intervals
now that it's available to the public, better give'em good docs!
2013-06-10 15:17:40 -04:00
Mauricio Carneiro c84f0deb1d Don't crash if cds file is not provided
CDS file should be optional.
2013-06-10 13:42:00 -04:00
Mauricio Carneiro a95fbd48e5 Moving QualifyMissingIntervals to protected
Making this walker available so we can share it with the CSER group for CLIA analysis.
2013-06-10 13:11:41 -04:00
Valentin Ruano-Rubio 96073c3058 This commit addresses JIRA issue GSA-948: Prevent users from doing the wrong thing with RNA-Seq data and the GATK.
The previous behavior is to process reads with N CIGAR operators as they are despite that many of the tools do not actually support such operator and results become unpredictible.

Now if the there is some read with the N operator, the engine returns a user exception. The error message indicates what is the problem (including the offending read and mapping position) and give a couple of alternatives that the user can take in order to move forward:

a) ask for those reads to be filtered out (with --filter_reads_with_N_cigar or -filterRNC)

b) keep them in as before (with -U ALLOW_N_CIGAR_READS or -U ALL)

Notice that (b) does not have any effect if (a) is enacted; i.e. filtering overrides ignoring.

Implementation:

* Added filterReadsWithMCigar argument to MalformedReadFilter with the corresponding changes in the code to get it to work.
* Added ALLOW_N_CIGAR_READS unsafe flag so that N cigar containing reads can be processed as they are if that is what the user wants.
* Added ReadFilterTest class commont parent for ReadFilter test cases.
* Refactor ReadGroupBlackListFilterUnitTest to extend ReadFilterTest and push up some functionality to that class.
* Modified MalformedReadFilterUnitTest to extend ReadFilterTest and to test the new filter functionality.
* Added AllowNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALLOW_N_CIGAR_READS flag is used.
* Added UnsafeNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALL flag is used.
* Updated a broken test case in UnifiedGenotyperIntegrationTest resulting from the new behavior.
* Updated EngineFeaturesIntegrationTest testdata to be compliant with new behavior
2013-06-10 10:44:42 -04:00
Michael McCowan 00c06e9e52 Performance improvements:
- Memoized MathUtil's cumulative binomial probability function.
 - Reduced the default size of the read name map in reduced reads and handle its resets more efficiently.
2013-06-09 11:26:52 -04:00
Mark DePristo 209dd64268 HaplotypeCaller now emits per-sample DP
-- Created a new annotation DepthPerSampleHC that is by default on in the HaplotypeCaller
-- The depth for the HC is the sum of the informative alleles at this site.  It's not perfect (as we cannot differentiate between reads that align over the event but aren't informative vs. those that aren't even close) but it's a pretty good proxy and it matches with the AD field (i.e., sum(AD) = DP).
-- Update MD5s
-- delivers [#48240601]
2013-06-06 09:47:32 -04:00
Mark DePristo 34bdf20132 Bugfix for bad AD values in UG/HC
-- In the case where we have multiple potential alternative alleles *and* we weren't calling all of them (so that n potential values < n called) we could end up trimming the alleles down which would result in the mismatch between the PerReadAlleleLikelihoodMap alleles and the VariantContext trimmed alleles.
-- Fixed by doing two things (1) moving the trimming code after the annotation call and (2) updating AD annotation to check that the alleles in the VariantContext and the PerReadAlleleLikelihoodMap are concordant, which will stop us from degenerating in the future.
-- delivers [#50897077]
2013-06-05 17:48:41 -04:00
Mark DePristo c9f5b53efa Bugfix for HC can fail to assemble the correct reference sequence in some cases
-- Ultimately this was caused by overly aggressive merging of CommonSuffixMerger.  In the case where you have this graph:

ACT [ref source] -> C
G -> ACT -> C

we would merge into

G -> ACT -> C

which would linearlize into

GACTC

Causing us to add bases to the reference source node that couldn't be recovered.  The solution was to ensure that CommonSuffixMerger only operates when all nodes to be merged aren't source nodes themselves.

-- Added a convenient argument to the haplotype caller (captureAssemblyFailureBAM) that will write out the exact reads to a BAM file that went into a failed assembly run (going to a file called AssemblyFailure.BAM).  This can be used to rerun the haplotype caller to produce the exact error, which can be hard in regions of deep coverage where the downsampler state determines the exact reads going into assembly and therefore makes running with a sub-interval not reproduce the error
-- Did some misc. cleanup of code while debugging
-- [delivers #50917729]
2013-06-03 16:16:39 -04:00
Ryan Poplin ab40f4af43 Break out the GGA kmers and the read kmers into separate functions for the DeBruijn assembler.
-- Added unit test for new function.
2013-06-03 14:00:35 -04:00
Ryan Poplin 21334e728d Merge pull request #252 from broadinstitute/md_bqsr_index_out_of_bounds
Make BQSR calculateIsIndel robust to indel CIGARs are start/end of read
2013-06-03 07:13:00 -07:00
sathibault de2a2a4cc7 Added command-line flag to disble FPGA
Completed integration with FPGA driver
2013-06-03 07:30:32 -05:00
Mark DePristo 6555361742 Fix error in merging code in HC
-- Ultimately this was caused by an underlying bug in the reverting of soft clipped bases in the read clipper.  The read clipper would fail to properly set the alignment start for reads that were 100% clipped before reverting, such as 10H2S5H => 10H2M5H.  This has been fixed and unit tested.
-- Update 1 ReduceReads MD5, which was due to cases where we were clipping away all of the MATCH part of the read, leaving a cigar like 50H11S and the revert soft clips was failing to properly revert the bases.
-- delivers #50655421
2013-05-31 16:29:29 -04:00
Mark DePristo 64b4d80729 Make BQSR calculateIsIndel robust to indel CIGARs are start/end of read
-- The previous implementation attempted to be robust to this, but not all cases were handled properly.  Added a helper function updateInde() that bounds up the update to be in the range of the indel array, and cleaned up logic of how the method works.  The previous behavior was inconsistent across read fwd/rev stand, so that the indel cigars at the end of read were put at the start of reads if the reads were in the forward strand but not if they were in the reverse strand.  Everything is now consistent, as can be seen in the symmetry of the unit tests:

        tests.add(new Object[]{"1D3M",   false, EventType.BASE_DELETION, new int[]{0,0,0}});
        tests.add(new Object[]{"1M1D2M", false, EventType.BASE_DELETION, new int[]{1,0,0}});
        tests.add(new Object[]{"2M1D1M", false, EventType.BASE_DELETION, new int[]{0,1,0}});
        tests.add(new Object[]{"3M1D",   false, EventType.BASE_DELETION, new int[]{0,0,1}});

        tests.add(new Object[]{"1D3M",   true, EventType.BASE_DELETION, new int[]{1,0,0}});
        tests.add(new Object[]{"1M1D2M", true, EventType.BASE_DELETION, new int[]{0,1,0}});
        tests.add(new Object[]{"2M1D1M", true, EventType.BASE_DELETION, new int[]{0,0,1}});
        tests.add(new Object[]{"3M1D",   true, EventType.BASE_DELETION, new int[]{0,0,0}});

        tests.add(new Object[]{"4M1I",   false, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
        tests.add(new Object[]{"3M1I1M", false, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
        tests.add(new Object[]{"2M1I2M", false, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});
        tests.add(new Object[]{"1M1I3M", false, EventType.BASE_INSERTION, new int[]{1,0,0,0,0}});
        tests.add(new Object[]{"1I4M",   false, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});

        tests.add(new Object[]{"4M1I",   true, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});
        tests.add(new Object[]{"3M1I1M", true, EventType.BASE_INSERTION, new int[]{0,0,0,0,1}});
        tests.add(new Object[]{"2M1I2M", true, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
        tests.add(new Object[]{"1M1I3M", true, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
        tests.add(new Object[]{"1I4M",   true, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});

-- delivers #50445353
2013-05-31 13:58:37 -04:00
Ryan Poplin b5b9d745a7 New implementation of the GGA mode in the HaplotypeCaller
-- We now inject the given alleles into the reference haplotype and add them to the graph.
-- Those paths are read off of the graph and then evaluated with the appropriate marginalization for GGA mode.
-- This unifies how Smith-Waterman is performed between discovery and GGA modes.
-- Misc minor cleanup in several places.
2013-05-31 10:35:36 -04:00
Ryan Poplin 61af37d0d2 Create a new normalDistributionLog10 function that is unit tested for use in the VQSR. 2013-05-30 16:00:08 -04:00
Eric Banks a5a68c09fa Fix for the "Removed too many insertions, header is now negative" bug in ReduceReads.
The problem ultimately was that ReadUtils.readStartsWithInsertion() ignores leading hard/softclips, but
ReduceReads does not.  So I refactored that method to include a boolean argument as to whether or not
clips should be ignored.  Also rebased so that return type is no longer a Pair.
Added unit test to cover this situation.
2013-05-29 16:41:01 -04:00
Mark DePristo 684c91c2e7 Merge pull request #245 from broadinstitute/dr_enforce_min_dcov
Require a minimum dcov value of 200 for Locus and ActiveRegion walkers when downsampling to coverage
2013-05-29 09:52:13 -07:00
David Roazen a7cb599945 Require a minimum dcov value of 200 for Locus and ActiveRegion walkers when downsampling to coverage
-Throw a UserException if a Locus or ActiveRegion walker is run with -dcov < 200,
 since low dcov values can result in problematic downsampling artifacts for locus-based
 traversals.

-Read-based traversals continue to have no minimum for -dcov, since dcov for read traversals
 controls the number of reads per alignment start position, and even a dcov value of 1 might
 be safe/desirable in some circumstances.

-Also reorganize the global downsampling defaults so that they are specified as annotations
 to the Walker, LocusWalker, and ActiveRegionWalker classes rather than as constants in the
 DownsamplingMethod class.

