Commit Graph

3728 Commits (cd2c5ce1b27df94b3af506d139932c49e4cd371c)

Author SHA1 Message Date
Mark DePristo 56b14be4bc Merge pull request #247 from broadinstitute/eb_fix_RR_negative_header_problem
Fix for the "Removed too many insertions, header is now negative" bug in ReduceReads.
2013-05-29 18:10:19 -07:00
Eric Banks a5a68c09fa Fix for the "Removed too many insertions, header is now negative" bug in ReduceReads.
The problem ultimately was that ReadUtils.readStartsWithInsertion() ignores leading hard/softclips, but
ReduceReads does not.  So I refactored that method to include a boolean argument as to whether or not
clips should be ignored.  Also rebased so that return type is no longer a Pair.
Added unit test to cover this situation.
2013-05-29 16:41:01 -04:00
David Roazen eb206e9f71 Fix confusing log output from the engine
-ReadShardBalancer was printing out an extra "Loading BAM index data for next contig"
 message at traversal end, which was confusing users and making the GATK look stupid.
 Suppress the extraneous message, and reword the log messages to be less confusing.

-Improve log message output when initializing the shard iterator in GenomeAnalysisEngine.
 Don't mention BAMs when the are none, and say "Preparing for traversal" rather than
 mentioning the meaningless-for-users concept of "shard strategy"

-These log messages are needed because the operations they surround might take a
 while under some circumstances, and the user should know that the GATK is actively
 doing something rather than being hung.
2013-05-29 16:17:04 -04:00
David Roazen a7cb599945 Require a minimum dcov value of 200 for Locus and ActiveRegion walkers when downsampling to coverage
-Throw a UserException if a Locus or ActiveRegion walker is run with -dcov < 200,
 since low dcov values can result in problematic downsampling artifacts for locus-based
 traversals.

-Read-based traversals continue to have no minimum for -dcov, since dcov for read traversals
 controls the number of reads per alignment start position, and even a dcov value of 1 might
 be safe/desirable in some circumstances.

-Also reorganize the global downsampling defaults so that they are specified as annotations
 to the Walker, LocusWalker, and ActiveRegionWalker classes rather than as constants in the
 DownsamplingMethod class.

-The default downsampling settings have not been changed: they are still -dcov 1000
 for Locus and ActiveRegion walkers, and -dt NONE for all other walkers.
2013-05-29 12:07:12 -04:00
Mark DePristo d167743852 Archived banded logless PairHMM
BandedHMM
---------
-- An implementation of a linear runtime, linear memory usage banded logless PairHMM.  Thought about 50% faster than current PairHMM, this implementation will be superceded by the GraphHMM when it becomes available.  The implementation is being archived for future reference

Useful infrastructure changes
-----------------------------
-- Split PairHMM into a N2MemoryPairHMM that allows smarter implementation to not allocate the double[][] matrices if they don't want, which was previously occurring in the base class PairHMM
-- Added functionality (controlled by private static boolean) to write out likelihood call information to a file from inside of LikelihoodCalculationEngine for using in unit or performance testing.  Added example of 100kb of data to private/testdata.  Can be easily read in with the PairHMMTestData class.
-- PairHMM now tracks the number of possible cell evaluations, and the LoglessCachingPairHMM updates the nCellsEvaluated so we can see how many cells are saved by the caching calculation.
2013-05-22 12:24:00 -04:00
delangel 925232b0fc Merge pull request #236 from broadinstitute/md_simple_hc_performance_improvements
3 simple performance improvements for HaplotypeCaller
2013-05-22 07:58:28 -07:00
Eric Banks 881b2b50ab Optimized counting of filtered records by filter.
Don't map class to counts in the ReadMetrics (necessitating 2 HashMap lookups for every increment).
Instead, wrap the ReadFilters with a counting version and then set those counts only when updating global metrics.
2013-05-21 21:54:49 -04:00
Mark DePristo 010034a650 Optimization/bugfix for PerReadAlleleLikelihoodMap
-- Add() call had a misplaced map.put call, so that we were always putting the result of get() back into the map, when what we really intended was to only put the value back in if the original get() resulted in a null and so initialized the result
2013-05-21 16:18:57 -04:00
Mark DePristo a1093ad230 Optimization for ActiveRegion.removeAll
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion.  This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element.   New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set.  Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
2013-05-21 16:18:57 -04:00
Mark DePristo d9cdc5d006 Optimization: track alleles in the PerReadAlleleLikelihoodMap with a HashSet
-- The previous version of PerReadAlleleLikelihoodMap only stored the alleles in an ArrayList, and used ArrayList.contains() to determine if an allele was already present in the map.  This is very slow with many alleles.  Now keeps both the ArrayList (for get() performance) and a Set of alleles for contains().
2013-05-21 16:18:56 -04:00
Eric Banks 20c7a89030 Fixes to get accurate read counts for Read traversals
1. Don't clone the dataSource's metrics object (because then the engine won't continue to get updated counts)
 2. Use the dataSource's metrics object in the CountingFilteringIterator and not the first shard's object!
 3. Synchronize ReadMetrics.incrementMetrics to prevent race conditions.

Also:
 * Make sure users realize that the read counts are approximate in the print outs.
 * Removed a lot of unused cruft from the metrics object while I was in there.
 * Added test to make sure that the ReadMetrics read count does not overflow ints.
 * Added unit tests for traversal metrics (reads, loci, and active region traversals); these test counts of reads and records.
2013-05-21 15:24:07 -04:00
Eric Banks 58f4b81222 Count Reads should use a Long instead of an Integer for counts to prevent overflows. Added unit test. 2013-05-21 15:23:51 -04:00
Mark DePristo 62fc88f92e CombineVariants no longer adds PASS to unfiltered records
-- [Delivers #49876703]
-- Add integration test and test file
-- Update SymbolicAlleles combine variant tests, which was turning unfiltered records into PASS!
2013-05-20 16:53:51 -04:00
Eric Banks 8a442d3c9f @Output needs to be required for LiftoverVariants to prevent a NPE and documentation needed updating. 2013-05-17 10:04:10 -04:00
Yossi Farjoun 3e2a0b15ed - Added a @Hidden option ( -outputInsertLength ) to PileupWalker that causes it to emit insert sizes together with the pileup (to assist Mark Daly's investigation of the contamination dependance on insert length)
- Converted my old GATKBAMIndexText (within PileupWalkerIntegrationTest) to use a dataProvider
- Added two integration tests to test -outputInsertLength option
2013-05-16 12:47:16 -04:00
Mark DePristo 371f3752c1 Subshard timeouts in the GATK
-- The previous implementation of the maxRuntime would require us to wait until all of the work was completed within a shard, which can be a substantial amount of work in the case of a locus walker with 16kb shards.
-- This implementation ensures that we exit from the traversal very soon after the max runtime is exceeded, without completely all of our work within the shard.  This is done by updating all of the traversal engines to return false for hasNext() in the nano scheduled input provider.  So as soon as the timeout is exceeeded, we stop generating additional data to process, and we only have to wait until the currently executing data processing unit (locus, read, active region) completes.
-- In order to implement this timeout efficiently at this fine scale, the progress meter now lives in the genome analysis engine, and the exceedsTimeout() call in the engine looks at a periodically updated runtime variable in the meter.  This variable contains the elapsed runtime of the engine, but is updated by the progress meter daemon thread so that the engine doesn't call System.nanotime() in each cycle of the engine, which would be very expense.  Instead we basically wait for the daemon to update this variable, and so our precision of timing out is limited by the update frequency of the daemon, which is on the order of every few hundred milliseconds, totally fine for a timeout.
-- Added integration tests to ensure that subshard timeouts are working properly
2013-05-15 07:00:39 -04:00
Mark DePristo 43e78286a0 Merge pull request #226 from broadinstitute/hc_ceu_trio_calling
Trivial update to ceutrio.ped file to make it really the CEU trio samples
2013-05-14 17:02:52 -07:00
Yossi Farjoun 409a202492 Merge pull request #214 from broadinstitute/chartl_genotype_concordance_diploid_and_OGC
Add overall genotype concordance to the genotype concordance tool. In ad...
2013-05-14 14:19:54 -07:00
Mark DePristo 7d78a77f17 Trivial update to ceutrio.ped file to make it really the CEU trio sample names 2013-05-14 17:08:13 -04:00
Mark DePristo 39e4396de0 New ActiveRegionShardBalancer allows efficient NanoScheduling
-- Previously we used the LocusShardBalancer for the haplotype caller, which meant that TraverseActiveRegions saw its shards grouped in chunks of 16kb bits on the genome.  These locus shards are useful when you want to use the HierarchicalMicroScheduler, as they provide fine-grained accessed to the underlying BAM, but they have two major drawbacks (1) we have to fairly frequently reset our state in TAR to handle moving between shard boundaries and (2) with the nano scheduled TAR we end up blocking at the end of each shard while our threads all finish processing.
-- This commit changes the system over to using an ActiveRegionShardBalancers, that combines all of the shard data for a single contig into a single combined shard.  This ensures that TAR, and by extensions the HaplotypeCaller, gets all of the data on a single contig together so the the NanoSchedule runs efficiently instead of blocking over and over at shard boundaries.  This simple change allows us to scale efficiently to around 8 threads in the nano scheduler:
  -- See https://www.dropbox.com/s/k7f280pd2zt0lyh/hc_nano_linear_scale.pdf
  -- See https://www.dropbox.com/s/fflpnan802m2906/hc_nano_log_scale.pdf
-- Misc. changes throughout the codebase so we Use the ActiveRegionShardBalancer where appropriate.
-- Added unit tests for ActiveRegionShardBalancer to confirm it does the merging as expected.
-- Fix bad toString in FilePointer
2013-05-13 11:09:02 -04:00
Mark DePristo b4f482a421 NanoScheduled ActiveRegionTraversal and HaplotypeCaller
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
  -- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
  -- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
2013-05-13 11:09:02 -04:00
Eric Banks 2f5ef6db44 New faster Smith-Waterman implementation that is edge greedy and assumes that ref and haplotype have same global start/end points.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
   * A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
     right thing for indels at the edges of the alignments.
     * Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
   * Lots of systematic testing added for this implementation.
   * NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
2013-05-13 09:36:39 -04:00
David Roazen 639030bd6d Enable convenient display of diff engine output in Bamboo, plus misc. minor test-related improvements
-Diff engine output is now included in the actual exception message thrown as a
 result of an MD5 mismatch, which allows it to be conveniently viewed on the
 main page of a build in Bamboo.

