Commit Graph

4738 Commits (c855714e10be425f94416bbb561e1f39c84d1085)

Author SHA1 Message Date
Mark DePristo 62fc88f92e CombineVariants no longer adds PASS to unfiltered records
-- [Delivers #49876703]
-- Add integration test and test file
-- Update SymbolicAlleles combine variant tests, which was turning unfiltered records into PASS!
2013-05-20 16:53:51 -04:00
Mauricio Carneiro c8b1c47764 Updating gsalib for R-3.0 compatibility
* add package namespace that exports all the visible objects
   * list gsalib dependencies in the package requirements

[fixes #49987933]
2013-05-18 12:43:38 -04:00
Eric Banks 8a442d3c9f @Output needs to be required for LiftoverVariants to prevent a NPE and documentation needed updating. 2013-05-17 10:04:10 -04:00
Yossi Farjoun 3e2a0b15ed - Added a @Hidden option ( -outputInsertLength ) to PileupWalker that causes it to emit insert sizes together with the pileup (to assist Mark Daly's investigation of the contamination dependance on insert length)
- Converted my old GATKBAMIndexText (within PileupWalkerIntegrationTest) to use a dataProvider
- Added two integration tests to test -outputInsertLength option
2013-05-16 12:47:16 -04:00
Mark DePristo 371f3752c1 Subshard timeouts in the GATK
-- The previous implementation of the maxRuntime would require us to wait until all of the work was completed within a shard, which can be a substantial amount of work in the case of a locus walker with 16kb shards.
-- This implementation ensures that we exit from the traversal very soon after the max runtime is exceeded, without completely all of our work within the shard.  This is done by updating all of the traversal engines to return false for hasNext() in the nano scheduled input provider.  So as soon as the timeout is exceeeded, we stop generating additional data to process, and we only have to wait until the currently executing data processing unit (locus, read, active region) completes.
-- In order to implement this timeout efficiently at this fine scale, the progress meter now lives in the genome analysis engine, and the exceedsTimeout() call in the engine looks at a periodically updated runtime variable in the meter.  This variable contains the elapsed runtime of the engine, but is updated by the progress meter daemon thread so that the engine doesn't call System.nanotime() in each cycle of the engine, which would be very expense.  Instead we basically wait for the daemon to update this variable, and so our precision of timing out is limited by the update frequency of the daemon, which is on the order of every few hundred milliseconds, totally fine for a timeout.
-- Added integration tests to ensure that subshard timeouts are working properly
2013-05-15 07:00:39 -04:00
Mark DePristo 43e78286a0 Merge pull request #226 from broadinstitute/hc_ceu_trio_calling
Trivial update to ceutrio.ped file to make it really the CEU trio samples
2013-05-14 17:02:52 -07:00
Yossi Farjoun 409a202492 Merge pull request #214 from broadinstitute/chartl_genotype_concordance_diploid_and_OGC
Add overall genotype concordance to the genotype concordance tool. In ad...
2013-05-14 14:19:54 -07:00
Mark DePristo 7d78a77f17 Trivial update to ceutrio.ped file to make it really the CEU trio sample names 2013-05-14 17:08:13 -04:00
Menachem Fromer de54223aed Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-14 10:15:21 -04:00
Mark DePristo 39e4396de0 New ActiveRegionShardBalancer allows efficient NanoScheduling
-- Previously we used the LocusShardBalancer for the haplotype caller, which meant that TraverseActiveRegions saw its shards grouped in chunks of 16kb bits on the genome.  These locus shards are useful when you want to use the HierarchicalMicroScheduler, as they provide fine-grained accessed to the underlying BAM, but they have two major drawbacks (1) we have to fairly frequently reset our state in TAR to handle moving between shard boundaries and (2) with the nano scheduled TAR we end up blocking at the end of each shard while our threads all finish processing.
-- This commit changes the system over to using an ActiveRegionShardBalancers, that combines all of the shard data for a single contig into a single combined shard.  This ensures that TAR, and by extensions the HaplotypeCaller, gets all of the data on a single contig together so the the NanoSchedule runs efficiently instead of blocking over and over at shard boundaries.  This simple change allows us to scale efficiently to around 8 threads in the nano scheduler:
  -- See https://www.dropbox.com/s/k7f280pd2zt0lyh/hc_nano_linear_scale.pdf
  -- See https://www.dropbox.com/s/fflpnan802m2906/hc_nano_log_scale.pdf
-- Misc. changes throughout the codebase so we Use the ActiveRegionShardBalancer where appropriate.
-- Added unit tests for ActiveRegionShardBalancer to confirm it does the merging as expected.
-- Fix bad toString in FilePointer
2013-05-13 11:09:02 -04:00
Mark DePristo b4f482a421 NanoScheduled ActiveRegionTraversal and HaplotypeCaller
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
  -- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
  -- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
2013-05-13 11:09:02 -04:00
Eric Banks 2f5ef6db44 New faster Smith-Waterman implementation that is edge greedy and assumes that ref and haplotype have same global start/end points.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
   * A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
     right thing for indels at the edges of the alignments.
     * Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
   * Lots of systematic testing added for this implementation.
   * NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
2013-05-13 09:36:39 -04:00
David Roazen 639030bd6d Enable convenient display of diff engine output in Bamboo, plus misc. minor test-related improvements
-Diff engine output is now included in the actual exception message thrown as a
 result of an MD5 mismatch, which allows it to be conveniently viewed on the
 main page of a build in Bamboo.