-The default downsampling settings have not been changed: they are still -dcov 1000
 for Locus and ActiveRegion walkers, and -dt NONE for all other walkers.
2013-05-29 12:07:12 -04:00
Mauricio Carneiro f1affa9fbb Turn off downsampling for DiagnoseTargets
Diagnose targets should never be downsampled. (and I didn't know there was a default downsampling going on for locus walkers)
2013-05-28 14:58:50 -04:00
Ryan Poplin 85905dba92 Bugfix for GGA mode in UG silently ignoring indels
-- Started by Mark. Finished up by Ryan.
-- GGA mode still respected glm argument for SNP and INDEL models, so that you would silently fail to genotype indels at all if the -glm INDEL wasn't provided, but you'd still emit the sites, so you'd see records in the VCF but all alleles would be no calls.
-- https://www.pivotaltracker.com/story/show/48924339 for more information
-- [resolves #48924339]
2013-05-24 13:47:26 -04:00
Mauricio Carneiro da21924b44 Make the missing targets output never use stdout
Problem
--------
Diagnose Targets is outputting missing intervals to stdout if the argument -missing is not provided

Solution
--------
Make it NOT default to stdout

[Delivers #50386741]
2013-05-22 14:22:54 -04:00
Mark DePristo d167743852 Archived banded logless PairHMM
BandedHMM
---------
-- An implementation of a linear runtime, linear memory usage banded logless PairHMM.  Thought about 50% faster than current PairHMM, this implementation will be superceded by the GraphHMM when it becomes available.  The implementation is being archived for future reference

Useful infrastructure changes
-----------------------------
-- Split PairHMM into a N2MemoryPairHMM that allows smarter implementation to not allocate the double[][] matrices if they don't want, which was previously occurring in the base class PairHMM
-- Added functionality (controlled by private static boolean) to write out likelihood call information to a file from inside of LikelihoodCalculationEngine for using in unit or performance testing.  Added example of 100kb of data to private/testdata.  Can be easily read in with the PairHMMTestData class.
-- PairHMM now tracks the number of possible cell evaluations, and the LoglessCachingPairHMM updates the nCellsEvaluated so we can see how many cells are saved by the caching calculation.
2013-05-22 12:24:00 -04:00
Mark DePristo a1093ad230 Optimization for ActiveRegion.removeAll
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion.  This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element.   New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set.  Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
2013-05-21 16:18:57 -04:00
Eric Banks 1f3624d204 Base Recalibrator doesn't recalibrate all reads, so the final output line was confusing 2013-05-21 11:35:05 -04:00
Valentin Ruano Rubio 71bbb25c9e Merge pull request #231 from broadinstitute/md_combinevariants_bugfix
CombineVariants no longer adds PASS to unfiltered records
2013-05-20 14:28:20 -07:00
Mark DePristo 62fc88f92e CombineVariants no longer adds PASS to unfiltered records
-- [Delivers #49876703]
-- Add integration test and test file
-- Update SymbolicAlleles combine variant tests, which was turning unfiltered records into PASS!
2013-05-20 16:53:51 -04:00
Ryan Poplin 507853c583 Active region boundary parameters need to be bigger when running in GGA mode. CGL performance is quite a bit better as a result.
-- The troule stems from the fact that we may be trying to genotype indels even though it appears there are only SNPs in the reads.
2013-05-20 14:29:04 -04:00
Eric Banks 8a442d3c9f @Output needs to be required for LiftoverVariants to prevent a NPE and documentation needed updating. 2013-05-17 10:04:10 -04:00
sathibault 195f0c3e98 Disable CnyPairHMM 2013-05-17 08:30:23 -05:00
Yossi Farjoun 9234a0efcd Merge pull request #223 from broadinstitute/mc_dt_gaddy_outputs
Bug fixes and missing interval functionality for Diagnose Targets

While the code seems fine, the complex parts of it are untested. This is probably fine for now, but private code can have a tendency to creep into the codebase once accepted. I would have preferred that unit test OR a big comment stating that the code is untested (and thus broken by Mark's rule).

It is with these cavets that I accept the pull request.
2013-05-16 09:25:54 -07:00
Chris Hartl 6da0aed30f Update GCIT md5s to account for trivial changes to description strings 2013-05-14 19:45:30 -04:00
Yossi Farjoun 409a202492 Merge pull request #214 from broadinstitute/chartl_genotype_concordance_diploid_and_OGC
Add overall genotype concordance to the genotype concordance tool. In ad...
2013-05-14 14:19:54 -07:00
Menachem Fromer de54223aed Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-14 10:15:21 -04:00
Mauricio Carneiro adcbf947bf Update MD5s and the Diagnose Target scala script 2013-05-13 12:06:17 -04:00
Mauricio Carneiro 9eceae793a Tool to manipulate intervals outside the GATK
Performs basic set operations on intervals like union, intersect and difference between two or more intervals. Useful for techdev and QC purposes.
2013-05-13 11:56:24 -04:00
Mauricio Carneiro 3dbb86b052 Outputting missing intervals in DiagnoseTargets
Problem
------
Diagnose Targets identifies holes in the coverage of a targetted experiment, but it only reports them doesn't list the actual missing loci

Solution
------
This commit implements an optional intervals file output listing the exact loci that did not pass filters

Itemized changes
--------------
   * Cache callable statuses (to avoid recalculation)
   * Add functionality to output missing intervals
   * Implement new tool to qualify the missing intervals (QualifyMissingIntervals) by gc content, size, type of missing coverage and origin (coding sequence, intron, ...)
2013-05-13 11:51:56 -04:00
Mauricio Carneiro 1466396a31 Diagnose target is outputting intervals out of order
Problem
-------
When the interval had no reads, it was being sent to the VCF before the intervals that just got processed, therefore violating the sort order of the VCF.

Solution
--------
Use a linked hash map, and make the insertion and removal all happen in one place regardless of having reads or not. Since the input is ordered, the output has to be ordered as well.

Itemized changes
--------------
   * Clean up code duplication in LocusStratification and SampleStratification
   * Add number of uncovered sites and number of low covered sites to the VCF output.
   * Add new VCF format fields
   * Fix outputting multiple status when threshold is 0 (ratio must be GREATER THAN not equal to the threshold to get reported)

[fixes #48780333]
[fixes #48787311]
2013-05-13 11:50:22 -04:00
Mark DePristo b4f482a421 NanoScheduled ActiveRegionTraversal and HaplotypeCaller
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
  -- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
  -- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
2013-05-13 11:09:02 -04:00
Eric Banks 2f5ef6db44 New faster Smith-Waterman implementation that is edge greedy and assumes that ref and haplotype have same global start/end points.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
   * A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
     right thing for indels at the edges of the alignments.
     * Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
   * Lots of systematic testing added for this implementation.
   * NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
2013-05-13 09:36:39 -04:00
Mark DePristo 111e8cef0f Merge pull request #219 from broadinstitute/eb_rr_multisample_fix
Fix bug in Reduce Reads that arises in multi-sample mode.
2013-05-09 15:31:14 -07:00
Eric Banks 8b9c6aae3e Fix bug in Reduce Reads that arises in multi-sample mode.
* bitset could legitimately be in an unfinished state but we were trying to access it without finalizing.
  * added --cancer_mode argument per Mark's suggestion to force the user to explicitly enable multi-sample mode.
  * tests were easiest to implement as integration tests (this was a really complicated case).
2013-05-08 23:23:51 -04:00
Mark DePristo fa8a47ceef Replace DeBruijnAssembler with ReadThreadingAssembler
Problem
-------
The DeBruijn assembler was too slow.  The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp).  This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.

Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers.  The algorithm operates as follows:

identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
  find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
  for each base in the sequence from the starting vertex kmer:
    look at the existing outgoing nodes of current vertex V.  If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
    If no matching next vertex exists, find a unique vertex with kmer K.  If one exists, merge the sequence into this vertex, and continue
    If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue

This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size.  This allows us to assemble well with even very short kmers.

This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:

-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples.  This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor.  This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization.  This change is essential for us to get good variants from our paths when the kmer size is small.  It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation.  Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary.  This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler

Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations.  This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate.  Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
2013-05-08 21:41:42 -04:00
sathibault d79b5f0931 Adding Convey HC-1 HMM acceleration 2013-05-08 11:01:20 -05:00
Eric Banks d242f1bba3 Secondary alignments were not handled correctly in IndelRealigner
* This is emerging now because BWA-MEM produces lots of reads that are not primary alignments
 * The ConstrainedMateFixingManager class used by IndelRealigner was mis-adjusting SAM flags because it
     was getting confused by these secondary alignments
 * Added unit test to cover this case
2013-05-06 19:09:10 -04:00
Eric Banks b53336c2d0 Added hidden mode for BQSR to force all read groups to be the same one.
* Very useful for debugging sample-specific issues
 * This argument got lost in the transition from BQSR v1 to v2
 * Added unit test to cover this case
2013-05-06 19:09:10 -04:00
Menachem Fromer c7dcc2b53b Fix to deal with multi-generational families being allowed if only one level (one 'trio', effectively) appears in the VCF 2013-05-06 15:47:27 -04:00
Menachem Fromer 86287dce76 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-06 13:52:55 -04:00
Menachem Fromer 13240588cf Fix to only consider the samples that are both in the PED file and in the VCF file 2013-05-06 13:52:14 -04:00
Chris Hartl 6ff74deac7 Add overall genotype concordance to the genotype concordance tool. In addition, protect from non-diploid genotypes, which can cause very strange behavior.
Update MD5 sums. As expected, md5 changes are consistent with the genotype concordance field being added to each output.
2013-05-06 13:06:30 -04:00
chartl 98021db264 Merge pull request #208 from broadinstitute/yf_fix_molten_GenotypeConcordance
- Fixed a small bug in the printout of molten data in GenotypeConcordanc...
2013-05-06 08:42:06 -07:00
Menachem Fromer 78e958bf39 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-06 10:39:21 -04:00
Guillermo del Angel 874dc8f9c1 Re-fix md5's that changed due to conflicting pushes 2013-05-03 14:59:16 -04:00
Mark DePristo f42bb86bdd e# This is a combination of 2 commits.
Only try to clip adaptors when both reads of the pair are on opposite strands

-- Read pairs that have unusual alignments, such as two reads both oriented like:

  <-----
     <-----

where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs.  This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
2013-05-03 11:19:14 -04:00
Mark DePristo 2bcbdd469f leftAlignCigarSequentially now supports haplotypes with insertions and deletions where the deletion allele was previously removed by the leftAlignSingleIndel during it's cleanup phase. 2013-05-03 09:32:05 -04:00
Guillermo del Angel 0c30a5ebc6 Rev'd up Picard to get PL fix: PLs were saturated to 32767 (Short.MAX_VALUE) when converting from GL to integers. Increase capping to Integer.MAX_VALUE (2^31-1) which should be enough for reasonable sites now. Integration tests change because some tests have some hyper-deep pileups where this case was hit 2013-05-02 16:31:43 -04:00
Yossi Farjoun 4b8b411b92 - Fixed a small bug in the printout of molten data in GenotypeConcordance
Output didn't "mix-up" the genotypes, it outputed the same HET vs HET (e.g.) 3 times rather than the combinations of HET vs {HET, HOM, HOM_REF}, etc.
This was only a problem in the text, _not_ the actual numbers, which were outputted correctly.