Minor Additional Improvements:

-WalkerTestSpec now auto-detects test class name via new JVMUtils.getCallingClass()
 method, and the test class name is now included as a regular part of integration
 test output for each test.

-Fix race condition in MD5DB.ensureMd5DbDirectory()

-integrationtests dir is now cleaned by "ant clean"

GSA-915 #resolve
2013-05-10 19:00:33 -04:00
Mark DePristo fa8a47ceef Replace DeBruijnAssembler with ReadThreadingAssembler
Problem
-------
The DeBruijn assembler was too slow.  The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp).  This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.

Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers.  The algorithm operates as follows:

identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
  find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
  for each base in the sequence from the starting vertex kmer:
    look at the existing outgoing nodes of current vertex V.  If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
    If no matching next vertex exists, find a unique vertex with kmer K.  If one exists, merge the sequence into this vertex, and continue
    If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue

This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size.  This allows us to assemble well with even very short kmers.

This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:

-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples.  This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor.  This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization.  This change is essential for us to get good variants from our paths when the kmer size is small.  It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation.  Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary.  This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler

Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations.  This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate.  Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
2013-05-08 21:41:42 -04:00
Chris Hartl d3c9910af6 Cosmetic changes (comments and variable names) to GenotypeConcordance and ConcordanceMetrics to address reviewer comments. 2013-05-08 17:25:14 -04:00
sathibault d79b5f0931 Adding Convey HC-1 HMM acceleration 2013-05-08 11:01:20 -05:00
Chris Hartl 6ff74deac7 Add overall genotype concordance to the genotype concordance tool. In addition, protect from non-diploid genotypes, which can cause very strange behavior.
Update MD5 sums. As expected, md5 changes are consistent with the genotype concordance field being added to each output.
2013-05-06 13:06:30 -04:00
chartl 98021db264 Merge pull request #208 from broadinstitute/yf_fix_molten_GenotypeConcordance
- Fixed a small bug in the printout of molten data in GenotypeConcordanc...
2013-05-06 08:42:06 -07:00
Mark DePristo f42bb86bdd e# This is a combination of 2 commits.
Only try to clip adaptors when both reads of the pair are on opposite strands

-- Read pairs that have unusual alignments, such as two reads both oriented like:

  <-----
     <-----

where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs.  This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
2013-05-03 11:19:14 -04:00
Mark DePristo 0587a145bf Utils.dupString should allow 0 number of duplicates to produce empty string 2013-05-03 09:32:05 -04:00
Mark DePristo f5a301fb63 Bugfix for AlignmentUtils.trimCigarByBases
-- Previous version would trim down 2M2D2M into 2M if you asked for the first 2 bases, but this can result in incorrect alignment of the bases to the reference as the bases no longer span the full reference interval expected.  Fixed and added unit tests
2013-05-03 09:32:05 -04:00
Mark DePristo 2bcbdd469f leftAlignCigarSequentially now supports haplotypes with insertions and deletions where the deletion allele was previously removed by the leftAlignSingleIndel during it's cleanup phase. 2013-05-03 09:32:05 -04:00
Yossi Farjoun 4b8b411b92 - Fixed a small bug in the printout of molten data in GenotypeConcordance
Output didn't "mix-up" the genotypes, it outputed the same HET vs HET (e.g.) 3 times rather than the combinations of HET vs {HET, HOM, HOM_REF}, etc.
This was only a problem in the text, _not_ the actual numbers, which were outputted correctly.

- Updated MD5's after looking at diffs to verify that the change is what I expected.
2013-05-02 09:16:07 -04:00
David Roazen f3c94a3c87 Update expected test output for Java 7
-Changes in Java 7 related to comparators / sorting produce a large number
 of innocuous differences in our test output. Updating expectations now
 that we've moved to using Java 7 internally.

-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
 intermittent failures.
2013-05-01 16:18:01 -04:00
David Roazen f57256b6c2 Delete unused FastaSequenceIndexBuilder class and accompanying test
This class, being unused, was no longer getting packaged into the
GATK release jar by bcel, and so attempting to run its unit test
on the release jar was producing an error.
2013-05-01 01:02:01 -04:00
Eric Banks 58424e56be Setting the reduce reads count tag was all wrong in a previous commit; fixing.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly.  Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.

The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly.  Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).

Also:
1. counts are now maintained as ints whenever possible.  Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
2013-04-30 13:45:42 -04:00
Mark DePristo 73fcacbf1b Change Long to long 2013-04-30 09:21:10 -04:00
Yossi Farjoun 0e7e6d35d8 GATKBAMIndex calls buffer.length() on every read. This is causing much pain.
Optimized by getting the read of the file upon opening the index-file and using that instead.
2013-04-29 12:49:02 -04:00
Mark DePristo 0387ea8df9 Bugfix for ReadClipper with ReducedReads
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts.  Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly.  Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
2013-04-29 11:12:09 -04:00
Mark DePristo 759c531d1b Merge pull request #197 from broadinstitute/dr_disable_snpeff_version_check
Add support for snpEff "GATK compatibility mode" (-o gatk)
2013-04-26 13:55:14 -07:00
David Roazen 7d90bbab08 Add support for snpEff "GATK compatibility mode" (-o gatk)
-Do not throw an exception when parsing snpEff output files
 generated by not-officially-supported versions of snpEff,
 PROVIDED that snpEff was run with -o gatk

-Requested by the snpEff author

-Relevant integration tests updated/expanded
2013-04-26 15:47:15 -04:00
Mark DePristo 071fd67d55 Merge pull request #193 from broadinstitute/eb_contamination_fixing_for_reduced_reads
Eb contamination fixing for reduced reads
2013-04-26 09:48:45 -07:00
Mark DePristo 92a6c7b561 Merge pull request #195 from broadinstitute/eb_exclude_sample_file_bug_in_select_variants
Fixed bug reported on the forum where using the --exclude_sample_file ar...
2013-04-26 09:47:38 -07:00
Eric Banks 360e2ba87e Fixed bug reported on the forum where using the --exclude_sample_file argument in SV was giving bad results.
Added integration test.
https://www.pivotaltracker.com/s/projects/793457/stories/47399245
2013-04-26 12:23:11 -04:00
Eric Banks ba2c3b57ed Extended the allele-biased down-sampling functionality to handle reduced reads.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.

Added lots of unit tests for new functionality.
2013-04-26 11:23:17 -04:00
Mark DePristo 528c3d083a Merge pull request #191 from broadinstitute/dr_fix_rod_system_locking
Detect stuck lock-acquisition calls, and disable file locking for tests
2013-04-25 09:32:54 -07:00
Mark DePristo d20be41fee Bugfix for FragmentUtils.mergeOverlappingPairedFragments
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences.  If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference.  Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
2013-04-25 11:11:15 -04:00
David Roazen 4d56142163 Detect stuck lock-acquisition calls, and disable file locking for tests
-Acquire file locks in a background thread with a timeout of 30 seconds,
 and throw a UserException if a lock acquisition call times out

    * should solve the locking issue for most people provided they
      RETRY failed farm jobs

    * since we use NON-BLOCKING lock acquisition calls, any call that
      takes longer than a second or two indicates a problem with the
      underlying OS file lock support

    * use daemon threads so that stuck lock acquisition tasks don't
      prevent the JVM from exiting

-Disable both auto-index creation and file locking for integration tests
 via a hidden GATK argument --disable_auto_index_creation_and_locking_when_reading_rods

    * argument not safe for general use, since it allows reading from
      an index file without first acquiring a lock

    * this is fine for the test suite, since all index files already
      exist for test files (or if they don't, they should!)

-Added missing indices for files in private/testdata

-Had to delete most of RMDTrackBuilderUnitTest, since it mostly tested auto-index
 creation, which we can't test with locking disabled, but I replaced the deleted
 tests with some tests of my own.

-Unit test for FSLockWithShared to test the timeout feature
2013-04-24 22:49:02 -04:00
Eric Banks 379a9841ce Various bug fixes for recent Reduce Reads additions plus solution implemented for low MQ reads.
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions.  Then we get the
best of both worlds.  As a note, coverage refers to just the individual base counts and not the entire pileup.

2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.

3. Each consensus keeps track of its own number of softclipped bases.  There was no reason that that number
should be shared between them.

4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now.  Don't lose that
information.  Maybe we'll decide to change this in the future, but for now we are conservative.

5. Also implemented various small performance optimizations based on profiling.

Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
2013-04-24 18:18:50 -04:00
Mark DePristo df90597bfc Performance optimizations and caliper benchmarking code for consolidateCigar
-- Now that this function is used in the core of LIBS it needed some basic optimizations, which are now complete, pass all unit tests.
-- Added caliper benchmark for AlignmentUtils to assess performance (showing new version is 3x-10x faster)
-- Remove unused import in ReadStateManager
2013-04-24 11:36:43 -04:00
Eric Banks 3477e092ea Minor: bump up the amount of cached log10 data in MathUtils so that Monkol can actually call 50K samples. 2013-04-19 08:39:08 -04:00
Eric Banks 5bce0e086e Refactored binomial probability code in MathUtils.
* Moved redundant code out of UGEngine
  * Added overloaded methods that assume p=0.5 for speed efficiency
  * Added unit test for the binomialCumulativeProbability method
2013-04-16 18:19:07 -04:00
Eric Banks df189293ce Improve compression in Reduce Reads by incorporating probabilistic model and global het compression
The Problem:
  Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
  regions in an exome) causes RR (with default settings) to consider it a variant region.  This
  seriously hurts compression performance.

The Solution:
  1. We now use a probabilistic model for determining whether we can create a consensus (in other
  words, whether we can error correct a site) instead of the old ratio threshold.  We calculate
  the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
  that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
  2. We also allow het compression globally, not just at known sites.  So if we cannot create a
  consensus at a given site then we try to perform het compression; and if we cannot perform het
  compression that we just don't reduce the variant region.  This way very wonky regions stay
  uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
  locus get het compressed.