Minor Additional Improvements:

-WalkerTestSpec now auto-detects test class name via new JVMUtils.getCallingClass()
 method, and the test class name is now included as a regular part of integration
 test output for each test.

-Fix race condition in MD5DB.ensureMd5DbDirectory()

-integrationtests dir is now cleaned by "ant clean"

GSA-915 #resolve
2013-05-10 19:00:33 -04:00
Mark DePristo fa8a47ceef Replace DeBruijnAssembler with ReadThreadingAssembler
Problem
-------
The DeBruijn assembler was too slow.  The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp).  This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.

Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers.  The algorithm operates as follows:

identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
  find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
  for each base in the sequence from the starting vertex kmer:
    look at the existing outgoing nodes of current vertex V.  If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
    If no matching next vertex exists, find a unique vertex with kmer K.  If one exists, merge the sequence into this vertex, and continue
    If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue

This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size.  This allows us to assemble well with even very short kmers.

This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:

-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples.  This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor.  This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization.  This change is essential for us to get good variants from our paths when the kmer size is small.  It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation.  Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary.  This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler

Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations.  This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate.  Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
2013-05-08 21:41:42 -04:00
Chris Hartl d3c9910af6 Cosmetic changes (comments and variable names) to GenotypeConcordance and ConcordanceMetrics to address reviewer comments. 2013-05-08 17:25:14 -04:00
sathibault d79b5f0931 Adding Convey HC-1 HMM acceleration 2013-05-08 11:01:20 -05:00
Mark DePristo 2b86ab02be Improve queue script jobreport visualization script
-- the Queue jobreport PDF script now provides a high-level summary of the de-scattered runtimes of each analysis, so that its easy to see where your script is spending its time across scatters.
2013-05-07 12:11:46 -04:00
Menachem Fromer 86287dce76 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-06 13:52:55 -04:00
Chris Hartl 6ff74deac7 Add overall genotype concordance to the genotype concordance tool. In addition, protect from non-diploid genotypes, which can cause very strange behavior.
Update MD5 sums. As expected, md5 changes are consistent with the genotype concordance field being added to each output.
2013-05-06 13:06:30 -04:00
chartl 98021db264 Merge pull request #208 from broadinstitute/yf_fix_molten_GenotypeConcordance
- Fixed a small bug in the printout of molten data in GenotypeConcordanc...
2013-05-06 08:42:06 -07:00
Menachem Fromer 78e958bf39 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-06 10:39:21 -04:00
Mark DePristo f42bb86bdd e# This is a combination of 2 commits.
Only try to clip adaptors when both reads of the pair are on opposite strands

-- Read pairs that have unusual alignments, such as two reads both oriented like:

  <-----
     <-----

where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs.  This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
2013-05-03 11:19:14 -04:00
Mark DePristo 0587a145bf Utils.dupString should allow 0 number of duplicates to produce empty string 2013-05-03 09:32:05 -04:00
Mark DePristo f5a301fb63 Bugfix for AlignmentUtils.trimCigarByBases
-- Previous version would trim down 2M2D2M into 2M if you asked for the first 2 bases, but this can result in incorrect alignment of the bases to the reference as the bases no longer span the full reference interval expected.  Fixed and added unit tests
2013-05-03 09:32:05 -04:00
Mark DePristo 2bcbdd469f leftAlignCigarSequentially now supports haplotypes with insertions and deletions where the deletion allele was previously removed by the leftAlignSingleIndel during it's cleanup phase. 2013-05-03 09:32:05 -04:00
Eric Banks d981fd01b8 Now that we don't generate dict and fai files, the resource script needs to copy them to the bundle. 2013-05-02 15:18:13 -04:00
David Roazen 13bfa963da Revert changes to exampleFASTA.fasta.fai for now to get tests passing again 2013-05-02 12:59:20 -04:00
Eric Banks f88a964e2c Adding .fai file to example fasta since we don't generate it anymore 2013-05-02 10:54:32 -04:00
Eric Banks 6d0e383a60 Fixing the bundle script
1. someone out there busted it when adding high confidence 1000G calls
2. new path to NA12878 bam
3. updated clashing version argument
2013-05-02 09:40:36 -04:00
Yossi Farjoun 4b8b411b92 - Fixed a small bug in the printout of molten data in GenotypeConcordance
Output didn't "mix-up" the genotypes, it outputed the same HET vs HET (e.g.) 3 times rather than the combinations of HET vs {HET, HOM, HOM_REF}, etc.
This was only a problem in the text, _not_ the actual numbers, which were outputted correctly.

- Updated MD5's after looking at diffs to verify that the change is what I expected.
2013-05-02 09:16:07 -04:00
David Roazen f3c94a3c87 Update expected test output for Java 7
-Changes in Java 7 related to comparators / sorting produce a large number
 of innocuous differences in our test output. Updating expectations now
 that we've moved to using Java 7 internally.

-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
 intermittent failures.
2013-05-01 16:18:01 -04:00
David Roazen f57256b6c2 Delete unused FastaSequenceIndexBuilder class and accompanying test
This class, being unused, was no longer getting packaged into the
GATK release jar by bcel, and so attempting to run its unit test
on the release jar was producing an error.
2013-05-01 01:02:01 -04:00
Eric Banks 58424e56be Setting the reduce reads count tag was all wrong in a previous commit; fixing.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly.  Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.

The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly.  Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).

Also:
1. counts are now maintained as ints whenever possible.  Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
2013-04-30 13:45:42 -04:00
Mark DePristo 73fcacbf1b Change Long to long 2013-04-30 09:21:10 -04:00
Yossi Farjoun 0e7e6d35d8 GATKBAMIndex calls buffer.length() on every read. This is causing much pain.
Optimized by getting the read of the file upon opening the index-file and using that instead.
2013-04-29 12:49:02 -04:00
Mark DePristo 0387ea8df9 Bugfix for ReadClipper with ReducedReads
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts.  Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly.  Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
2013-04-29 11:12:09 -04:00
Mark DePristo 759c531d1b Merge pull request #197 from broadinstitute/dr_disable_snpeff_version_check
Add support for snpEff "GATK compatibility mode" (-o gatk)
2013-04-26 13:55:14 -07:00
David Roazen 7d90bbab08 Add support for snpEff "GATK compatibility mode" (-o gatk)
-Do not throw an exception when parsing snpEff output files
 generated by not-officially-supported versions of snpEff,
 PROVIDED that snpEff was run with -o gatk

-Requested by the snpEff author

-Relevant integration tests updated/expanded
2013-04-26 15:47:15 -04:00
Mark DePristo 071fd67d55 Merge pull request #193 from broadinstitute/eb_contamination_fixing_for_reduced_reads
Eb contamination fixing for reduced reads
2013-04-26 09:48:45 -07:00
Mark DePristo 92a6c7b561 Merge pull request #195 from broadinstitute/eb_exclude_sample_file_bug_in_select_variants
Fixed bug reported on the forum where using the --exclude_sample_file ar...
2013-04-26 09:47:38 -07:00
Eric Banks 360e2ba87e Fixed bug reported on the forum where using the --exclude_sample_file argument in SV was giving bad results.
Added integration test.
https://www.pivotaltracker.com/s/projects/793457/stories/47399245
2013-04-26 12:23:11 -04:00
Eric Banks ba2c3b57ed Extended the allele-biased down-sampling functionality to handle reduced reads.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.