- Updated MD5's after looking at diffs to verify that the change is what I expected.
2013-05-02 09:16:07 -04:00
David Roazen f3c94a3c87 Update expected test output for Java 7
-Changes in Java 7 related to comparators / sorting produce a large number
 of innocuous differences in our test output. Updating expectations now
 that we've moved to using Java 7 internally.

-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
 intermittent failures.
2013-05-01 16:18:01 -04:00
Eric Banks 58424e56be Setting the reduce reads count tag was all wrong in a previous commit; fixing.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly.  Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.

The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly.  Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).

Also:
1. counts are now maintained as ints whenever possible.  Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
2013-04-30 13:45:42 -04:00
Guillermo del Angel 20d3137928 Fix for indel calling with UG in presence of reduced reads: When a read is long enough so that there's no reference context available, the reads gets clipped so that it falls again within the reference context range. However, the clipping is incorrect, as it makes the read end precisely at the end of the reference context coordinates. This might lead to a case where a read might span beyond the haplotype if one of the candidate haplotypes is shorter than the reference context (As in the case e.g. with deletions). In this case, the HMM will not work properly and the likelihood will be bad, since "insertions" at end of reads when haplotype is done will be penalized and likelihood will be much lower than it should.
-- Added check to see if read spans beyond reference window MINUS padding and event length. This guarantees that read will always be contained in haplotype.
-- Changed md5's that happen when long reads from old 454 data have their likelihoods changed because of the extra base clipping.
2013-04-29 19:33:02 -04:00
Mark DePristo 0387ea8df9 Bugfix for ReadClipper with ReducedReads
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts.  Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly.  Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
2013-04-29 11:12:09 -04:00
Mark DePristo 5dd73ba2d1 Merge pull request #198 from broadinstitute/mc_reduce_reads_ds_doc
Updates GATKDocs for ReduceReads downsampling
2013-04-27 05:49:47 -07:00
Mauricio Carneiro 76e997895e Updates GATKDocs for ReduceReads downsampling
[fixes #48258295]
2013-04-26 23:33:44 -04:00
Guillermo del Angel 4168aaf280 Add feature to specify Allele frequency priors by command line when calling variants.
Use case:
The default AF priors used (infinite sites model, neutral variation) is appropriate in the case where the reference allele is ancestral, and the called allele is a derived allele.
Most of the times this is true but in several population studies and in ancient DNA analyses this might introduce reference biases, and in some other cases it's hard to ascertain what the ancestral allele is (normally requiring to look up homologous chimp sequence).
Specifying no prior is one solution, but this may introduce a lot of artifactual het calls in shallower coverage regions.
With this option, users can specify what the prior for each AC should be according to their needs, subject to the restrictions documented in the code and in GATK docs.
-- Updated ancient DNA single sample calling script with filtering options and other cleanups.
-- Added integration test. Removed old -noPrior syntax.
2013-04-26 19:06:39 -04:00
Mark DePristo 759c531d1b Merge pull request #197 from broadinstitute/dr_disable_snpeff_version_check
Add support for snpEff "GATK compatibility mode" (-o gatk)
2013-04-26 13:55:14 -07:00
David Roazen 7d90bbab08 Add support for snpEff "GATK compatibility mode" (-o gatk)
-Do not throw an exception when parsing snpEff output files
 generated by not-officially-supported versions of snpEff,
 PROVIDED that snpEff was run with -o gatk

-Requested by the snpEff author

-Relevant integration tests updated/expanded
2013-04-26 15:47:15 -04:00
Mark DePristo 071fd67d55 Merge pull request #193 from broadinstitute/eb_contamination_fixing_for_reduced_reads
Eb contamination fixing for reduced reads
2013-04-26 09:48:45 -07:00
Mark DePristo 92a6c7b561 Merge pull request #195 from broadinstitute/eb_exclude_sample_file_bug_in_select_variants
Fixed bug reported on the forum where using the --exclude_sample_file ar...
2013-04-26 09:47:38 -07:00
Eric Banks 360e2ba87e Fixed bug reported on the forum where using the --exclude_sample_file argument in SV was giving bad results.
Added integration test.
https://www.pivotaltracker.com/s/projects/793457/stories/47399245
2013-04-26 12:23:11 -04:00
Eric Banks 021adf4220 WTF - I thought we had disabled the randomized dithering of rank sum tests for integration tests?!
Well, it wasn't done so I went ahead and did so.  Lots of MD5 changes accordingly.
2013-04-26 11:24:05 -04:00
Eric Banks ba2c3b57ed Extended the allele-biased down-sampling functionality to handle reduced reads.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.

Added lots of unit tests for new functionality.
2013-04-26 11:23:17 -04:00
Mark DePristo d20be41fee Bugfix for FragmentUtils.mergeOverlappingPairedFragments
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences.  If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference.  Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
2013-04-25 11:11:15 -04:00
Eric Banks 379a9841ce Various bug fixes for recent Reduce Reads additions plus solution implemented for low MQ reads.
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions.  Then we get the
best of both worlds.  As a note, coverage refers to just the individual base counts and not the entire pileup.

2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.

3. Each consensus keeps track of its own number of softclipped bases.  There was no reason that that number
should be shared between them.

4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now.  Don't lose that
information.  Maybe we'll decide to change this in the future, but for now we are conservative.

5. Also implemented various small performance optimizations based on profiling.

Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
2013-04-24 18:18:50 -04:00
MauricioCarneiro 45fec382e7 Merge pull request #180 from broadinstitute/mc_diagnosetargets_missing_targets
DiagnoseTargets Global Refactor
2013-04-24 14:54:55 -07:00
Mauricio Carneiro 367f0c0ac1 Split class names into stratification and metrics
Calling everything statistics was very confusing. Diagnose Targets stratifies the data three ways: Interval, Sample and Locus. Each stratification then has it's own set of metrics (plugin system) to calculate -- LocusMetric, SampleMetric, IntervalMetric.

 Metrics are generalized by the Metric interface. (for generic access)
 Stratifications are generalized by the AbstractStratification abstract class. (to aggressively limit code duplication)
2013-04-24 14:15:49 -04:00
Ryan Poplin 80131ac996 Adding the 1000G_phase1.snps.high_confidence callset to the GATK resource bundle for use in the April 2013 updated best practices. 2013-04-24 11:41:32 -04:00
Guillermo del Angel 2ab270cf3f Corner case fix to General Ploidy SNP likelihood model.
-- In case there are no informative bases in a pileup but pileup isn't empty (like when all bases have Q < min base quality) the GLs were still computed (but were all zeros) and fed to the exact model. Now, mimic case of diploid Gl computation where GLs are only added if # good bases > 0
-- I believe general case where only non-informative GLs are fed into AF calc model is broken and yields bogus QUAL, will investigate separately.
2013-04-23 21:13:18 -04:00
Mauricio Carneiro 8f8f339e4b Abstract class for the statistics
Addressing the code duplication issue raised by Mark.
2013-04-23 18:02:27 -04:00
Mauricio Carneiro 38662f1d47 Limiting access to the DT classes
* Make most classes final, others package local
    * Move to diagnostics.diagnosetargets package
    * Aggregate statistics and walker classes on the same package for simplified visibility.
    * Make status list a LinkedList instead of a HashSet
2013-04-23 14:01:43 -04:00
Ryan Poplin cb4ec3437a After debate reverting SW parameter changes temporarily while we explore global SW plans. 2013-04-23 13:32:06 -04:00
Mauricio Carneiro fdd16dc6f9 DiagnoseTargets refactor
A plugin enabled implementation of DiagnoseTargets

Summarized Changes:
-------------------
   * move argument collection into Thresholder object
   * make thresholder object private member of all statistics classes
   * rework the logic of the mate pairing thresholds
   * update unit and integration tests to reflect the new behavior
   * Implements Locus Statistic plugins
   * Extend Locus Statistic plugins to determine sample status
   * Export all common plugin functionality into utility class
   * Update tests accordingly

[fixes #48465557]
2013-04-22 23:53:10 -04:00
Mauricio Carneiro eb6308a0e4 General DiagnoseTargets documentation cleanup
* remove interval statistic low_median_coverage -- it is already captured by low coverage and coverage gaps.
   * add gatkdocs to all the parameters
   * clean up the logic on callable status a bit (still need to be re-worked into a plugin system)
   * update integration tests
2013-04-22 23:53:09 -04:00
Mauricio Carneiro b3c0abd9e8 Remove REF_N status from DiagnoseTargets
This is not really feasible with the current mandate of this walker. We would have to traverse by reference and that would make the runtime much higher, and we are not really interested in the status 99% of the time anyway. There are other walkers that can report this, and just this, status more cheaply.

[fixes #48442663]
2013-04-22 23:53:09 -04:00
Mauricio Carneiro 2b923f1568 fix for DiagnoseTargets multiple filter output
Problem
-------
Diagnose targets is outputting both LOW_MEDIAN_COVERAGE and NO_READS when no reads are covering the interval

Solution
--------
Only allow low median coverage check if there are reads

[fixes #48442675]
2013-04-22 23:53:09 -04:00
Mauricio Carneiro cf7afc1ad4 Fixed "skipped intervals" bug on DiagnoseTargets
Problem
-------
Diagnose targets was skipping intervals when they were not covered by any reads.