Details:
  1. -minvar is now deprecated in favor of -min_pvalue.
  2. Added integration test for bad pvalue input.
  3. -known argument still works to force het compression only at known sites; if it's not included
     then we allow het compression anywhere.  Added unit tests for this.
  4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
     Before finalizing het compression, we now check for insertions or other variant regions (usually due
     to multi-allelics) which can render a region incompressible (and we back out if we find one).  We
     were checking for excessive softclips before, but now we add these tests too.
  5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
     consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
     out instead of backing out all of them.
  6. We no longer create a mini read at the stop of the variant window for het compression.  Instead, we
     allow it to be part of the next global consensus.
  7. The coverage test is no longer run systematically on all integration tests because the quals test
     supercedes it.  The systematic quals test is now much stricter in order to catch bugs and edge cases
     (very useful!).
  8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
     for a consensus was affected by good and bad bases/reads).
  9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
     This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
  10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
     with insertions from a header.

Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
2013-04-16 18:19:06 -04:00
Geraldine Van der Auwera e176fc3af1 Merge pull request #159 from broadinstitute/md_bqsr_ion
Trivial BQSR bug fixes and improvement
2013-04-16 08:54:47 -07:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Guillermo del Angel a971e7ab6d Several improvements to ReadAdaptorTrimmer so that it can be incorporated into ancient DNA processing pipelines (for which it was developed):
-- Add pair cleaning feature. Reads in query-name sorted order are required and pairs need to appear consecutively, but if -cleanPairs option is set, a malformed pair where second read is missing is just skipped instead of erroring out.
-- Add integration tests
-- Move walker to public
2013-04-13 13:41:36 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mauricio Carneiro 3960733c88 Fix PrintReads out of space issue
Problem:
--------
Print Reads was running out of disk space when using the -BQSR option even for small bam files

Solution:
---------
Configure setupWriter to expect pre sorted reads
2013-04-09 08:19:52 -04:00
Mark DePristo 1b36db8940 Make ActiveRegionTraversal robust to excessive coverage
-- Add a maximum per sample and overall maximum number of reads held in memory by the ART at any one time.  Does this in a new TAROrderedReadCache data structure that uses a reservior downsampler to limit the total number of reads to a constant amount.  This constant is set to be by default 3000 reads * nSamples to a global maximum of 1M reads, all controlled via the ActiveRegionTraversalParameters annotation.
-- Added an integration test and associated excessively covered BAM excessiveCoverage.1.121484835.bam (private/testdata) that checks that the system is operating correctly.
-- #resolves GSA-921
2013-04-08 15:48:19 -04:00
Mark DePristo 317dc4c323 Add size() method to Downsampler interface
-- This method provides client with the current number of elements, without having to retreive the underlying list<T>.  Added unit tests for LevelingDownsampler and ReservoirDownsampler as these are the only two complex ones.  All of the others are trivially obviously correct.
2013-04-08 15:48:13 -04:00
Mark DePristo 21410690a2 Address reviewer comments 2013-04-08 12:48:20 -04:00
Mark DePristo 6d22485a4c Critical bugfix to ReduceRead functionality of the GATKSAMRecord
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5].  The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding.  Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i.  Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
2013-04-08 12:47:50 -04:00
Mark DePristo 3a19266843 Fix residual merge conflicts 2013-04-08 12:47:50 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 7105ad65a6 Remove the capability of EventMap to emit symbolic alleles for unassembled events
-- These events always occur on the very edge of the haplotypes, and are intrinsically dodgy.  So instead of emitting them and then potentially having to deal with merging real basepair events into them we just no longer emit those events.
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 167cd49e71 Added -forceActive argument to ActiveRegionWalkers
-- Causes the ART tool to treat all bases as active.   Useful for debugging
2013-04-08 12:47:48 -04:00
Mark DePristo 8656bd5e29 Haplotype now consolidates cigars in setCigar
-- This fixes edge base bugs where non-consolidated cigars are causing problems in users of the Haplotype object.  Input arguments are now checks (let's see if we blow up)
2013-04-08 12:47:47 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mark DePristo b7d59ea13b LIBS unit test debugging should be false 2013-04-08 12:47:47 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Eric Banks 6253ba164e Using --keepOriginalAC in SelectVariants was causing it to emit bad VCFs
* This occurred when one or more alleles were lost from the record after selection
  * Discussed here: http://gatkforums.broadinstitute.org/discussion/comment/4718#Comment_4718
  * Added some integration tests for --keepOriginalAC (there were none before)
2013-04-05 00:53:28 -04:00
Eric Banks 7897d52f32 Don't allow users to specify keys and IDs that contain angle brackets or equals signs (not allowed in VCF spec).
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
  * This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
  * Added integration test to confirm failure with User Error
  * Removed illegal header line in KB test VCF that was causing related tests to fail.
2013-04-05 00:52:32 -04:00
Eric Banks 14bbba0980 Optimization to method for getting values in ArgumentMatch
* Very trivial, but I happened to see this code and it drove me nuts so I felt compelled to refactor it.
  * Instead of iterating over keys in map to get the values, just iterate over the values...
2013-04-04 23:30:47 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
David Roazen 2eac97a76c Remove auto-creation of fai/dict files for fasta references
-A UserException is now thrown if either the fai or dict file for the
 reference does not exist, with pointers to instructions for creating
 these files.

-Gets rid of problematic file locking that was causing intermittent
 errors on our farm.

-Integration tests to verify that correct exceptions are thrown in
 the case of a missing fai / dict file.

GSA-866 #resolve
2013-04-02 18:34:08 -04:00
Mark DePristo e7a8e6e8ee Merge pull request #140 from broadinstitute/dr_interval_intersection_bug_GSA-909
Intervals: fix bug where we could fail to find the intersection of unsorted/missorted interval lists
2013-04-02 11:59:01 -07:00
David Roazen 5baf906c28 Intervals: fix bug where we could fail to find the intersection of unsorted/missorted interval lists
-The algorithm for finding the intersection of two sets of intervals
 relies on the sortedness of the intervals within each set, but the engine
 was not sorting the intervals before attempting to find the intersection.

-The result was that if one or both interval lists was unsorted / lexicographically
 sorted, we would often fail to find the intersection correctly.

-Now the IntervalBinding sorts all sets of intervals before returning them,
 solving the problem.

-Added an integration test for this case.

GSA-909 #resolve
2013-04-02 14:01:52 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Mark DePristo 7c83efc1b9 Merge pull request #135 from broadinstitute/mc_pgtag_fix
Fixing @PG tag uniqueness issue
2013-03-31 11:36:40 -07:00
Guillermo del Angel 9686e91a51 Added small feature to VariantFiltration to filter sites outside of a given mask:
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
2013-03-31 08:48:16 -04:00
Mauricio Carneiro ec475a46b1 Fixing @PG tag uniqueness issue
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".

How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.

Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter

Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31

Issue Tracker:
--------------
[fixes 47100885]
2013-03-30 20:31:33 -04:00
Mauricio Carneiro 52e67a6973 ReviewedStingException -> IllegalStateException 2013-03-30 20:11:55 -04:00
Guillermo del Angel 6b8bed34d0 Big bad bug fix: feature added to LeftAlignAndTrimVariants to left align multiallelic records didn't work.
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
2013-03-30 19:31:28 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
Guillermo del Angel 8fbf9c947f Upgrades and changes to LeftAlignVariants, motivated by 1000G consensus indel production:
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
2013-03-29 10:02:06 -04:00
Chris Hartl 73d1c319bf Rarely-occurring logic bugfix for GenotypeConcordance, streamlining and testing of MathUtils
Currently, the multi-allelic test is covering the following case:

Eval   A   T,C
Comp   A   C

reciprocate this so that the reverse can be covered.

Eval   A   C
Comp   A   T,C

And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.

This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:

Eval:   A  G,T      0/0   2/0   2/2   1/1
Comp:   A  C,T      0/0   1/0   0/0   0/0

Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:

Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)

Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.

Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
 - dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
 - vectorSum
 - array shuffle, random subset
 - countOccurances (general forms, the char form is used in the codebase)
 - getNMaxElements
 - array permutation
 - sorted array permutation
 - compare floats
 - sum() (for integer arrays and lists).

Final keyword was extensively added to MathUtils.

The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).

The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.

In addition, more extensive tests were added for
 - logBinomialCoefficient (Newton's identity should always hold)
 - logFactorial
 - log10sumlog10 and its approximation

All unit tests pass
2013-03-28 23:25:28 -04:00
MauricioCarneiro a2b69790a6 Merge pull request #128 from broadinstitute/eb_rr_polyploid_compression_GSA-639 2013-03-28 06:39:43 -07:00
Mark DePristo 12475cc027 Display the active MappingQualityFilter if mmq > 0 in the HaplotypeCaller 2013-03-26 14:27:18 -04:00
Mark DePristo ad04fdb233 PerReadAlleleLikelihoodMap getMostLikelyAllele returns an MostLikelyAllele objects now
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users.  The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not.  That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves.  There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second.  For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads.   All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event.  In this case our annotations will all fall apart, returning their default values.  Added a JIRA to address this (should be discussed in group meeting)
2013-03-26 14:27:13 -04:00
Eric Banks 593d3469d4 Refactored the het (polyploid) consensus creation in ReduceReads.
* It is now cleaner and easier to test; added tests for newly implemented methods.
 * Many fixes to the logic to make it work
   * The most important change was that after triggering het compression we actually need to back it out if it
      creates reads that incorporated too many softclips at any one position (because they get unclipped).
   * There was also an off-by-one error in the general code that only manifested itself with het compression.
 * Removed support for creating a het consensus around deletions (which was broken anyways).
   * Mauricio gave his blessing for this.
 * Het compression now works only against known sites (with -known argument).
    * The user can pass in one or more VCFs with known SNPs (other variants are ignored).
    * If no known SNPs are provided het compression will automatically be disabled.
 * Added SAM tag to stranded (i.e. het compressed) reduced reads to distinguish their
   strandedness from normal reduced reads.
    * GATKSAMRecord now checks for this tag when determining whether or not the read is stranded.
    * This allows us to update the FisherStrand annotation to count het compressed reduced reads
       towards the FS calculation.
    * [It would have been nice to mark the normal reads as unstranded but then we wouldn't be
       backwards compatible.]
    * Updated integration tests accordingly with new het compressed bams (both for RR and UG).
 * In the process of fixing the FS annotation I noticed that SpanningDeletions wasn't handling
   RR properly, so I fixed it too.
    * Also, the test in the UG engine for determining whether there are too many overlapping
       deletions is updated to handle RR.
 * I added a special hook in the RR integration tests to additionally run the systematic
   coverage checking tool I wrote earlier.
    * AssessReducedCoverage is now run against all RR integration tests to ensure coverage is
       not lost from original to reduced bam.
    * This helped uncover a huge bug in the MultiSampleCompressor where it would drop reads
       from all but 1 sample (now fixed).
    * AssessReducedCoverage moved from private to protected for packaging reasons.
 * #resolve GSA-639