Added lots of unit tests for new functionality.
2013-04-26 11:23:17 -04:00
Mark DePristo 528c3d083a Merge pull request #191 from broadinstitute/dr_fix_rod_system_locking
Detect stuck lock-acquisition calls, and disable file locking for tests
2013-04-25 09:32:54 -07:00
Mark DePristo d20be41fee Bugfix for FragmentUtils.mergeOverlappingPairedFragments
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences.  If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference.  Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
2013-04-25 11:11:15 -04:00
David Roazen 4d56142163 Detect stuck lock-acquisition calls, and disable file locking for tests
-Acquire file locks in a background thread with a timeout of 30 seconds,
 and throw a UserException if a lock acquisition call times out

    * should solve the locking issue for most people provided they
      RETRY failed farm jobs

    * since we use NON-BLOCKING lock acquisition calls, any call that
      takes longer than a second or two indicates a problem with the
      underlying OS file lock support

    * use daemon threads so that stuck lock acquisition tasks don't
      prevent the JVM from exiting

-Disable both auto-index creation and file locking for integration tests
 via a hidden GATK argument --disable_auto_index_creation_and_locking_when_reading_rods

    * argument not safe for general use, since it allows reading from
      an index file without first acquiring a lock

    * this is fine for the test suite, since all index files already
      exist for test files (or if they don't, they should!)

-Added missing indices for files in private/testdata

-Had to delete most of RMDTrackBuilderUnitTest, since it mostly tested auto-index
 creation, which we can't test with locking disabled, but I replaced the deleted
 tests with some tests of my own.

-Unit test for FSLockWithShared to test the timeout feature
2013-04-24 22:49:02 -04:00
Eric Banks 379a9841ce Various bug fixes for recent Reduce Reads additions plus solution implemented for low MQ reads.
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions.  Then we get the
best of both worlds.  As a note, coverage refers to just the individual base counts and not the entire pileup.

2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.

3. Each consensus keeps track of its own number of softclipped bases.  There was no reason that that number
should be shared between them.

4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now.  Don't lose that
information.  Maybe we'll decide to change this in the future, but for now we are conservative.

5. Also implemented various small performance optimizations based on profiling.

Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
2013-04-24 18:18:50 -04:00
Eric Banks 3f52f55c55 Merge pull request #186 from broadinstitute/md_libs_canonical_cigar
Performance optimizations and caliper benchmarks code for consolidateCigar
2013-04-24 12:58:32 -07:00
Ryan Poplin 80131ac996 Adding the 1000G_phase1.snps.high_confidence callset to the GATK resource bundle for use in the April 2013 updated best practices. 2013-04-24 11:41:32 -04:00
Mark DePristo df90597bfc Performance optimizations and caliper benchmarking code for consolidateCigar
-- Now that this function is used in the core of LIBS it needed some basic optimizations, which are now complete, pass all unit tests.
-- Added caliper benchmark for AlignmentUtils to assess performance (showing new version is 3x-10x faster)
-- Remove unused import in ReadStateManager
2013-04-24 11:36:43 -04:00
Eric Banks 3477e092ea Minor: bump up the amount of cached log10 data in MathUtils so that Monkol can actually call 50K samples. 2013-04-19 08:39:08 -04:00
Eric Banks 5bce0e086e Refactored binomial probability code in MathUtils.
* Moved redundant code out of UGEngine
  * Added overloaded methods that assume p=0.5 for speed efficiency
  * Added unit test for the binomialCumulativeProbability method
2013-04-16 18:19:07 -04:00
Eric Banks df189293ce Improve compression in Reduce Reads by incorporating probabilistic model and global het compression
The Problem:
  Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
  regions in an exome) causes RR (with default settings) to consider it a variant region.  This
  seriously hurts compression performance.

The Solution:
  1. We now use a probabilistic model for determining whether we can create a consensus (in other
  words, whether we can error correct a site) instead of the old ratio threshold.  We calculate
  the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
  that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
  2. We also allow het compression globally, not just at known sites.  So if we cannot create a
  consensus at a given site then we try to perform het compression; and if we cannot perform het
  compression that we just don't reduce the variant region.  This way very wonky regions stay
  uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
  locus get het compressed.

Details:
  1. -minvar is now deprecated in favor of -min_pvalue.
  2. Added integration test for bad pvalue input.
  3. -known argument still works to force het compression only at known sites; if it's not included
     then we allow het compression anywhere.  Added unit tests for this.
  4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
     Before finalizing het compression, we now check for insertions or other variant regions (usually due
     to multi-allelics) which can render a region incompressible (and we back out if we find one).  We
     were checking for excessive softclips before, but now we add these tests too.
  5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
     consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
     out instead of backing out all of them.
  6. We no longer create a mini read at the stop of the variant window for het compression.  Instead, we
     allow it to be part of the next global consensus.
  7. The coverage test is no longer run systematically on all integration tests because the quals test
     supercedes it.  The systematic quals test is now much stricter in order to catch bugs and edge cases
     (very useful!).
  8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
     for a consensus was affected by good and bad bases/reads).
  9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
     This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
  10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
     with insertions from a header.

Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
2013-04-16 18:19:06 -04:00
Geraldine Van der Auwera e176fc3af1 Merge pull request #159 from broadinstitute/md_bqsr_ion
Trivial BQSR bug fixes and improvement
2013-04-16 08:54:47 -07:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Guillermo del Angel a971e7ab6d Several improvements to ReadAdaptorTrimmer so that it can be incorporated into ancient DNA processing pipelines (for which it was developed):
-- Add pair cleaning feature. Reads in query-name sorted order are required and pairs need to appear consecutively, but if -cleanPairs option is set, a malformed pair where second read is missing is just skipped instead of erroring out.
-- Add integration tests
-- Move walker to public
2013-04-13 13:41:36 -04:00
Mauricio Carneiro a063e79597 Updating the exampleGRP.grp test file
It had been generated with an old version of BQSRv2 and wasn't compatible with exampleBAM anymore.
2013-04-13 09:07:13 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mauricio Carneiro 3960733c88 Fix PrintReads out of space issue
Problem:
--------
Print Reads was running out of disk space when using the -BQSR option even for small bam files

Solution:
---------
Configure setupWriter to expect pre sorted reads
2013-04-09 08:19:52 -04:00
Mark DePristo 1b36db8940 Make ActiveRegionTraversal robust to excessive coverage
-- Add a maximum per sample and overall maximum number of reads held in memory by the ART at any one time.  Does this in a new TAROrderedReadCache data structure that uses a reservior downsampler to limit the total number of reads to a constant amount.  This constant is set to be by default 3000 reads * nSamples to a global maximum of 1M reads, all controlled via the ActiveRegionTraversalParameters annotation.
-- Added an integration test and associated excessively covered BAM excessiveCoverage.1.121484835.bam (private/testdata) that checks that the system is operating correctly.
-- #resolves GSA-921
2013-04-08 15:48:19 -04:00
Mark DePristo 317dc4c323 Add size() method to Downsampler interface
-- This method provides client with the current number of elements, without having to retreive the underlying list<T>.  Added unit tests for LevelingDownsampler and ReservoirDownsampler as these are the only two complex ones.  All of the others are trivially obviously correct.
2013-04-08 15:48:13 -04:00
Mark DePristo 21410690a2 Address reviewer comments 2013-04-08 12:48:20 -04:00
Mark DePristo 6d22485a4c Critical bugfix to ReduceRead functionality of the GATKSAMRecord
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5].  The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding.  Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i.  Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
2013-04-08 12:47:50 -04:00
Mark DePristo 3a19266843 Fix residual merge conflicts 2013-04-08 12:47:50 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 7105ad65a6 Remove the capability of EventMap to emit symbolic alleles for unassembled events
-- These events always occur on the very edge of the haplotypes, and are intrinsically dodgy.  So instead of emitting them and then potentially having to deal with merging real basepair events into them we just no longer emit those events.
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 167cd49e71 Added -forceActive argument to ActiveRegionWalkers
-- Causes the ART tool to treat all bases as active.   Useful for debugging
2013-04-08 12:47:48 -04:00
Mark DePristo 8656bd5e29 Haplotype now consolidates cigars in setCigar
-- This fixes edge base bugs where non-consolidated cigars are causing problems in users of the Haplotype object.  Input arguments are now checks (let's see if we blow up)
2013-04-08 12:47:47 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mark DePristo b7d59ea13b LIBS unit test debugging should be false 2013-04-08 12:47:47 -04:00
Guillermo del Angel c9d3c67a9b Small Queue/scala improvements, and commiting pipeline scripts developed for ancient DNA processing for posterity:
-- Picard extension so Queue scripts can use FastqToSam
-- Single-sample BAM processing: merge/trim reads + BWA + IR + MD + BQSR. Mostly identical to standard pipeline,
except for the adaptor trimming/merging which is critical for short-insert libraries.
-- Single-sample calling (experimental, work in progress): standard UG run but outputting at all sites, meant for
deep whole genomes.