Solution
--------
Rework the interval iteration logic to output all intervals as they're skipped over by the traversal, as well as adding a loop on traversal done to finish outputting intervals past the coverage of teh BAM file.

Summarized Changes
------------------
   * Outputs all intervals it iterates over, even if uncovered
   * Outputs leftover intervals in the end of the traversal
   * Updated integration tests

[fixes #47813825]
2013-04-22 23:53:09 -04:00
Mark DePristo be66049a6f Bugfix for CommonSuffixSplitter
-- The problem is that the common suffix splitter could eliminate the reference source vertex when there's an incoming node that contains all of the reference source vertex bases and then some additional prefix bases.  In this case we'd eliminate the reference source vertex.  Fixed by checking for this condition and aborting the simplification
-- Update MD5s, including minor improvements
2013-04-21 19:37:01 -04:00
Mark DePristo f0e64850da Two sensitivity / specificity improvements to the haplotype caller
-- Reduce the min read length to 10 bp in the filterNonPassingReads in the HC.  Now that we filter out reads before genotyping, we have to be more tolerant of shorter, but informative, reads, in order to avoid a few FNs in shallow read data
-- Reduce the min usable base qual to 8 by default in the HC.  In regions with low coverage we sometimes throw out our only informative kmers because we required a contiguous run of bases with >= 16 QUAL.  This is a bit too aggressive of a requirement, so I lowered it to 8.
-- Together with the previous commit this results in a significant improvement in the sensitivity and specificity of the caller

 NA12878 MEM chr20:10-11
 Name    VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
 branch  SNPS                  1216               0               2            194                        0
 branch  INDELS                 312               2              13             71                        7
 master  SNPS                  1214               0               4            194                        1
 master  INDELS                 309               2              16             71                       10

-- Update MD5s in the integration tests to reflect these two new changes
2013-04-17 12:32:31 -04:00
Eric Banks 5bce0e086e Refactored binomial probability code in MathUtils.
* Moved redundant code out of UGEngine
  * Added overloaded methods that assume p=0.5 for speed efficiency
  * Added unit test for the binomialCumulativeProbability method
2013-04-16 18:19:07 -04:00
Eric Banks df189293ce Improve compression in Reduce Reads by incorporating probabilistic model and global het compression
The Problem:
  Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
  regions in an exome) causes RR (with default settings) to consider it a variant region.  This
  seriously hurts compression performance.

The Solution:
  1. We now use a probabilistic model for determining whether we can create a consensus (in other
  words, whether we can error correct a site) instead of the old ratio threshold.  We calculate
  the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
  that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
  2. We also allow het compression globally, not just at known sites.  So if we cannot create a
  consensus at a given site then we try to perform het compression; and if we cannot perform het
  compression that we just don't reduce the variant region.  This way very wonky regions stay
  uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
  locus get het compressed.

Details:
  1. -minvar is now deprecated in favor of -min_pvalue.
  2. Added integration test for bad pvalue input.
  3. -known argument still works to force het compression only at known sites; if it's not included
     then we allow het compression anywhere.  Added unit tests for this.
  4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
     Before finalizing het compression, we now check for insertions or other variant regions (usually due
     to multi-allelics) which can render a region incompressible (and we back out if we find one).  We
     were checking for excessive softclips before, but now we add these tests too.
  5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
     consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
     out instead of backing out all of them.
  6. We no longer create a mini read at the stop of the variant window for het compression.  Instead, we
     allow it to be part of the next global consensus.
  7. The coverage test is no longer run systematically on all integration tests because the quals test
     supercedes it.  The systematic quals test is now much stricter in order to catch bugs and edge cases
     (very useful!).
  8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
     for a consensus was affected by good and bad bases/reads).
  9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
     This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
  10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
     with insertions from a header.

Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
2013-04-16 18:19:06 -04:00
Ryan Poplin e0dfe5ca14 Restore the read filter function in the HaplotypeCaller. 2013-04-16 12:01:30 -04:00
Geraldine Van der Auwera e176fc3af1 Merge pull request #159 from broadinstitute/md_bqsr_ion
Trivial BQSR bug fixes and improvement
2013-04-16 08:54:47 -07:00
Ryan Poplin 936f4da1f6 Merge pull request #166 from broadinstitute/md_hc_persample_haplotypes
Select the haplotypes we move forward for genotyping per sample, not poo...
2013-04-16 08:46:56 -07:00
Mark DePristo 17982bcbf8 Update MD5s for VQSR header change 2013-04-16 11:45:45 -04:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Mark DePristo 5a74a3190c Improvements to the VariantRecalibrator R plots
-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
2013-04-16 09:09:51 -04:00
Mark DePristo 564fe36d22 VariantRecalibrator's VQSR.vcf now contains NEG/POS labels
-- It's useful to know which sites have been used in the training of the model.  The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
2013-04-16 09:09:47 -04:00
Mauricio Carneiro 9bfa5eb70f Quick optimization to the PairHMM
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.

Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
2013-04-14 23:25:33 -04:00
Mark DePristo 3144eae51c UnifiedGenotyper bugfix: don't create haplotypes with 0 bases
-- The PairHMM no longer allows us to create haplotypes with 0 bases.  The UG indel caller used to create such haplotypes.  Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes #47523579]
2013-04-13 14:57:55 -04:00
Mauricio Carneiro f11c8d22d4 Updating java 7 md5's to java 6 md5's 2013-04-13 08:21:48 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 0e627bce93 Slight update to Path SW parameters.
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
2013-04-12 12:43:52 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00
Ryan Poplin a507381a33 Updating BQSR RecalibrationEngine to work correctly with empty BQSR tables.
-- Previously would crash when a scatter/gather interval contained no usable data.
-- Added unit test to cover this case.
2013-04-11 16:27:59 -04:00
Mark DePristo fb86887bf2 Fast algorithm for determining which kmers are good in a read
-- old algorithm was O(kmerSize * readLen) for each read.  New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph.  Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
2013-04-11 09:54:22 -04:00
Mark DePristo bf42be44fc Fast DeBruijnGraph creation using the kmer counter
-- The previous creation algorithm used the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to the graph
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
  update edge count by 1 if kmer1 -> kmer2 already existed in the graph

-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)).  This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap

for each kmer pair 1 and 2 in the hash counter
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
  update edge count by count from map if kmer1 -> kmer2 already existed in the graph

-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
2013-04-10 17:10:59 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mark DePristo b115e5c582 Critical bugfix for CommonSuffixSplitter to avoid infinite loops
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:

X -> A -> B
Y -> A -> B

So that the incoming vertices of B all have the same sequence.  This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph.  Fixed and unit tested

-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging.  So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph.  Equals here means that all vertices have equivalents in both graphs, as do all edges.  If the two graphs are equal we stop simplifying.  It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
2013-04-09 16:19:26 -04:00
Mark DePristo 51954ae3e5 HaplotypeCaller doesn't support EXACT_GENERAL_PLOIDY model
-- HC now throws a UserException if this model is provided.  Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
2013-04-09 15:18:42 -04:00
Mark DePristo 33ecec535d Turn off the LD merging code by default
-- It's just too hard to interpret the called variation when we merge variants via LD.
-- Can now be turned on with -mergeVariantsViaLD
-- Update MD5s
2013-04-09 10:08:06 -04:00
Mark DePristo 21410690a2 Address reviewer comments 2013-04-08 12:48:20 -04:00
Mark DePristo caf15fb727 Update MD5s to reflect new HC algorithms and parameter values 2013-04-08 12:48:16 -04:00
Mark DePristo 6d22485a4c Critical bugfix to ReduceRead functionality of the GATKSAMRecord
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5].  The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding.  Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i.  Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
2013-04-08 12:47:50 -04:00
Mark DePristo 5a54a4155a Change key Haplotype default parameter values
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
2013-04-08 12:47:50 -04:00
Mark DePristo 3a19266843 Fix residual merge conflicts 2013-04-08 12:47:50 -04:00
Mark DePristo 9c7a35f73f HaplotypeCaller no longer creates haplotypes that involve cycles in the SeqGraph
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models.  Allowing cycles can be re-enabled with an HC command line switch.
2013-04-08 12:47:50 -04:00
Mark DePristo 5545c629f5 Rename Utils to GraphUtils to avoid conflicts with the sting.Utils class; fix broken unit test in SharedVertexSequenceSplitterUnitTest 2013-04-08 12:47:49 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo 9b5c55a84a LikelihoodCalculationEngine will now only use reads longer than the minReadLength, which is currently fixed at 20 bp 2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 4d389a8234 Optimizations for HC infrastructure
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
2013-04-08 12:47:49 -04:00
Mark DePristo e916998784 Bugfix for head and tail merging code in SeqGraph
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so.  This would introduce large deletion events at the start / end of the assemblies.  Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
2013-04-08 12:47:48 -04:00
Mark DePristo 2aac9e2782 More efficient ZipLinearChains algorithm
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go.  Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains.  The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 67cd407854 The GenotypingEngine now uses the samples from the mapping of Samples -> PerReadAllele likelihoods instead of passing around a redundant list of samples 2013-04-08 12:47:47 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Eric Banks 6253ba164e Using --keepOriginalAC in SelectVariants was causing it to emit bad VCFs
* This occurred when one or more alleles were lost from the record after selection
  * Discussed here: http://gatkforums.broadinstitute.org/discussion/comment/4718#Comment_4718
  * Added some integration tests for --keepOriginalAC (there were none before)
2013-04-05 00:53:28 -04:00
Eric Banks 7897d52f32 Don't allow users to specify keys and IDs that contain angle brackets or equals signs (not allowed in VCF spec).
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
  * This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
  * Added integration test to confirm failure with User Error
  * Removed illegal header line in KB test VCF that was causing related tests to fail.
2013-04-05 00:52:32 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
Mark DePristo bb42c90f2b Use LinkedHashSets in incoming and outgoing vertex functions in BaseGraph
-- Using a LinkedHashSet changed the md5 for HCTestComplexVariants.
2013-04-02 17:58:20 -04:00
David Roazen b4b58a3968 Fix unprintable character in a comment from the BaseEdge class
Compiler warnings about this were starting to get to me...
2013-04-02 14:24:23 -04:00
Mark DePristo c191d7de8c Critical bugfix for CommonSuffixSplitter
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm.  Created unit test that reproduced the issue, and then fixed the underlying issue.
2013-04-02 09:22:33 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Ryan Poplin f65206e758 Two changes to HC GGA mode to make it more like the UG.
-- Only try to genotype PASSing records in the alleles file
-- Don't attempt to genotype multiple records with the same start location. Instead take the first record and throw a warning message.
2013-04-01 10:20:23 -04:00
Mark DePristo 7c83efc1b9 Merge pull request #135 from broadinstitute/mc_pgtag_fix
Fixing @PG tag uniqueness issue
2013-03-31 11:36:40 -07:00
Eric Banks 7dd58f671f Merge pull request #132 from broadinstitute/gda_filter_unmasked_sites
Added small feature to VariantFiltration to filter sites outside of a gi...
2013-03-31 06:27:26 -07:00
Guillermo del Angel 9686e91a51 Added small feature to VariantFiltration to filter sites outside of a given mask:
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
2013-03-31 08:48:16 -04:00
Eric Banks 8e2094d2af Updated AssessReducedQuals and applied it systematically to all ReduceReads integration tests.
* Moved to protected for packaging purposes.
  * Cleaned up and removed debugging output.
  * Fixed logic for epsilons so that we really only test significant differences between BAMs.
  * Other small fixes (e.g. don't include low quality reduced reads in overall qual).
  * Most RR integration tests now automatically run the quals test on output.
    * A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
2013-03-31 00:27:14 -04:00
Mauricio Carneiro ec475a46b1 Fixing @PG tag uniqueness issue
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".