At this point, this commit encompasses most of what is needed for het compression to go live.
There are still a few TODO items that I want to get in before the 2.5 release, but I will save
those for a separate branch because as it is I feel bad for the person who needs to review all
these changes (sorry, Mauricio).
2013-03-25 09:34:54 -04:00
Mauricio Carneiro eb33da6820 Added support to reduce reads to Callable Loci
-- added calls to representativeCount() of the pileup instead of using ++
-- renamed CallableLoci integration test
-- added integration test for reduce read support on callable loci
2013-03-21 15:53:04 -04:00
Mark DePristo 7ae15dadbe HC now by default only uses reads with MAPQ >= 20 for assembly and calling
-- Previously we tried to include lots of these low mapping quality reads in the assembly and calling, but we effectively were just filtering them out anyway while generating an enormous amount of computational expense to handle them, as well as much larger memory requirements.  The new version simply uses a read filter to remove them upfront.  This causes no major problems -- at least, none that don't have other underlying causes -- compared to 10-11mb of the KB
-- Update MD5s to reflect changes due to no longer including mmq < 20 by default
2013-03-21 13:10:50 -04:00
Mark DePristo 3a8f001c27 Misc. fixes upon pull request review
-- DeBruijnAssemblerUnitTest and AlignmentUtilsUnitTest were both in DEBUG = true mode (bad!)
-- Remove the maxHaplotypesToConsider feature of HC as it's not useful
2013-03-20 22:54:37 -04:00
Mark DePristo 98c4cd060d HaplotypeCaller now uses SeqGraph instead of kmer graph to build haplotypes.
-- DeBruijnAssembler functions are no longer static.  This isn't the right way to unit test your code
-- An a HaplotypeCaller command line option to use low-quality bases in the assembly
-- Refactored DeBruijnGraph and associated libraries into base class
-- Refactored out BaseEdge, BaseGraph, and BaseVertex from DeBruijn equivalents.  These DeBruijn versions now inherit from these base classes.  Added some reasonable unit tests for the base and Debruijn edges and vertex classes.
-- SeqVertex: allows multiple vertices in the sequence graph to have the same sequence and yet be distinct
-- Further refactoring of DeBruijnAssembler in preparation for the full SeqGraph <-> DeBruijnGraph split
-- Moved generic methods in DeBruijnAssembler into BaseGraph
-- Created a simple SeqGraph that contains SeqVertex objects
-- Simple chain zipper for SeqGraph that reproduces the results for the mergeNode function on DeBruijnGraphs
-- A working version of the diamond remodeling algorithm in SeqGraph that converts graphs that look like A -> Xa, A -> Ya, Xa -> Z, Ya -> Z into A -> X -> a, A -Y -> a, a -> Z
-- Allow SeqGraph zip merging of vertices where the in vertex has multiple incoming edges or the out vertex has multiple outgoing edges
-- Fix all unit tests so they work with the new SeqGraph system.  All tests passed without modification.
-- Debugging makes it easier to tell which kmer graph contributes to a haplotype
-- Better docs and unit tests for BaseVertex, SeqVertex, BaseEdge, and KMerErrorCorrector
-- Remove unnecessary printing of cleaning info in BaseGraph
-- Turn off kmer graph creation in DeBruijnAssembler.java
-- Only print SeqGraphs when debugGraphTransformations is set to true
-- Rename DeBruijnGraphUnitTest to SeqGraphUnitTest.  Now builds DeBruijnGraph, converts to SeqGraph, uses SeqGraph.mergenodes and tests for equality.
-- Update KBestPathsUnitTest to use SeqGraphs not DebruijnGraphs
-- DebruijnVertex now longer takes kmer argument -- it's implicit that the kmer length is the sequence.length now
2013-03-20 22:54:36 -04:00
Mark DePristo ffea6dd95f HaplotypeCaller now has the ability to only consider the best N haplotypes for genotyping
-- Added a -dontGenotype mode for testing assembly efficiency
-- However, it looks like this has a very negative impact on the quality of the results, so the code should be deleted
2013-03-20 22:54:36 -04:00
Mark DePristo a8fb26bf01 A generic downsampler that reduces coverage for a bunch of reads
-- Exposed the underlying minElementsPerStack parameter for LevelingDownsampler
2013-03-20 22:54:35 -04:00
Mark DePristo 752440707d AlignmentUtils.calcNumDifferentBases computes the number of bases that differ between a reference and read sequence given a cigar between the two. 2013-03-20 22:54:35 -04:00
Geraldine Van der Auwera d70bf64737 Created new DeprecatedToolChecks class
--Based on existing code in GenomeAnalysisEngine
	--Hashmaps hold mapping of deprecated tool name to version number and recommended replacement (if any)
	--Using FastUtils for maps; specifically Object2ObjectMap but there could be a better type for Strings...
	--Added user exception for deprecated annotations
	--Added deprecation check to AnnotationInterfaceManager.validateAnnotations
	--Run when annotations are initialized
	--Made annotation sets instead of lists
2013-03-20 06:46:02 -04:00
Geraldine Van der Auwera 6b4d88ebe9 Created ListAnnotations utility (extends CommandLineProgram)
--Refactored listAnnotations basic method out of VA into HelpUtils
	--HelpUtils.listAnnotations() is now called by both VA and the new ListAnnotations utility (lives in sting.tools)
	--This way we keep the VA --list option but we also offer a way to list annotations without a full valid VA command-line, which was a pain users continually complained about
	--We could get rid of the VA --list option altogether ...?
2013-03-20 06:15:27 -04:00
Geraldine Van der Auwera 95a9ed853d Made some documentation updates & fixes
--Mostly doc block tweaks
	--Added @DocumentedGATKFeature to some walkers that were undocumented because they were ending up in "uncategorized". Very important for GSA: if a walker is in public or protected, it HAS to be properly tagged-in. If it's not ready for the public, it should be in private.
2013-03-20 06:15:20 -04:00
Mark DePristo d7bec9eb6e AssessNA12878 bugfixes
-- @Output isn't required for AssessNA12878
-- Previous version would could non-variant sites in NA12878 that resulted from subsetting a multi-sample VC to NA12878 as CALLED_BUT_NOT_IN_DB sites.  Now they are properly skipped
-- Bugfix for subsetting samples to NA12878.  Previous version wouldn't trim the alleles when subsetting down a multi-sample VCF, so we'd have false FN/FP sites at indels when the multi-sample VCF has alleles that result in the subset for NA12878 having non-trimmed alleles.  Fixed and unit tested now.
2013-03-18 15:48:08 -04:00
Ami Levy-Moonshine 0e9c1913ff fix typos in argument docs and in printed output in CoveredByNSamplesSites and rewrite an unaccurate comment 2013-03-18 13:54:21 -04:00
Mark DePristo 2b80068164 Merged bug fix from Stable into Unstable 2013-03-18 12:36:21 -04:00
Mark DePristo 7ab7c873a1 Temp. to PairHMM to avoid bad likelihoods
-- Simply caps PairHMM likelihoods from rising above 0 by taking the min of the likelihood and 0.  Will be properly fixed in GATK 2.5 with better PairHMM implementation.
2013-03-18 12:34:51 -04:00
David Roazen a67d8c8dd6 Bump timeout for MaxRuntimeIntegrationTest
Looks like returning this timeout to its original value was a
bit too aggressive -- adding 40 seconds to the tolerance limit.
2013-03-17 16:17:29 -04:00
David Roazen 742a7651e9 Further tweaking of test timeouts
Increase one timeout, restore others that were only timing out due to the
Java crypto lib bug to their original values.

-DOUBLE timeout for NanoSchedulerUnitTest.testNanoSchedulerInLoop()

-REDUCE timeout for EngineFeaturesIntegrationTest to its original value

-REDUCE timeout for MaxRuntimeIntegrationTest to its original value

-REDUCE timeout for GATKRunReportUnitTest to its original value
2013-03-15 14:49:21 -04:00
Mark DePristo 8317cc155e Merge pull request #108 from broadinstitute/eb_bqsr_out_of_bounds_fix
Added check in the MalformedReadFilter for reads without stored bases (i...
2013-03-14 17:29:35 -07:00
MauricioCarneiro 6f0269df2c Merge pull request #107 from broadinstitute/eb_fix_bqsr_clip_exception 2013-03-14 14:40:06 -07:00
Eric Banks 232afdcbea Added check in the MalformedReadFilter for reads without stored bases (i.e. that use '*').
* We now throw a User Error for such reads
  * User can override this to filter instead with --filter_bases_not_stored
  * Added appropriate unit test
2013-03-14 17:17:26 -04:00
droazen 0fd9f0e77c Merge pull request #104 from broadinstitute/eb_fix_output_annotation_GSA-837
Fixed the logic of the @Output annotation and its interaction with 'required'
2013-03-14 12:52:00 -07:00
Ryan Poplin 38914384d1 Changing CALLED_IN_DB_UNKNOWN_STATUS to count as TRUE_POSITIVEs in the simplified stats for AssessNA12878. 2013-03-14 14:44:18 -04:00
Eric Banks 6d6264b108 Merge pull request #105 from broadinstitute/gg_annotations_cleanup_45802765
Cleaned up annotations
2013-03-14 11:35:00 -07:00
Geraldine Van der Auwera 61349ecefa Cleaned up annotations
- Moved AverageAltAlleleLength, MappingQualityZeroFraction and TechnologyComposition to Private
  - VariantType, TransmissionDisequilibriumTest, MVLikelihoodRatio and GCContent are no longer Experimental
  - AlleleBalanceBySample, HardyWeinberg and HomopolymerRun are Experimental and available to users with a big bold caveat message
  - Refactored getMeanAltAlleleLength() out of AverageAltAlleleLength into GATKVariantContextUtils in order to make QualByDepth independent of where AverageAltAlleleLength lives
  - Unrelated change, bundled in for convenience: made HC argument includeUnmappedreads @Hidden
  - Removed unnecessary check in AverageAltAlleleLength
2013-03-14 14:26:48 -04:00
Eric Banks 7cab709a88 Fixed the logic of the @Output annotation and its interaction with 'required'.
ALL GATK DEVELOPERS PLEASE READ NOTES BELOW:

I have updated the @Output annotation to behave differently and to include a 'defaultToStdout' tag.
  * The 'defaultToStdout' tags lets walkers specify whether to default to stdout if -o is not provided.
  * The logic for @Output is now:
    * if required==true then -o MUST be provided or a User Error is generated.
    * if required==false and defaultToStdout==true then the output is assigned to stdout if no -o is provided.
      * this is the default behavior (i.e. @Output with no modifiers).
    * if required==false and defaultToStdout==false then the output object is null.
      * use this combination for truly optional outputs (e.g. the -badSites option in AssessNA12878).

  * I have updated walkers so that previous behavior has been maintained (as best I could).
    * In general, all @Outputs with default long/short names have required=false.
    * Walkers with nWayOut options must have required==false and defaultToStdout==false (I added checks for this)
  * I added unit tests for @Output changes with David's help (thanks!).
  * #resolve GSA-837
2013-03-14 11:58:51 -04:00
Eric Banks 573ed07ad0 Fixed reported bug in BQSR for RNA seq alignments with Ns.
* ClippingOp updated to incorporate Ns in the hard clips.
  * ReadUtils.getReadCoordinateForReferenceCoordinate() updated to account for Ns.
  * Added test that covers the BQSR case we saw.
  * Created GSA-856 (for Mauricio) to add lots of tests to ReadUtils.
    * It will require refactoring code and not in the scope of what I was willing to do to fix this.
2013-03-14 11:26:52 -04:00
Eric Banks ff87b62fe3 Fixed bug in SelectVariants where maxIndelSize argument wasn't getting applied to deletions.
Added unit tests and docs.
2013-03-13 15:11:34 -04:00
Mark DePristo b5b63eaac7 New GATKSAMRecord concept of a strandless read, update to FS
-- Strandless GATK reads are ones where they don't really have a meaningful strand value, such as Reduced Reads or fragment merged reads.  Added GATKSAMRecord support for such reads, along with unit tests
-- The merge overlapping fragments code in FragmentUtils now produces strandless merged fragments
-- FisherStrand annotation generalized to treat strandless as providing 1/2 the representative count for both strands.  This means that that merged fragments are properly handled from the HC, so we don't hallucinate fake strand-bias just because we managed to merge a lot of reads together.
-- The previous getReducedCount() wouldn't work if a read was made into a reduced read after getReducedCount() had been called.  Added new GATKSAMRecord method setReducedCounts() that does the right thing.  Updated SlidingWindow and SyntheticRead to explicitly call this function, and so the readTag parameter is now gone.
-- Update MD5s for change to FS calculation.  Differences are just minor updates to the FS
2013-03-13 11:16:36 -04:00
Mark DePristo 925846c65f Cleanup of FragmentUtils
-- Code was undocumented, big, and not well tested.  All three things fixed.
-- Currently not passing, but the framework works well for testing
-- Added concat(byte[] ... arrays) to utils
2013-03-13 07:36:20 -04:00
David Roazen 8ed78b453f Increase timeout for a test in the EngineFeaturesIntegrationTest
-This test was intermittently failing when run on the farm
2013-03-12 23:53:26 -04:00
Mark DePristo b3f67899b5 Merge pull request #101 from broadinstitute/dr_fix_failing_parallel_tests
Fix more tests that fail when run in parallel on the farm
2013-03-12 14:11:02 -07:00
David Roazen cdb1fa1105 Fix more tests that fail when run in parallel on the farm
-Allow the default S3 put timeout of 30 seconds for GATKRunReports
 to be overridden via a constructor argument, and use a timeout
 of 300 seconds for tests. The timeout remains 30 seconds in all
 other cases.

-Change integration tests that themselves dispatch farm jobs
 into pipeline tests. Necessary because some farm nodes are
 not set up as submit hosts. Pipeline tests are still run
 directly on gsa4.

-Bump up the timeout for the MaxRuntimeIntegrationTest even more
 (was still occasionally failing on the farm!)
2013-03-12 16:53:30 -04:00
Geraldine Van der Auwera f972963918 Fixed issues raised by Appistry QA (mostly small fixes, corrections & clarifications to GATKDocs)
GATK-73 updated docs for bqsr args
GATK-9 differentiate CountRODs from CountRODsByRef
GATK-76 generate GATKDoc for CatVariants
GATK-4 made resource arg required
GATK-10 added -o, some docs to CountMales; some docs to CountLoci
GATK-11 fixed by MC's -o change; straightened out the docs.
GATK-77 fixed references to wiki
GATK-76 Added Ami's doc block
GATK-14 Added note that these annotations can only be used with VariantAnnotator
GATK-15 specified required=false for two arguments
GATK-23 Added documentation block
GATK-33 Added documentation
GATK-34 Added documentation
GATK-32 Corrected arg name and docstring in DiffObjects
GATK-32 Added note to DO doc about reference (required but unused)
GATK-29 Added doc block to CountIntervals
GATK-31 Added @Output PrintStream to enable -o
GATK-35 Touched up docs
GATK-36 Touched up docs, specified verbosity is optional
GATK-60 Corrected GContent annot module location in gatkdocs
GATK-68 touched up docs and arg docstrings
GATK-16 Added note of caution about calling RODRequiringAnnotations as a group
GATK-61 Added run requirements (num samples, min genotype quality)
Tweaked template and generic doc block formatting (h2 to h3 titles)
GATK-62 Added a caveat to HR annot
Made experimental annotation hidden
GATK-75 Added setup info regarding BWA
GATK-22 Clarified some argument requirements
GATK-48 Clarified -G doc comments
GATK-67 Added arg requirement
GATK-58 Added annotation and usage docs
GSATDG-96 Corrected doc
Updated MD5 for DiffObjectsIntegrationTests (only change is link in table title)
2013-03-12 10:57:14 -04:00
Guillermo del Angel 695723ba43 Two features useful for ancient DNA processing.
Ancient DNA sequencing data is in many ways different from modern data, and methods to analyze it need to be adapted accordingly.
Feature 1: Read adaptor trimming. Ancient DNA libraries typically have very short inserts (in the order of 50 bp), so typical Illumina libraries sequenced in, say, 100bp HiSeq will have a large adaptor component being read after the insert.
If this adaptor is not removed, data will not be aligneable. There are third party tools that remove adaptor and potentially merge read pairs, but are cumbersome to use and require precise knowledge of the library construction and adaptor sequence.
-- New walker ReadAdaptorTrimmer walks through paired end data, computes pair overlap and trims auto-detected adaptor sequence.
-- Unit tests added for trimming operation.
-- Utility walker (may be retired later) DetailedReadLengthDistribution computes insert size or read length distribution stratified by read group and mapping status and outputs a GATKReport with data.
-- Renamed MaxReadLengthFilter to ReadLengthFilter and added ability to specify minimum read length as a filter (may be useful if, as a consequence of adaptor trimming, we're left with a lot of very short reads which will map poorly and will just clutter output BAMs).

Feature 2: Unbiased site QUAL estimation: many times ancestral allele status is not known and VCF fields like QUAL, QD, GQ, etc. are affected by the pop. gen. prior at a site. This might introduce subtle biases in studies where a species is aligned against the reference of another species, so an option for UG and HC not to apply such prior is introduced.
-- Added -noPrior argument to StandardCallerArgumentCollection.
-- Added option not to fill priors is such argument is set.
-- Added an integration test.
2013-03-09 18:18:13 -05:00
Yossi Farjoun baad965a57 - Changed loadContaminationFile file parser to delimit by tab only. This allows spaces in sampleIDs, which apparently are allowed.
- This was needed since samples with spaces in their names are regularly found in the picard pipeline.
- Modified the tests to account for this (removed spaces from the good tests, and changed the failing tests accordingly)
- Cleaned up the unit tests using a @DataProvider (I'm in love...).
- Moved AlleleBiasedDownsamplingUtilsUnitTest to public to match location of class it is testing (due to the way bamboo operates)
2013-03-07 13:04:24 -05:00
David Roazen 3ab78543a7 Fix tests that were consistently or intermittently failing when run in parallel on the farm
-Make MaxRuntimeIntegrationTest more lenient by assuming that startup overhead
 might be as long as 120 seconds on a very slow node, rather than the original
 assumption of 20 seconds

-In TraverseActiveRegionsUnitTest, write temp bam file to the temp directory, not
 to the current working directory

-SimpleTimerUnitTest: This test was internally inconsistent. It asserted that
 a particular operation should take no more than 10 milliseconds, and then asserted
 again that this same operation should take no more than 100 microseconds (= 0.1 millisecond).
 On a slow node it could take slightly longer than 100 microseconds, however.
 Changed the test to assert that the operation should require no more than 10000 microseconds
 (= 10 milliseconds)

-change global default test timeout from 20 to 40 minutes (things just take longer
 on the farm!)