How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.

Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter

Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31

Issue Tracker:
--------------
[fixes 47100885]
2013-03-30 20:31:33 -04:00
Mauricio Carneiro 68bf470524 making LoglessPairHMM final 2013-03-30 20:00:45 -04:00
Guillermo del Angel 6b8bed34d0 Big bad bug fix: feature added to LeftAlignAndTrimVariants to left align multiallelic records didn't work.
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
2013-03-30 19:31:28 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
Chris Hartl 74a17359a8 MathUtils.randomSubset() now uses Collections.shuffle() (indirectly, through the other methods
that are tested), resulting in slightly different numbers of calls to the RNG, and ultimately
different sets of selected variants.

This commits updates the md5 values for the validation site selector integration test to reflect
these new random subsets of variants that are selected.
2013-03-29 14:52:10 -04:00
Guillermo del Angel 8fbf9c947f Upgrades and changes to LeftAlignVariants, motivated by 1000G consensus indel production:
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
2013-03-29 10:02:06 -04:00
Chris Hartl 73d1c319bf Rarely-occurring logic bugfix for GenotypeConcordance, streamlining and testing of MathUtils
Currently, the multi-allelic test is covering the following case:

Eval   A   T,C
Comp   A   C

reciprocate this so that the reverse can be covered.

Eval   A   C
Comp   A   T,C

And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.

This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:

Eval:   A  G,T      0/0   2/0   2/2   1/1
Comp:   A  C,T      0/0   1/0   0/0   0/0

Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:

Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)

Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.

Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
 - dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
 - vectorSum
 - array shuffle, random subset
 - countOccurances (general forms, the char form is used in the codebase)
 - getNMaxElements
 - array permutation
 - sorted array permutation
 - compare floats
 - sum() (for integer arrays and lists).

Final keyword was extensively added to MathUtils.

The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).

The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.

In addition, more extensive tests were added for
 - logBinomialCoefficient (Newton's identity should always hold)
 - logFactorial
 - log10sumlog10 and its approximation

All unit tests pass
2013-03-28 23:25:28 -04:00
MauricioCarneiro a2b69790a6 Merge pull request #128 from broadinstitute/eb_rr_polyploid_compression_GSA-639 2013-03-28 06:39:43 -07:00
Mark DePristo fde7d36926 Updating md5s due to changes in assembly graph creation algorithms and default parameter 2013-03-27 15:31:24 -04:00
Mark DePristo 197d149495 Increase the maxNumHaplotypesInPopulation to 25
-- A somewhat arbitrary increase, and will need some evaluation but necessary to get good results on the AFR integrationtest.
2013-03-27 15:31:24 -04:00
Mark DePristo 66910b036c Added new and improved suffix and node merging algorithms
-- These new algorithms are more powerful than the restricted diamond merging algoriths, in that they can merge nodes with multiple incoming and outgoing edges.  Together the splitter + merger algorithms will correctly merge many more cases than the original headless and tailless diamond merger.
-- Refactored haplotype caller infrastructure into graphs package, code cleanup
-- Cleanup new merging / splitting algorithms, with proper docs and unit tests
-- Fix bug in zipping of linear chains.  Because the multiplicity can be 0, protect ourselves with a max function call
-- Fix BaseEdge.max unit test
-- Add docs and some more unit tests
-- Move error correct from DeBruijnGraph to DeBruijnAssembler
-- Replaced uses of System.out.println with logger.info
-- Don't make multiplicity == 0 nodes look like they should be pruned
-- Fix toString of Path
2013-03-27 15:31:18 -04:00
Mark DePristo 39f2e811e5 Increase max cigar elements from SW before failing path creation to 20 from 6
-- This allows more diversity in paths, which is sometimes necessary when we cannot simply graphs that have large bubbles
2013-03-26 14:27:18 -04:00
Mark DePristo b1b615b668 BaseGraph shouldn't implement getEdge -- no idea why I added this 2013-03-26 14:27:18 -04:00
Mark DePristo a97576384d Fix bug in the HC not respecting the requested pruning 2013-03-26 14:27:18 -04:00
Mark DePristo 78c672676b Bugfix for pruning and removing non-reference edges in graph
-- Previous algorithms were applying pruneGraph inappropriately on the raw sequence graph (where each vertex is a single base).  This results in overpruning of the graph, as prunegraph really relied on the zipping of linear chains (and the sharing of weight this provides) to avoid over-pruning the graph.  Probably we should think hard about this.  This commit fixes this logic, so we zip the graph between pruning
-- In this process ID's a fundamental problem with how we were trimming away vertices that occur on a path from the reference source to sink.  In fact, we were leaving in any vertex that happened to be accessible from source, any vertices in cycles, and any vertex that wasn't the absolute end of a chain going to a sink.  The new algorithm fixes all of this, using a BaseGraphIterator that's a general approach to walking the base graph.  Other routines that use the same traversal idiom refactored to use this iterator.  Added unit tests for all of these capabilities.
-- Created new BaseGraphIterator, which abstracts common access patterns to graph, and use this where appropriate
2013-03-26 14:27:18 -04:00
Mark DePristo ad04fdb233 PerReadAlleleLikelihoodMap getMostLikelyAllele returns an MostLikelyAllele objects now
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users.  The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not.  That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves.  There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second.  For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads.   All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event.  In this case our annotations will all fall apart, returning their default values.  Added a JIRA to address this (should be discussed in group meeting)
2013-03-26 14:27:13 -04:00
Mark DePristo 2472828e1c HC bug fixes: no longer create reference graphs with cycles
-- Though not intended, it was possible to create reference graphs with cycles in the case where you started the graph with a homopolymer of length > the kmer.  The previous test would fail to catch this case.  Now its not possible
-- Lots of code cleanup and refactoring in this push.  Split the monolithic createGraphFromSequences into simple calls to addReferenceKmersToGraph and addReadKmersToGraph which themselves share lower level functions like addKmerPairFromSeqToGraph.
-- Fix performance problem with reduced reads and the HC, where we were calling add kmer pair for each count in the reduced read, instead of just calling it once with a multiplicity of count.
-- Refactor addKmersToGraph() to use things like addOrUpdateEdge, now the code is very clear
2013-03-26 10:12:24 -04:00
Mark DePristo 1917d55dc2 Bugfix for DeBruijnAssembler: don't fail when read length > haplotype length
-- The previous version would generate graphs that had no reference bases at all in the situation where the reference haplotype was < the longer read length, which would cause the kmer size to exceed the reference haplotype length.  Now return immediately with a null graph when this occurs as opposed to continuing and eventually causing an error
2013-03-26 10:12:17 -04:00
Mark DePristo 464e65ea96 Disable error correcting kmers by default in the HC
-- The error correction algorithm can break the reference graph in some cases by error correcting us into a bad state for the reference sequence.  Because we know that the error correction algorithm isn't ideal, and worse, doesn't actually seem to improve the calling itself on chr20, I've simply disabled error correction by default and allowed it to be turned on with a hidden argument.
-- In the process I've changed a bit the assembly interface, moving some common arguments us into the LocalAssemblyEngine, which are turned on/off via setter methods.
-- Went through the updated arguments in the HC to be @Hidden and @Advanced as appropriate
-- Don't write out an errorcorrected graph when debugging and error correction isn't enabled
2013-03-26 10:05:17 -04:00
Eric Banks 593d3469d4 Refactored the het (polyploid) consensus creation in ReduceReads.
* It is now cleaner and easier to test; added tests for newly implemented methods.
 * Many fixes to the logic to make it work
   * The most important change was that after triggering het compression we actually need to back it out if it
      creates reads that incorporated too many softclips at any one position (because they get unclipped).
   * There was also an off-by-one error in the general code that only manifested itself with het compression.
 * Removed support for creating a het consensus around deletions (which was broken anyways).
   * Mauricio gave his blessing for this.
 * Het compression now works only against known sites (with -known argument).
    * The user can pass in one or more VCFs with known SNPs (other variants are ignored).
    * If no known SNPs are provided het compression will automatically be disabled.
 * Added SAM tag to stranded (i.e. het compressed) reduced reads to distinguish their
   strandedness from normal reduced reads.
    * GATKSAMRecord now checks for this tag when determining whether or not the read is stranded.
    * This allows us to update the FisherStrand annotation to count het compressed reduced reads
       towards the FS calculation.
    * [It would have been nice to mark the normal reads as unstranded but then we wouldn't be
       backwards compatible.]
    * Updated integration tests accordingly with new het compressed bams (both for RR and UG).
 * In the process of fixing the FS annotation I noticed that SpanningDeletions wasn't handling
   RR properly, so I fixed it too.
    * Also, the test in the UG engine for determining whether there are too many overlapping
       deletions is updated to handle RR.
 * I added a special hook in the RR integration tests to additionally run the systematic
   coverage checking tool I wrote earlier.
    * AssessReducedCoverage is now run against all RR integration tests to ensure coverage is
       not lost from original to reduced bam.
    * This helped uncover a huge bug in the MultiSampleCompressor where it would drop reads
       from all but 1 sample (now fixed).
    * AssessReducedCoverage moved from private to protected for packaging reasons.
 * #resolve GSA-639