-build.xml: allow runtestonly target to work with scala test classes
2013-03-06 13:56:54 -05:00
Eric Banks 3759d9dd67 Added the functionality to impose a relative ordering on ReadTransformers in the GATK engine.
* ReadTransformers can say they must be first, must be last, or don't care.
  * By default, none of the existing ones care about ordering except BQSR (must be first).
    * This addresses a bug reported on the forum where BAQ is incorrectly applied before BQSR.
  * The engine now orders the read transformers up front before applying iterators.
  * The engine checks for enabled RTs that are not compatible (e.g. both must be first) and blows up (gracefully).
  * Added unit tests.
2013-03-06 12:38:59 -05:00
Mark DePristo 446cd61f7e Merge pull request #84 from broadinstitute/eb_allelic_primitives
Added new walker to split MNPs into their allelic primitives (SNPs).
2013-03-06 09:02:21 -08:00
Eric Banks 78721ee09b Added new walker to split MNPs into their allelic primitives (SNPs).
* Can be extended to complex alleles at some point.
  * Currently only works for bi-allelics (documented).
  * Added unit and integration tests.
2013-03-05 23:16:42 -05:00
Mauricio Carneiro e2d41f0282 Turning @Output required to false
By default all output is assigned to stdout if a -o is not provided. Technically this makes @Output a not required parameter, and the documentation is misleading because it's reading from the annotation.
GSA-820 #resolve
2013-03-05 17:26:16 -05:00
Eric Banks 2be57fbcfb Merged bug fix from Stable into Unstable 2013-03-05 13:28:46 -05:00
Eric Banks 5e89f01e10 Don't allow the use of compressed (.gz) references in the GATK. 2013-03-05 13:28:19 -05:00
Mauricio Carneiro d0c8105387 Cleaning up hilarious exception messages
Too many users (with RNASeq reads) are hitting these exceptions that were never supposed to happen. Let's give them (and us) a better and clearer error message.
2013-03-04 16:52:22 -05:00
Mark DePristo 42d3919ca4 Expanded functionality for writing BAMs from HaplotypeCaller
-- The new code includes a new mode to write out a BAM containing reads realigned to the called haplotypes from the HC, which can be easily visualized in IGV.
-- Previous functionality maintained, with bug fixes
-- Haplotype BAM writing code now lives in utils
-- Created a base class that includes most of the functionality of writing reads realigned to haplotypes onto haplotypes.
-- Created two subclasses, one that writes all haplotypes (previous functionality) and a CalledHaplotypeBAMWriter that will only write reads aligned to the actually called haplotypes
-- Extended PerReadAlleleLikelihoodMap.getMostLikelyAllele to optionally restrict set of alleles to consider best
-- Massive increase in unit tests in AlignmentUtils, along with several new powerful functions for manipulating cigars
-- Fix bug in SWPairwiseAlignment that produces cigar elements with 0 size, and are now fixed with consolidateCigar in AlignmentUtils
-- HaplotypeCaller now tracks the called haplotypes in the GenotypingEngine, and returns this information to the HC for use in visualization.
-- Added extensive docs to HaplotypeCaller on how to use this capability
-- BUGFIX -- don't modify the read bases in GATKSAMRecord in LikelihoodCalculationEngine in the HC
-- Cleaned up SWPairwiseAlignment.  Refactored out the big main and supplementary static methods.  Added a unit test with a bug TODO to fix what seems to be an edge case bug in SW
-- Integration test to make sure we can actually write a BAM for each mode.  This test only ensures that the code runs and doesn't exception out.  It doesn't actually enforce any MD5s
-- HaplotypeBAMWriter also left aligns indels in the reads, as SW can return a random placement of a read against the haplotype.  Calls leftAlign to make the alignments more clear, with unit test of real read to cover this case
-- Writes out haplotypes for both all haplotype and called haplotype mode
-- Haplotype writers now get the active region call, regardless of whether an actual call was made.  Only emitting called haplotypes is moved down to CalledHaplotypeBAMWriter
2013-03-03 12:07:29 -05:00
depristo 6204e6ccc9 Merge pull request #76 from broadinstitute/md_kb_bugfix_GSA-795
Bug fixes and optimizations for NA12878 KB
2013-03-01 10:52:16 -08:00
Eric Banks ebd5404124 Fixed the add functionality of GenomeLocSortedSet.
* Fixed GenomeLocSortedSet.add() to ensure that overlapping intervals are detected and an exception is thrown.
 * Fixed GenomeLocSortedSet.addRegion() by merging it with the add() method; it now produces sorted inputs in all cases.
 * Cleaned up duplicated code throughout the engine to create a list of intervals over all contigs.
 * Added more unit tests for add functionality of GLSS.
 * Resolves GSA-775.
2013-02-28 23:31:00 -05:00
Mark DePristo 4095a9ef32 Bugfixes for AssessNA12878
-- Refactor initialization routine into BadSitesWriter.  This now adds the GQ and DP genotype header lines which are necessarily if the input VCF doesn't have proper headers
-- GATKVariantContextUtils subset to biallelics now tolerates samples with bad GL values for multi-allelics, where it just removes the PLs and issues a warning.
2013-02-28 10:35:06 -05:00
depristo 92d6a4f441 Merge pull request #75 from broadinstitute/eb_missing_rg_error_GSA-407
Added better error message for BAMs with bad read groups.
2013-02-28 05:20:39 -08:00
Eric Banks 12fc198b80 Added better error message for BAMs with bad read groups.
* Split the cases into reads that don't have a RG at all vs. those with a RG that's not defined in the header.
  * Added integration tests to make sure that the correct error is thrown.
  * Resolved GSA-407.
2013-02-27 16:02:56 -05:00
Eric Banks 69b8173535 Replace uses of NestedHashMap with NestedIntegerArray.
* Removed from codebase NestedHashMap since it is unused and untested.
 * Integration tests change because the BQSR CSV is now sorted automatically.
 * Resolves GSA-732
2013-02-27 14:03:39 -05:00
David Roazen 752f4335a5 Merged bug fix from Stable into Unstable 2013-02-27 05:20:41 -05:00
David Roazen 2a7af43164 Fix improper dependencies in QScripts used by pipeline tests, and attempt to fix the flawed MisencodedBaseQualityUnitTest
-Some QScripts used by public pipeline tests unnecessarily used the (now protected) UnifiedGenotyper.
 Changed them to use PrintReads instead.

-Moved ExampleUnifiedGenotyperPipelineTest to protected

-Attempt to fix the flawed and sporadically failing MisencodedBaseQualityUnitTest:

   After looking at this class a bit, I think the problem was the use of global arrays for the quals
   shared across all reads in all tests (BAMRecord class definitely does not make a separate copy for
   each read!). One test (testFixBadQuals) modifies the bad quals array, and if this happens to run
   before the testBadQualsThrowsError test the bad quals array will have been "fixed" and no exception
   will be thrown.
2013-02-27 04:45:53 -05:00
David Roazen a53b4a7521 Merged bug fix from Stable into Unstable 2013-02-26 21:41:13 -05:00
David Roazen 65d31ba4ad Fix runtime public -> protected dependencies in the test suite
-replace unnecessary uses of the UnifiedGenotyper by public integration tests
 with PrintReads

-move NanoSchedulerIntegrationTest to protected, since it's completely dependent
 on the UnifiedGenotyper
2013-02-26 21:19:12 -05:00
depristo 93205154b5 Merge pull request #63 from broadinstitute/eb_fix_pairhmm_unittest_GSA-776
Eb fix pairhmm unittest gsa 776
2013-02-26 11:56:58 -08:00
Mauricio Carneiro 711cbd3b5a Archiving CoverageBySample
This walker was not updated since 2009, and users were getting wrong answers when running it with ReduceReads. I don't want to deal with this because DiagnoseTargets does everything this walker does.
2013-02-26 13:49:00 -05:00
depristo 51d618de97 Merge pull request #62 from broadinstitute/rp_increase_max_kmer_in_assembly
The maximum kmer length is derived from the reads.
2013-02-26 05:37:02 -08:00
Eric Banks 7519484a38 Refactored PairHMM.initialize to first take haplotype max length and then the read max length so that it is consistent with other PairHMM methods. 2013-02-25 15:04:23 -05:00
Ryan Poplin 89e2943dd1 The maximum kmer length is derived from the reads.
-- This is done to take advantage of longer reads which can produce less ambiguous haplotypes
-- Integration tests change for HC and BiasedDownsampling
2013-02-25 14:40:25 -05:00
David Roazen 3645ea9bb6 Sequence dictionary validation: detect problematic contig indexing differences
The GATK engine does not behave correctly when contigs are indexed
differently in the reads sequence dictionaries vs. the reference
sequence dictionary, and the inconsistently-indexed contigs are included
in the user's intervals. For example, given the dictionaries:

Reference dictionary = { chrM, chr1, chr2, ... }
BAM dictionary       = { chr1, chr2, ... }

and the interval "-L chr1", the engine would fail to correctly retrieve
the reads from chr1, since chr1 has a different index in the two dictionaries.

With this patch, we throw an exception if there are contig index differences
between the dictionaries for reads and reference, AND the user's intervals
include at least one of the mismatching contigs.

The user can disable this exception via -U ALLOW_SEQ_DICT_INCOMPATIBILITY

In all other cases, dictionary validation behaves as before.

I also added comprehensive unit tests for the (previously-untested)
SequenceDictionaryUtils class.

GSA-768 #resolve
2013-02-25 11:14:22 -05:00
Ryan Poplin 6a639c8ffc Replace Smith-Waterman alignment with the bubble traversal.
-- Instead of doing a full SW alignment against the reference we read off bubbles from the assembly graph.
-- Smith-Waterman is run only on the base composition of the bubbles which drastically reduces runtime.
-- Refactoring graph functions into a new DeBruijnAssemblyGraph class.
-- Bug fix in path.getBases().
-- Adding validation code to the assembly engine.
-- Renaming SimpleDeBruijnAssembler to match the naming of the new Assembly graph class.
-- Adding bug fixes, docs and unit tests for DeBruijnAssemblyGraph and KBestPaths classes.
-- Added ability to ignore bubbles that are too divergent from the reference
-- Max kmer can't be bigger than the extension size.
-- Reverse the order that we create the assembly graphs so that the bigger kmers are used first.
-- New algorithm for determining unassembled insertions based on the bubble traversal instead of the full SW alignment.
-- Don't need the full read span reference loc for anything any more now that we clip down to the extended loc for both assembly and likelihood evaluation.
-- Updating HaplotypeCaller and BiasedDownsampling integration tests.
-- Rebased everything into one commit as requested by Eric
-- improvements to the bubble traversal are coming as a separate push
2013-02-22 15:42:16 -05:00
depristo 2ad559cf58 Merge pull request #59 from broadinstitute/mc_reving_testng_GSA-695
Updating TestNG to the latest version
2013-02-22 10:39:04 -08:00
Mauricio Carneiro 4ac50c89ad Updating TestNG to the latest version
-- changed SkipException constructors that are now private in TestNG
-- Updated build.xml to use the latest testng
-- Added guice dependency to ivy
-- Fixed broken SampleDBUnitTest

The SampleDBUnitTest was only passing before because the map comparison in the old TestNG was broken. It was comparing two DIFFERENT samples and testing for "equals"

GSA-695 #resolve
2013-02-22 09:40:23 -05:00
Mark DePristo 182c32a2b7 Relax bounds checking in QualityUtils.boundQual
-- Previous version did runtime checking that qual >= 0 but BQSR was relying on boundQual to restore -1 to 1.  So relax the bound.
2013-02-22 08:46:59 -05:00
Mark DePristo 8ac6d3521f Vast improvements to AssessNA12878 code and functionality
-- AssessNA12878 now breaks out multi-allelics into bi-allelic components.  This means that we can properly assess multi-allelic calls against the bi-allelic KB
-- Refactor AssessNA12878, moving into assess package in KB.  Split out previously private classes in the walker itself into separate classes.  Added real docs for all of the classes.
-- Vastly expand (from 0) unit tests for NA12878 assessments
-- Allow sites only VCs to be evaluated by Assessor
-- Move utility for creating simple VCs from a list of string alleles from GATKVariantContextUtilsUnitTest to GATKVariantContextUtils
-- Assessor bugfix for discordant records at a site.  Previous version didn't handle properly the case where one had a non-matching call in the callset w.r.t. the KB, so that the KB element was eaten during the analysis.  Fixed.  UnitTested
-- See GSA-781 -- Handle multi-allelic variants in KB for more information
-- Bugfix for missing site counting in AssessNA12878.  Previous version would count N misses for every missed value at a site.  Not that this has much impact but it's worth fixing
-- UnitTests for BadSitesWriter
-- UnitTests for filtered and filtering sites in the Assessor
-- Cleanup end report generation code (simply the code).  Note that instead of "indel" the new code will print out "INDELS"
-- Assessor DoC calculations now us LIBS and RBPs for the depth calculation.  The previous version was broken for reduced reads.  Added unit test that reads a complex reduced read example and matches the DoC of this BAM with the output of the GATK DoC tool here.
-- Added convenience constructor for LIBS using just SAMFileReader and an iterator.  It's now easy to create a LIBS from a BAM at a locus.  Added advanceToLocus function that moves the LIBS to a specific position.  UnitTested via the assessor (which isn't ideal, but is a proper test)
2013-02-21 20:43:12 -05:00
Mark DePristo 29319bf222 Improved allele trimming code in GATKVariantContextUtils
-- Now supports trimming the alleles from both the reverse and forward direction.
-- Added lots of unit tests for forwrad allele trimming, as well as creating VC from forward and reverse trimming.
-- Added docs and tests for the code, to bring it up to GATK spec
2013-02-21 12:01:43 -05:00
Eric Banks 6996a953a8 Haplotype/Allele based optimizations for the HaplotypeCaller that knock off nearly 20% of the total runtime (multi-sample).
These 2 changes improve runtime performance almost as much as Ryan's previous attempt (with ID-based comparisons):
* Don't unnecessarily overload Allele.getBases() in the Haplotype class.
  * Haplotype.getBases() was calling clone() on the byte array.
* Added a constructor to Allele (and Haplotype) that takes in an Allele as input.
  * It makes a copy of he given allele without having to go through the validation of the bases (since the Allele has already been validated).
  * Rev'ed the variant jar accordingly.

For the reviewer: all tests passed before rebasing, so this should be good to go as far as correctness.
2013-02-21 10:14:11 -05:00
Geraldine Van der Auwera c3e01fea40 Added several more info types / annotations to GATKDocs
-- top-level walker type (locus, read etc)
-- parallelism options (nt or nct)
-- annotation type (for Variant Annotations)
-- downsampling settings that override engine defaults
-- reference window size
-- active region settings
-- partitionBy info
2013-02-21 03:12:40 -05:00
Geraldine Van der Auwera e674b4a524 Added new ReadFilter that allows users to specifically reassign one single mapping quality to a different value. Useful for TopHat and other RNA-seq software users. 2013-02-20 01:24:45 -05:00
MauricioCarneiro 76810465aa Merge pull request #40 from broadinstitute/gg_retrieve_readfilters_GSATDG-63 2013-02-19 19:42:35 -08:00
Mark DePristo 910d966428 Extend timeout of NanoScheduler deadlock tests
-- The previous timeout of 1 second was just dangerously short.  Increase the timeout to 10 seconds
2013-02-19 20:25:25 -05:00
Eric Banks 0055a6f1cd Merge pull request #45 from broadinstitute/mc_fix_indelrealigner_GSA-774
Fix to the Indel Realigner bug described in GSA-774
2013-02-19 16:16:48 -08:00
Geraldine Van der Auwera faef85841b Added GATKDocs fct to indicate default Read Filters for each tool
-- Added getClazzAnnotations() as hub to retrieve various annotations values and class properties through reflection
-- Added getReadFilters() method to retrieve Read Filter annotations
-- getReadFilters() uses recursion to walk up the inheritance to also capture superclass annotations
-- getClazzAnnotations() stores collected info in doc handler root, which is unit.forTemplate in Doclet
-- Modified FreeMarker template to use the Readfilters info (displayed after arg table, before additional capabilities)
-- Tadaaa :-) #GSATDG-63 resolve
2013-02-19 16:12:29 -05:00
Mauricio Carneiro 371ea2f24c Fixed IndelRealigner reference length bug (GSA-774)
-- modified ReadBin GenomeLoc to keep track of softStart() and softEnd() of the reads coming in, to make sure the reference will always be sufficient even if we want to use the soft-clipped bases
-- changed the verification from readLength to aligned bases to allow reads with soft-clipped bases
-- switched TreeSet -> PriorityQueue in the ConstrainedMateFixer as some different reads can be considered equal by picard's SAMRecordCoordinateComparator (the Set was replacing them)
-- pulled out ReadBin class so it can be testable
-- added unit tests for ReadBin with soft-clips
-- added tests for getMismatchCount (AlignmentUtils) to make sure it works with soft-clipped reads

GSA-774 #resolve
2013-02-19 16:00:36 -05:00
Mauricio Carneiro 815028edd4 Added verbose error message to the PluginManager
-- added a logger.error with a more descriptive message of what the most likely cause of the error is

Typical error happens when a walker's global variable is not initialized properly (usually in test conditions). The old error message was very hard to understand "Could not create module because of an exception of type NullPointerException ocurred caused by exception null"
2013-02-19 16:00:35 -05:00
Ryan Poplin c025e84c8b Fix for calculating read pos rank sum test with reads that are informative but don't actually overlap the variant due to some hard clipping.
-- Updated a few integration tests for HC, UG, and UG general ploidy
2013-02-19 14:09:24 -05:00
Mark DePristo be45edeff2 ActivityProfile and ActiveRegions respects engine interval boundaries
-- Active regions are created as normal, but they are split and trimmed to the engine intervals when added to the traversal, if there are intervals present.
-- UnitTests for ActiveRegion.splitAndTrimToIntervals
-- GenomeLocSortedSet.getOverlapping uses binary search to efficiently in ~ log N time find overlapping intervals
-- UnitTesting overlap function in GenomeLocSortedSet
-- Discovered fundamental implementation bug in that adding genome locs out of order (elements on 20 then on 19) produces an invalid GenomeLocSortedSet.  Created a JIRA to address this: https://jira.broadinstitute.org/browse/GSA-775
-- Constructor that takes a collection of genome locs now sorts its input and merges overlapping intervals
-- Added docs for the constructors in GLSS
-- Update HaplotypeCaller MD5s, which change because ActiveRegions are now restricted to the engine intervals, which changes slightly the regions in the tests and so the reads in the regions, and thus the md5s
-- GenomeAnalysisEngineUnitTest needs to provide non-null genome loc parser
2013-02-18 10:40:25 -05:00
Mark DePristo 3b67aa8aee Final edge case bug fixes to QualityUtil routines
-- log10 functions in QualityUtils allow -Infinity to allow log10(0.0) values
-- Fix edge condition of log10OneMinusX failing with Double.MIN_VALUE
-- Fix another edge condition of log10OneMinusX failing with a small but not min_value double
2013-02-16 07:31:38 -08:00
Mark DePristo b393c27f07 QualityUtils now uses runtime argument checks instead of contract
-- There's some runtime cost for these tests, but it's not big enough to outweigh the value of catching errors quickly
2013-02-16 07:31:38 -08:00
Mark DePristo 9a29d6d4be Fix an catastrophic bug (WoW!) in the reference calculation of the UG
-- The UG was using MathUtils binomial probability backward, so that the estimated confidence was always NaN, and was as a side effect other utils converted this to a meaningless 0.0.  This is all because there wasn't a unit test.
-- I've fixed the calculation, so it's now log10 based, uses robust MathUtils and QualityUtils functions to compute probabilities, and added a unit test.
2013-02-16 07:31:38 -08:00
Mark DePristo 9e28d1e347 Cleanup and unit tests for QualityUtils
-- Fixed a few conversion bugs with edge case quals (ones that were very high)
-- Fixed a critical bug in the conversion of quals that was causing near capped quals to fall below their actual value.  Will undoubtedly need to fix md5s
-- More precise prob -> qual calculations for very high confidence events in phredScaleCorrectRate, trueProbToQual, and errorProbToQual.  Very likely to improve accuracy of many calculations in the GATK
-- Added errorProbToQual and trueProbToQual calculations that accept an integer cap, and perform the (tricky) conversion from int to byte correctly.
-- Full docs and unit tests for phredScaleCorrectRate and phredScaleErrorRate.
-- Renamed probToQual to trueProbToQual
-- Added goodProbability and log10OneMinusX to MathUtils
-- Went through the GATK and cleaned up many uses of QualityUtils
-- Cleanup constants in QualityUtils
-- Added full docs for all of the constants
-- Rename MAX_QUAL_SCORE to MAX_SAM_QUAL_SCORE for clarity
-- Moved MAX_GATK_USABLE_Q_SCORE to RecalDatum, as it's s BQSR specific feature
-- Convert uses of QualityUtils.errorProbToQual(1-x) to QualityUtils.trueProbToQual(x)
-- Cleanup duplicate quality score routines in MathUtils.  Moved and renamed MathUtils.log10ProbabilityToPhredScale => QualityUtils.phredScaleLog10ErrorRate. Removed 3 routines from MathUtils, and remapped their usages into the better routines in QualityUtils
2013-02-16 07:31:37 -08:00
Yossi Farjoun aa99a5f47c Added an option to print out the version string
@argument (-)-version
(should this be @hidden?)