At this point, this commit encompasses most of what is needed for het compression to go live.
There are still a few TODO items that I want to get in before the 2.5 release, but I will save
those for a separate branch because as it is I feel bad for the person who needs to review all
these changes (sorry, Mauricio).
2013-03-25 09:34:54 -04:00
Mark DePristo 965043472a Vastly more powerful, cleaner graph simplification approach
-- Generalizes previous node merging and splitting approaches.  Can split common prefixes and suffices among nodes, build a subgraph representing this new structure, and incorporate it into the original graph.  Introduces the concept of edges with 0 multiplicity (for purely structural reasons) as well as vertices with no sequence (again, for structural reasons).  Fully UnitTested.  These new algorithms can now really simplify diamond configurations as well as ones sources and sinks that arrive / depart linearly at a common single root node.
-- This new suite of algorithms is fully integrated into the HC, replacing previous approaches
-- SeqGraph transformations are applied iteratively (zipping, splitting, merging) until no operations can be performed on the graph.  This further simplifies the graphs, as splitting nodes may enable other merging / zip operations to go.
2013-03-23 17:40:55 -04:00
Ryan Poplin c15453542e Merge pull request #124 from broadinstitute/md_hc_lowmapq_read_filter
HC now by default only uses reads with MAPQ >= 20 for assembly and calli...
2013-03-21 12:00:28 -07:00
Mark DePristo 7ae15dadbe HC now by default only uses reads with MAPQ >= 20 for assembly and calling
-- Previously we tried to include lots of these low mapping quality reads in the assembly and calling, but we effectively were just filtering them out anyway while generating an enormous amount of computational expense to handle them, as well as much larger memory requirements.  The new version simply uses a read filter to remove them upfront.  This causes no major problems -- at least, none that don't have other underlying causes -- compared to 10-11mb of the KB
-- Update MD5s to reflect changes due to no longer including mmq < 20 by default
2013-03-21 13:10:50 -04:00
Ryan Poplin b9c331c2fa Bug fix in HC gga mode.
-- Don't try to test alleles which haven't had haplotypes assigned to them
2013-03-21 11:02:41 -04:00
Mark DePristo aa7f172b18 Cap the computational cost of the kmer based error correction in the DeBruijnGraph
-- Simply don't do more than MAX_CORRECTION_OPS_TO_ALLOW = 5000 * 1000 operations to correct a graph.  If the number of ops would exceed this threshold, the original graph is used.
-- Overall the algorithm is just extremely computational expensive, and actually doesn't implement the correct correction.  So we live with this limitations while we continue to explore better algorithms
-- Updating MD5s to reflect changes in assembly algorithms
2013-03-21 09:21:35 -04:00
Mark DePristo d94b3f85bc Increase NUM_BEST_PATHS_PER_KMER_GRAPH in DeBruijnAssembler to 25
-- The value of 11 was too small to properly return a real low-frequency variant in our the 1000G AFR integration test.
2013-03-20 22:54:38 -04:00
Mark DePristo 6d7d21ca47 Bugfix for incorrect branch diamond merging algorithm
-- Previous version was just incorrectly accumulating information about nodes that were completely eliminated by the common suffix, so we were dropping some reference connections between vertices.  Fixed.  In the process simplified the entire algorithm and codebase
-- Resolves https://jira.broadinstitute.org/browse/GSA-884
2013-03-20 22:54:37 -04:00
Mark DePristo 3a8f001c27 Misc. fixes upon pull request review
-- DeBruijnAssemblerUnitTest and AlignmentUtilsUnitTest were both in DEBUG = true mode (bad!)
-- Remove the maxHaplotypesToConsider feature of HC as it's not useful
2013-03-20 22:54:37 -04:00
Mark DePristo d3b756bdc7 BaseVertex optimization: don't clone byte[] unnecessarily
-- Don't clone sequence upon construction or in getSequence(), as these are frequently called, memory allocating routines and cloning will be prohibitively expensive
2013-03-20 22:54:37 -04:00
Mark DePristo 5226b24a11 HaplotypeCaller instructure cleanup and unit testing
-- UnitTest for isRootOfDiamond along with key bugfix detected while testing
-- Fix up the equals methods in BaseEdge.  Now called hasSameSourceAndTarget and seqEquals.  A much more meaningful naming
-- Generalize graphEquals to use seqEquals, so it works equally well with Debruijn and SeqGraphs
-- Add BaseVertex method called seqEquals that returns true if two BaseVertex objects have the same sequence
-- Reorganize SeqGraph mergeNodes into a single master function that does zipping, branch merging, and zipping again, rather than having this done in the DeBruijnAssembler itself
-- Massive expansion of the SeqGraph unit tests.  We now really test out the zipping and branch merging code.
-- Near final cleanup of the current codebase
-- DeBruijnVertex cleanup and optimizations.  Since kmer graphs don't allow sequences longer than the kmer size, the suffix is always a byte, not a byte[].  Optimize the code to make use of this constraint
2013-03-20 22:54:37 -04:00
Mark DePristo 2e36f15861 Update md5s to reflect new downsampling and assembly algorithm output
-- Only minor differences, with improvement in allele discovery where the sites differ.  The test of an insertion at the start of the MT no longer calls a 1 bp indel at position 0 in the genome
2013-03-20 22:54:37 -04:00
Mark DePristo 1fa5050faf Cleanup, unit test, and optimize KBestPaths and Path
-- Split Path from inner class of KBestPaths
-- Use google MinMaxPriorityQueue to track best k paths, a more efficient implementation
-- Path now properly typed throughout the code
-- Path maintains a on-demand hashset of BaseEdges so that path.containsEdge is fast
2013-03-20 22:54:36 -04:00
Mark DePristo 98c4cd060d HaplotypeCaller now uses SeqGraph instead of kmer graph to build haplotypes.
-- DeBruijnAssembler functions are no longer static.  This isn't the right way to unit test your code
-- An a HaplotypeCaller command line option to use low-quality bases in the assembly
-- Refactored DeBruijnGraph and associated libraries into base class
-- Refactored out BaseEdge, BaseGraph, and BaseVertex from DeBruijn equivalents.  These DeBruijn versions now inherit from these base classes.  Added some reasonable unit tests for the base and Debruijn edges and vertex classes.
-- SeqVertex: allows multiple vertices in the sequence graph to have the same sequence and yet be distinct
-- Further refactoring of DeBruijnAssembler in preparation for the full SeqGraph <-> DeBruijnGraph split
-- Moved generic methods in DeBruijnAssembler into BaseGraph
-- Created a simple SeqGraph that contains SeqVertex objects
-- Simple chain zipper for SeqGraph that reproduces the results for the mergeNode function on DeBruijnGraphs
-- A working version of the diamond remodeling algorithm in SeqGraph that converts graphs that look like A -> Xa, A -> Ya, Xa -> Z, Ya -> Z into A -> X -> a, A -Y -> a, a -> Z
-- Allow SeqGraph zip merging of vertices where the in vertex has multiple incoming edges or the out vertex has multiple outgoing edges
-- Fix all unit tests so they work with the new SeqGraph system.  All tests passed without modification.
-- Debugging makes it easier to tell which kmer graph contributes to a haplotype
-- Better docs and unit tests for BaseVertex, SeqVertex, BaseEdge, and KMerErrorCorrector
-- Remove unnecessary printing of cleaning info in BaseGraph
-- Turn off kmer graph creation in DeBruijnAssembler.java
-- Only print SeqGraphs when debugGraphTransformations is set to true
-- Rename DeBruijnGraphUnitTest to SeqGraphUnitTest.  Now builds DeBruijnGraph, converts to SeqGraph, uses SeqGraph.mergenodes and tests for equality.
-- Update KBestPathsUnitTest to use SeqGraphs not DebruijnGraphs
-- DebruijnVertex now longer takes kmer argument -- it's implicit that the kmer length is the sequence.length now
2013-03-20 22:54:36 -04:00
Mark DePristo 0f4328f6fe Basic kmer error correction algorithm xfor the HaplotypeCaller
-- Error correction algorithm for the assembler.  Only error correct reads to others that are exactly 1 mismatch away
-- The assembler logic is now: build initial graph, error correct*, merge nodes*, prune dead nodes, merge again, make haplotypes.  The * elements are new
-- Refactored the printing routines a bit so it's easy to write a single graph to disk for testing.
-- Easier way to control the testing of the graph assembly algorithms
-- Move graph printing function to DeBruijnAssemblyGraph from DeBruijnAssembler
-- Simple protected parsing function for making DeBruijnAssemblyGraph
-- Change the default prune factor for the graph to 1, from 2
-- debugging graph transformations are controllable from command line
2013-03-20 22:54:36 -04:00
Mark DePristo 53a904bcbd Bugfix for HaplotypeCaller: GSA-822 for trimming softclipped reads
-- Previous version would not trim down soft clip bases that extend beyond the active region, causing the assembly graph to go haywire.  The new code explicitly reverts soft clips to M bases with the ever useful ReadClipper, and then trims.  Note this isn't a 100% fix for the issue, as it's possible that the newly unclipped bases might in reality extend beyond the active region, should their true alignment include a deletion in the reference.  Needs to be fixed.  JIRA added

-- See https://jira.broadinstitute.org/browse/GSA-822
-- #resolve #fix GSA-822
2013-03-20 22:54:36 -04:00
Mark DePristo ffea6dd95f HaplotypeCaller now has the ability to only consider the best N haplotypes for genotyping
-- Added a -dontGenotype mode for testing assembly efficiency
-- However, it looks like this has a very negative impact on the quality of the results, so the code should be deleted
2013-03-20 22:54:36 -04:00
Mark DePristo a783f19ab1 Fix for potential HaplotypeCaller bug in annotation ordering
-- Annotations were being called on VariantContext that might needed to be trimmed.  Simply inverted the order of operations so trimming occurs before the annotations are added.
-- Minor cleanup of call to PairHMM in LikelihoodCalculationEngine
2013-03-20 22:54:35 -04:00
Eric Banks 1fae750ebe Merge pull request #120 from broadinstitute/aw_reduce_reads_clear_name_cache
Clear ReduceReads name cache after each set of reads produced by ReduceR...
2013-03-20 19:47:42 -07:00
Guillermo del Angel ea01dbf130 Fix to issue encountered when running HaplotypeCaller in GGA mode with data from other 1000G callers.
In particular, someone produced a tandem repeat site with 57 alt alleles (sic) which made the caller blow up.
Inelegant fix is to detect if # of alleles is > our max cached capacity, and if so, emit an informative warning and skip site.
-- Added unit test to UG engine to cover this case.
-- Commit to posterity private scala script currently used for 1000G indel consensus (still very much subject to changes).
GSA-878 #resolve
2013-03-20 14:30:37 -04:00
Geraldine Van der Auwera 95a9ed853d Made some documentation updates & fixes
--Mostly doc block tweaks
	--Added @DocumentedGATKFeature to some walkers that were undocumented because they were ending up in "uncategorized". Very important for GSA: if a walker is in public or protected, it HAS to be properly tagged-in. If it's not ready for the public, it should be in private.
2013-03-20 06:15:20 -04:00
Alec Wysoker bccc9d79e5 Clear ReduceReads name cache after each set of reads produced by ReduceReadsStash.
Name cache was filling up with names of all reads in entire file, which for large file eventually
consumes all of memory.  Only keep read name cache for the reads that are together in one variant
region, so that a pair of reads within the same variant region will still be joined via read name.
Otherwise the ability to connect a read to its mate is lost.

Update MD5s in integration test to reflect altered output.
Add new integration test that confirms that pair within variant region is joined by read name.
2013-03-19 14:12:33 -04:00
Ryan Poplin 0cf5d30dac Bug fix in assembly for edge case in which the extendPartialHaplotype function was filling in deletions in the middle of haplotypes. 2013-03-15 14:20:25 -04:00
Ryan Poplin b8991f5e98 Fix for edge case bug of trying to create insertions/deletions on the edge of contigs.
-- Added integration test using MT that previously failed
2013-03-15 12:32:13 -04:00
Mark DePristo 2d35065238 QualityByDepth remaps QD values > 40 to a gaussian around 30
-- This is a temporarily fix / hack to deal with the very high QD values that are generated by the haplotype caller when nearby events occur within reads.  In that case, the QUAL field can be many fold higher than normal, and results in an inflated QD value.  This hack projects such high QD values back into the good range (as these are good variants in general) so they aren't filtered away by VQSR.
-- The long-term solution to this problem is to move the HaplotypeCaller to the full bubble calling algorithm
-- Update md5s
2013-03-14 16:09:41 -04:00
droazen 0fd9f0e77c Merge pull request #104 from broadinstitute/eb_fix_output_annotation_GSA-837
Fixed the logic of the @Output annotation and its interaction with 'required'
2013-03-14 12:52:00 -07:00
Ryan Poplin 38914384d1 Changing CALLED_IN_DB_UNKNOWN_STATUS to count as TRUE_POSITIVEs in the simplified stats for AssessNA12878. 2013-03-14 14:44:18 -04:00
Geraldine Van der Auwera 61349ecefa Cleaned up annotations
- Moved AverageAltAlleleLength, MappingQualityZeroFraction and TechnologyComposition to Private
  - VariantType, TransmissionDisequilibriumTest, MVLikelihoodRatio and GCContent are no longer Experimental
  - AlleleBalanceBySample, HardyWeinberg and HomopolymerRun are Experimental and available to users with a big bold caveat message
  - Refactored getMeanAltAlleleLength() out of AverageAltAlleleLength into GATKVariantContextUtils in order to make QualByDepth independent of where AverageAltAlleleLength lives
  - Unrelated change, bundled in for convenience: made HC argument includeUnmappedreads @Hidden
  - Removed unnecessary check in AverageAltAlleleLength
2013-03-14 14:26:48 -04:00
Eric Banks 7cab709a88 Fixed the logic of the @Output annotation and its interaction with 'required'.
ALL GATK DEVELOPERS PLEASE READ NOTES BELOW:

I have updated the @Output annotation to behave differently and to include a 'defaultToStdout' tag.
  * The 'defaultToStdout' tags lets walkers specify whether to default to stdout if -o is not provided.
  * The logic for @Output is now:
    * if required==true then -o MUST be provided or a User Error is generated.
    * if required==false and defaultToStdout==true then the output is assigned to stdout if no -o is provided.
      * this is the default behavior (i.e. @Output with no modifiers).
    * if required==false and defaultToStdout==false then the output object is null.
      * use this combination for truly optional outputs (e.g. the -badSites option in AssessNA12878).

  * I have updated walkers so that previous behavior has been maintained (as best I could).
    * In general, all @Outputs with default long/short names have required=false.
    * Walkers with nWayOut options must have required==false and defaultToStdout==false (I added checks for this)
  * I added unit tests for @Output changes with David's help (thanks!).
  * #resolve GSA-837
2013-03-14 11:58:51 -04:00
Mark DePristo b5b63eaac7 New GATKSAMRecord concept of a strandless read, update to FS
-- Strandless GATK reads are ones where they don't really have a meaningful strand value, such as Reduced Reads or fragment merged reads.  Added GATKSAMRecord support for such reads, along with unit tests
-- The merge overlapping fragments code in FragmentUtils now produces strandless merged fragments
-- FisherStrand annotation generalized to treat strandless as providing 1/2 the representative count for both strands.  This means that that merged fragments are properly handled from the HC, so we don't hallucinate fake strand-bias just because we managed to merge a lot of reads together.
-- The previous getReducedCount() wouldn't work if a read was made into a reduced read after getReducedCount() had been called.  Added new GATKSAMRecord method setReducedCounts() that does the right thing.  Updated SlidingWindow and SyntheticRead to explicitly call this function, and so the readTag parameter is now gone.
-- Update MD5s for change to FS calculation.  Differences are just minor updates to the FS
2013-03-13 11:16:36 -04:00
MauricioCarneiro 4403e3572a Merge pull request #94 from broadinstitute/gg_gatkdoc_docfixes_GSATDG-111 2013-03-12 13:02:35 -07:00
MauricioCarneiro 3a16ba04d4 Merge pull request #97 from broadinstitute/eb_refactor_sliding_window
Refactoring of SlidingWindow class in RR to reduce complexity and fix important bug
2013-03-12 12:27:26 -07:00
Geraldine Van der Auwera f972963918 Fixed issues raised by Appistry QA (mostly small fixes, corrections & clarifications to GATKDocs)
GATK-73 updated docs for bqsr args
GATK-9 differentiate CountRODs from CountRODsByRef
GATK-76 generate GATKDoc for CatVariants
GATK-4 made resource arg required
GATK-10 added -o, some docs to CountMales; some docs to CountLoci
GATK-11 fixed by MC's -o change; straightened out the docs.
GATK-77 fixed references to wiki
GATK-76 Added Ami's doc block
GATK-14 Added note that these annotations can only be used with VariantAnnotator
GATK-15 specified required=false for two arguments
GATK-23 Added documentation block
GATK-33 Added documentation
GATK-34 Added documentation
GATK-32 Corrected arg name and docstring in DiffObjects
GATK-32 Added note to DO doc about reference (required but unused)
GATK-29 Added doc block to CountIntervals
GATK-31 Added @Output PrintStream to enable -o
GATK-35 Touched up docs
GATK-36 Touched up docs, specified verbosity is optional
GATK-60 Corrected GContent annot module location in gatkdocs
GATK-68 touched up docs and arg docstrings
GATK-16 Added note of caution about calling RODRequiringAnnotations as a group
GATK-61 Added run requirements (num samples, min genotype quality)
Tweaked template and generic doc block formatting (h2 to h3 titles)
GATK-62 Added a caveat to HR annot
Made experimental annotation hidden
GATK-75 Added setup info regarding BWA
GATK-22 Clarified some argument requirements
GATK-48 Clarified -G doc comments
GATK-67 Added arg requirement
GATK-58 Added annotation and usage docs
GSATDG-96 Corrected doc
Updated MD5 for DiffObjectsIntegrationTests (only change is link in table title)
2013-03-12 10:57:14 -04:00
Eric Banks 05e69b6294 Refactoring of SlidingWindow class in RR to reduce complexity and fix important bug.
* Allow RR to write its BAM to stdout by setting required=true for @Output.
  * Fixed bug in sliding window where a break in coverage after a long stretch without
     a variant region was causing a doubling of all the reads before the break.
  * Refactored SlidingWindow.updateHeaderCounts() into 3 separate tested methods.
  * Refactored polyploid consensus code out of SlidingWindow.compressVariantRegion().
2013-03-12 09:06:55 -04:00
Ryan Poplin c96fbcb995 Use the indel heterozygosity prior when calling indels with the HC 2013-03-11 14:12:43 -04:00
Guillermo del Angel 695723ba43 Two features useful for ancient DNA processing.
Ancient DNA sequencing data is in many ways different from modern data, and methods to analyze it need to be adapted accordingly.
Feature 1: Read adaptor trimming. Ancient DNA libraries typically have very short inserts (in the order of 50 bp), so typical Illumina libraries sequenced in, say, 100bp HiSeq will have a large adaptor component being read after the insert.
If this adaptor is not removed, data will not be aligneable. There are third party tools that remove adaptor and potentially merge read pairs, but are cumbersome to use and require precise knowledge of the library construction and adaptor sequence.
-- New walker ReadAdaptorTrimmer walks through paired end data, computes pair overlap and trims auto-detected adaptor sequence.
-- Unit tests added for trimming operation.
-- Utility walker (may be retired later) DetailedReadLengthDistribution computes insert size or read length distribution stratified by read group and mapping status and outputs a GATKReport with data.
-- Renamed MaxReadLengthFilter to ReadLengthFilter and added ability to specify minimum read length as a filter (may be useful if, as a consequence of adaptor trimming, we're left with a lot of very short reads which will map poorly and will just clutter output BAMs).