Prints out the version to System.out and quit(0)
No tests. (any ideas on how to test this would be happily accepted)
2013-02-15 12:42:59 -05:00
droazen 664960373d Merge pull request #31 from broadinstitute/yf_fast_BAM_index_traversal
-re-enables fast BAM indexing
2013-02-15 09:12:32 -08:00
MauricioCarneiro 1dd284a5bb Merge pull request #39 from broadinstitute/tj_printreads_tag_for_bqsr_GSA-720
PrintReads writes a header when used with -BQSR
2013-02-15 07:18:28 -08:00
MauricioCarneiro b58a0eca6b Merge pull request #33 from broadinstitute/gg_more_gatkdocs_tweaks_GSATDG-62
Refactored GATKDocs categories some more ( GSATDG-62 )
2013-02-14 22:35:07 -08:00
Tad Jordan 6cb80591e3 PrintReads writes a header when used with -BQSR 2013-02-14 22:19:14 -05:00
Yossi Farjoun 3a7c8c13e2 Re-enabled fastBAMindexing by replacing the FileChannel with a SeekableBufferedStream
This helps a lot since FileChannel is very low-level and traversing the BAMIndex involves lots of short reads.

- Fixed a deterioration in BAMIndex due to rev'ed picard (see below)
- Added unit tests for SeekableBufferedStream
- Added integrationTests for GATKBAMIndex (in PileupWalkerIntegrationTest)
- Added a runtime-test to verify that the amount read equals the amount requested.
- Added failing tests with expectedExceptions
- Used a DataProvider to make code nicer
2013-02-14 17:51:15 -05:00
Mark DePristo f92328a1a1 Extend default timeout to 20 minutes
-- The default of 10 minutes is right on the edge for some tests, and we really want a default not to enforce a max time (test should be short) but to stop testng from failing to terminate ever in the case where some test is truly hung
2013-02-13 17:43:40 -08:00
Geraldine Van der Auwera 6208742f7c Refactored GATKDocs categories some more ( GSATDG-62 )
-- Renamed ValidatePileup to CheckPileup since validation is reserved word
-- Renamed AlignmentValidation to CheckAlignment (same as above)
-- Refactored category definitions to use constants defined in HelpConstants
-- Fixed a couple of minor typos and an example error
-- Reorganized the GATKDocs index template to use supercategories
-- Refactored integration tests for renamed walkers (my earlier refactoring had screwed them up or not carried over)
2013-02-13 16:49:18 -05:00
Guillermo del Angel 4308b27f8c Fixed non-determinism in HaplotypeCaller and some UG calls -
-- HaplotypeCaller and PerReadAlleleLikelihoodMap should use LinkedHashMaps instead of plain HashMaps. That way the ordering when traversing alleles is maintained. If the JVM traverses HashMaps with random ordering, different reads (with same likelihood) may be removed by contamination checker, and different alleles may be picked if they have same likelihoods for all reads.
-- Put in some GATKDocs and contracts in HaplotypeCaller files (far from done, code is a beast)
-- Update md5's due to different order of iteration in LinkedHashMaps instead of HashMaps inside HaplotypeCaller  (due to change in PerReadAlleleLikelihoodMap that also slightly modifies reads chosen by per-read downsampling).
-- Reenabled testHaplotypeCallerMultiSampleGGAMultiAllelic test
-- Added some defensive argument checks into HaplotypeCaller public functions (not intended to be done yet).
2013-02-12 15:43:29 -05:00
Geraldine Van der Auwera dff5ef562b Reorganized walker categories in GATKDocs (@DocumentedGATKFeature details)
-- Sorted out contents of BAM Processing vs. Diagnostics & QC Tools
-- Moved two validation-related walkers from Diagnostics & QC to Validation Utilities
-- Reworded some category names and descriptions to be more explicit and user-friendly
2013-02-12 13:36:15 -05:00
Mark DePristo e40d83f00e Final version of PairHMMs with correct edge conditions
-- Uses 1/N for N potential start sites as the probability of starting at any one of the potential start sites
-- Add flag that says to use the original edge condition, respected by all subclasses.  This brings the new code back to the original state, but with all of the cleanup I've done
-- Only test configurations where the read length <= haplotype length.  I think this is actually the contract, but we'll talk about this tomorrow
-- Fix egregious bug with the myLog10SumLog10 function doing the exact opposite of the requested arguments, so that doExact really meant don't do exact
-- PairHMM now exposes computeReadLikelihoodGivenHaplotypeLog10 but subclasses must overload subComputeReadLikelihoodGivenHaplotypeLog10.  This protected function does the work, and the public function will do argument and result QC
-- Have to be more tolerant of reference (approximate) HMM.  All unit tests from the original HMM implementations pass now
-- Added locs of docs
-- Generalize unit tests with multiple equivalent matches of read to haplotype
-- Added runtime argument checking for initial and computeReadLikelihoodGivenHaplotypeLog10
-- Functions to dumpMatrices for debugging
-- Fix nasty bug (without original unit tests) in LoglessPairHMM
-- Max read and haplotype lengths only worked in previous code if they were exactly equal to the provided read and haplotype sizes.  Fixed bug.  Added unit test to ensure this doesn't break again.
-- Added dupString(string, n) method to Utils
-- Added TODOs for next commit.  Need to compute number of potential start sites not in initialize but in the calc routine since this number depends not on the max sizes but the actual read sizes
-- Unit tests for the hapStartIndex functionality of PairHMM
-- Moved computeFirstDifferingPosition to PairHMM, and added unit tests
-- Added extensive unit tests for the hapStartIndex functionality of computeReadLikelihoodGivenHaplotypeLog10
-- Still TODOs left in the code that I'll fix up
-- Logless now compute constants, if they haven't been yet initialized, even if you forgot to say so
-- General: the likelihood penalty for potential start sites is now properly computed against the actual read and reference bases, not the maximum.  This involved moving some initialize() code into the computeLikelihoods function.  That's ok because all of the potential log10 functions are actually going to cached versions, so the slowdown is minimal
-- Added some unit tests to ensure that common errors (providing haplotypes too long, reads too long, not initializing the HMM) are captured as errors
2013-02-09 19:19:22 -05:00
Mark DePristo 09595cdeb9 Remove ExactPairHMM and OriginalPairHMM, everyone just uses Log10PairHMM with appropriate arguments 2013-02-09 13:06:54 -05:00
Mark DePristo 2d802e17a4 Delete the CachingPairHMM 2013-02-09 13:06:54 -05:00
Mark DePristo 7dcafe8b81 Preliminary version of LoglessCachingPairHMM that avoids positive likelihoods
-- Would have been squashed but could not because of subsequent deletion of Caching and Exact/Original PairHMMs
-- Actual working unit tests for PairHMMUnitTest
-- Fixed incorrect logic in how I compared hmm results to the theoretical and exact results
-- PairHMM has protected variables used throughout the subclasses
2013-02-09 13:06:54 -05:00
Mark DePristo ca76de0619 Move ProcessUtilsUnitTest to private 2013-02-09 12:34:45 -05:00
MauricioCarneiro f5e52b72ea Merge pull request #23 from broadinstitute/md_process_utils_unit_tests
UnitTests for ProcessUtils
2013-02-09 09:27:31 -08:00
MauricioCarneiro 3ff10ab277 Merge pull request #24 from broadinstitute/md_ngsplatform_unittests
Expand NGSPlatform to meet SAM 1.4 spec, with full unit tests
2013-02-09 09:27:03 -08:00
Mark DePristo b127fc6a1a Expand NGSPlatform to meet SAM 1.4 spec, with full unit tests
-- Added CAPILLARY and HELICOS platforms as required by spec 1.4
-- Added extensive unit tests to ensure NGSPlatform functions work as expected.
-- Fixed some NPE bugs for reads that don't have RGs or PLs in their RG fields
2013-02-09 11:16:21 -05:00
Mark DePristo fc3307a97f UnitTests for ProcessUtils 2013-02-09 10:13:01 -05:00
Mark DePristo 7fb620dce7 Generalize and fixup ContigComparator
-- Now uses a SAMSequenceDictionary to do the comparison of contigs (which is the right way to do it)
-- Added unit tests
2013-02-09 09:52:13 -05:00
Mark DePristo a3dc7dc5cb Extend AWS timeout for uploads of the GATK run reports to 30 seconds 2013-02-08 17:37:36 -05:00
Mauricio Carneiro 5f49c95cc1 Added distance across contigs calculation to GenomeLocs
-- distance across contigs is calculated given a sequence dictionary (from SAMFileHeader)
-- unit test added
GSATDG-45
2013-02-07 16:31:41 -05:00
Eric Banks 9826192854 Added contracts, docs, and tests for several methods in AlignmentUtils. There are over 74K tests being run now for this class!
* AlignmentUtils.getMismatchCount()
* AlignmentUtils.calcAlignmentByteArrayOffset()
* AlignmentUtils.readToAlignmentByteArray().
* AlignmentUtils.leftAlignIndel()
2013-02-07 13:04:24 -05:00