Feature 2: Unbiased site QUAL estimation: many times ancestral allele status is not known and VCF fields like QUAL, QD, GQ, etc. are affected by the pop. gen. prior at a site. This might introduce subtle biases in studies where a species is aligned against the reference of another species, so an option for UG and HC not to apply such prior is introduced.
-- Added -noPrior argument to StandardCallerArgumentCollection.
-- Added option not to fill priors is such argument is set.
-- Added an integration test.
2013-03-09 18:18:13 -05:00
Yossi Farjoun baad965a57 - Changed loadContaminationFile file parser to delimit by tab only. This allows spaces in sampleIDs, which apparently are allowed.
- This was needed since samples with spaces in their names are regularly found in the picard pipeline.
- Modified the tests to account for this (removed spaces from the good tests, and changed the failing tests accordingly)
- Cleaned up the unit tests using a @DataProvider (I'm in love...).
- Moved AlleleBiasedDownsamplingUtilsUnitTest to public to match location of class it is testing (due to the way bamboo operates)
2013-03-07 13:04:24 -05:00
Eric Banks 3759d9dd67 Added the functionality to impose a relative ordering on ReadTransformers in the GATK engine.
* ReadTransformers can say they must be first, must be last, or don't care.
  * By default, none of the existing ones care about ordering except BQSR (must be first).
    * This addresses a bug reported on the forum where BAQ is incorrectly applied before BQSR.
  * The engine now orders the read transformers up front before applying iterators.
  * The engine checks for enabled RTs that are not compatible (e.g. both must be first) and blows up (gracefully).
  * Added unit tests.
2013-03-06 12:38:59 -05:00
Menachem Fromer 928f646afd Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-03-06 10:01:29 -05:00
Eric Banks 78721ee09b Added new walker to split MNPs into their allelic primitives (SNPs).
* Can be extended to complex alleles at some point.
  * Currently only works for bi-allelics (documented).
  * Added unit and integration tests.
2013-03-05 23:16:42 -05:00
Eric Banks bbbaf9ad20 Revert push from stable (I forgot that pushing from stable overwrites current unstable changes) 2013-03-05 09:06:02 -05:00
Eric Banks a037423225 Merged bug fix from Stable into Unstable 2013-03-05 09:03:48 -05:00
Eric Banks 7e1bfd6a7c Included an accidental change from unstable into the previous push 2013-03-05 09:03:31 -05:00
Eric Banks bd4e4f4ee3 Merged bug fix from Stable into Unstable 2013-03-04 23:24:44 -05:00
Eric Banks b715218bfe Fix for mismatching indel quals erro: need to adjust for softclips just like we do for bases and normal quals. 2013-03-04 23:23:18 -05:00
Ryan Poplin ce7554e9d6 Merged bug fix from Stable into Unstable 2013-03-04 12:36:04 -05:00
Ryan Poplin 0697594778 Active regions that don't contain any usable reads should just be skipped over instead of throwing an IllegalStateException. 2013-03-04 12:35:40 -05:00
Mark DePristo 42d3919ca4 Expanded functionality for writing BAMs from HaplotypeCaller
-- The new code includes a new mode to write out a BAM containing reads realigned to the called haplotypes from the HC, which can be easily visualized in IGV.
-- Previous functionality maintained, with bug fixes
-- Haplotype BAM writing code now lives in utils
-- Created a base class that includes most of the functionality of writing reads realigned to haplotypes onto haplotypes.
-- Created two subclasses, one that writes all haplotypes (previous functionality) and a CalledHaplotypeBAMWriter that will only write reads aligned to the actually called haplotypes
-- Extended PerReadAlleleLikelihoodMap.getMostLikelyAllele to optionally restrict set of alleles to consider best
-- Massive increase in unit tests in AlignmentUtils, along with several new powerful functions for manipulating cigars
-- Fix bug in SWPairwiseAlignment that produces cigar elements with 0 size, and are now fixed with consolidateCigar in AlignmentUtils
-- HaplotypeCaller now tracks the called haplotypes in the GenotypingEngine, and returns this information to the HC for use in visualization.
-- Added extensive docs to HaplotypeCaller on how to use this capability
-- BUGFIX -- don't modify the read bases in GATKSAMRecord in LikelihoodCalculationEngine in the HC
-- Cleaned up SWPairwiseAlignment.  Refactored out the big main and supplementary static methods.  Added a unit test with a bug TODO to fix what seems to be an edge case bug in SW
-- Integration test to make sure we can actually write a BAM for each mode.  This test only ensures that the code runs and doesn't exception out.  It doesn't actually enforce any MD5s
-- HaplotypeBAMWriter also left aligns indels in the reads, as SW can return a random placement of a read against the haplotype.  Calls leftAlign to make the alignments more clear, with unit test of real read to cover this case
-- Writes out haplotypes for both all haplotype and called haplotype mode
-- Haplotype writers now get the active region call, regardless of whether an actual call was made.  Only emitting called haplotypes is moved down to CalledHaplotypeBAMWriter
2013-03-03 12:07:29 -05:00
David Roazen c5c99c8339 Split long-running integration test classes into multiple classes
This is to facilitate the current experiment with class-level test
suite parallelism. It's our hope that with these changes, we can get
the runtime of the integration test suite down to 20 minutes or so.

-UnifiedGenotyper tests: these divided nicely into logical categories
 that also happened to distribute the runtime fairly evenly

-UnifiedGenotyperPloidy: these had to be divided arbitrarily into two
 classes in order to halve the runtime

-HaplotypeCaller: turns out that the tests for complex and symbolic
 variants make up half the runtime here, so merely moving these into
 a separate class was sufficient

-BiasedDownsampling: most of these tests use excessively large intervals
 that likely can't be reduced without defeating the goals of the tests. I'm
 disabling these tests for now until they can either be redesigned to use smaller
 intervals around the variants of interest, or refactored into unit tests
 (creating a JIRA for Yossi for this task)
2013-03-01 13:55:23 -05:00
depristo cac3f80c64 Merge pull request #73 from broadinstitute/eb_remove_nested_hashmap_GSA-732
Replace uses of NestedHashMap with NestedIntegerArray.
2013-02-28 05:19:56 -08:00
Eric Banks d2904cb636 Update docs for RTC. 2013-02-27 14:56:44 -05:00
Eric Banks 69b8173535 Replace uses of NestedHashMap with NestedIntegerArray.
* Removed from codebase NestedHashMap since it is unused and untested.
 * Integration tests change because the BQSR CSV is now sorted automatically.
 * Resolves GSA-732
2013-02-27 14:03:39 -05:00
Alec Wysoker c8368ae2a5 Eliminate 7-element arrays in BaseCounts and BaseAndQualsCount and replace with in-line primitive attributes. This is ugly but reduces heap overhead, and changes are localized. When used in conjunction with Mauricio's FastUtil changes it saves and additional 9% or so of execution time. 2013-02-27 12:49:56 -05:00
David Roazen 752f4335a5 Merged bug fix from Stable into Unstable 2013-02-27 05:20:41 -05:00
David Roazen 2a7af43164 Fix improper dependencies in QScripts used by pipeline tests, and attempt to fix the flawed MisencodedBaseQualityUnitTest
-Some QScripts used by public pipeline tests unnecessarily used the (now protected) UnifiedGenotyper.
 Changed them to use PrintReads instead.

-Moved ExampleUnifiedGenotyperPipelineTest to protected

-Attempt to fix the flawed and sporadically failing MisencodedBaseQualityUnitTest:

   After looking at this class a bit, I think the problem was the use of global arrays for the quals
   shared across all reads in all tests (BAMRecord class definitely does not make a separate copy for
   each read!). One test (testFixBadQuals) modifies the bad quals array, and if this happens to run
   before the testBadQualsThrowsError test the bad quals array will have been "fixed" and no exception
   will be thrown.
2013-02-27 04:45:53 -05:00
David Roazen 6466463d5a Merged bug fix from Stable into Unstable 2013-02-26 21:54:54 -05:00
David Roazen 12a3d7ecad Fix licenses on files modified in 2.4-1 2013-02-26 21:53:17 -05:00
David Roazen a53b4a7521 Merged bug fix from Stable into Unstable 2013-02-26 21:41:13 -05:00
David Roazen 65d31ba4ad Fix runtime public -> protected dependencies in the test suite
-replace unnecessary uses of the UnifiedGenotyper by public integration tests
 with PrintReads

-move NanoSchedulerIntegrationTest to protected, since it's completely dependent
 on the UnifiedGenotyper
2013-02-26 21:19:12 -05:00
depristo 93205154b5 Merge pull request #63 from broadinstitute/eb_fix_pairhmm_unittest_GSA-776
Eb fix pairhmm unittest gsa 776
2013-02-26 11:56:58 -08:00
Eric Banks 734353e9df Merge pull request #60 from broadinstitute/mc_fastutil_GSATDG-83
Brought all of ReduceReads to fastutils
2013-02-26 11:56:41 -08:00
David Roazen 8b29030467 Change default downsampling coverage target for the HaplotypeCaller to 250
-was previously set to 30, which seems far too aggressive given that with
 ActiveRegionWalkers, as with LocusWalkers, this limits the depth of any
 pileup returned by LIBS

-250 is a more conservative default used by the UG

-can adjust down/up later based on further experiments (GSA-699 will
 remain open)

-verified with Ryan that all integration test differences are either
 innocent or represent an improvement

GSA-699
2013-02-26 09:33:25 -05:00
Eric Banks 396b7e0933 Fixed the intermittent PairHMM unit test failure.
The issue here is that the OptimizedLikelihoodTestProvider uses the same basic underlying class as the
BasicLikelihoodTestProvider and we were using the BasicTestProvider functionality to pull out tests of
that class; so if the optimized tests were run first we were unintentionally running those same tests
again with the basic ones (but expecting different results).
2013-02-25 15:05:13 -05:00