New scripts
2013-04-08 11:52:13 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Eric Banks 6253ba164e Using --keepOriginalAC in SelectVariants was causing it to emit bad VCFs
* This occurred when one or more alleles were lost from the record after selection
  * Discussed here: http://gatkforums.broadinstitute.org/discussion/comment/4718#Comment_4718
  * Added some integration tests for --keepOriginalAC (there were none before)
2013-04-05 00:53:28 -04:00
Eric Banks 7897d52f32 Don't allow users to specify keys and IDs that contain angle brackets or equals signs (not allowed in VCF spec).
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
  * This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
  * Added integration test to confirm failure with User Error
  * Removed illegal header line in KB test VCF that was causing related tests to fail.
2013-04-05 00:52:32 -04:00
Eric Banks 14bbba0980 Optimization to method for getting values in ArgumentMatch
* Very trivial, but I happened to see this code and it drove me nuts so I felt compelled to refactor it.
  * Instead of iterating over keys in map to get the values, just iterate over the values...
2013-04-04 23:30:47 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
David Roazen 2eac97a76c Remove auto-creation of fai/dict files for fasta references
-A UserException is now thrown if either the fai or dict file for the
 reference does not exist, with pointers to instructions for creating
 these files.

-Gets rid of problematic file locking that was causing intermittent
 errors on our farm.

-Integration tests to verify that correct exceptions are thrown in
 the case of a missing fai / dict file.

GSA-866 #resolve
2013-04-02 18:34:08 -04:00
Mark DePristo e7a8e6e8ee Merge pull request #140 from broadinstitute/dr_interval_intersection_bug_GSA-909
Intervals: fix bug where we could fail to find the intersection of unsorted/missorted interval lists
2013-04-02 11:59:01 -07:00
David Roazen 5baf906c28 Intervals: fix bug where we could fail to find the intersection of unsorted/missorted interval lists
-The algorithm for finding the intersection of two sets of intervals
 relies on the sortedness of the intervals within each set, but the engine
 was not sorting the intervals before attempting to find the intersection.

-The result was that if one or both interval lists was unsorted / lexicographically
 sorted, we would often fail to find the intersection correctly.

-Now the IntervalBinding sorts all sets of intervals before returning them,
 solving the problem.

-Added an integration test for this case.

GSA-909 #resolve
2013-04-02 14:01:52 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Mark DePristo 7c83efc1b9 Merge pull request #135 from broadinstitute/mc_pgtag_fix
Fixing @PG tag uniqueness issue
2013-03-31 11:36:40 -07:00
Guillermo del Angel 9686e91a51 Added small feature to VariantFiltration to filter sites outside of a given mask:
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
2013-03-31 08:48:16 -04:00
Mauricio Carneiro ec475a46b1 Fixing @PG tag uniqueness issue
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".

How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.

Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter

Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31

Issue Tracker:
--------------
[fixes 47100885]
2013-03-30 20:31:33 -04:00
Mauricio Carneiro 52e67a6973 ReviewedStingException -> IllegalStateException 2013-03-30 20:11:55 -04:00
Guillermo del Angel 6b8bed34d0 Big bad bug fix: feature added to LeftAlignAndTrimVariants to left align multiallelic records didn't work.
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
2013-03-30 19:31:28 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
Guillermo del Angel 8fbf9c947f Upgrades and changes to LeftAlignVariants, motivated by 1000G consensus indel production:
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
2013-03-29 10:02:06 -04:00
Chris Hartl 73d1c319bf Rarely-occurring logic bugfix for GenotypeConcordance, streamlining and testing of MathUtils
Currently, the multi-allelic test is covering the following case:

Eval   A   T,C
Comp   A   C

reciprocate this so that the reverse can be covered.

Eval   A   C
Comp   A   T,C

And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.

This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:

Eval:   A  G,T      0/0   2/0   2/2   1/1
Comp:   A  C,T      0/0   1/0   0/0   0/0

Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:

Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)

Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.

Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
 - dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
 - vectorSum
 - array shuffle, random subset
 - countOccurances (general forms, the char form is used in the codebase)
 - getNMaxElements
 - array permutation
 - sorted array permutation
 - compare floats
 - sum() (for integer arrays and lists).

Final keyword was extensively added to MathUtils.

The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).

The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.

In addition, more extensive tests were added for
 - logBinomialCoefficient (Newton's identity should always hold)
 - logFactorial
 - log10sumlog10 and its approximation

All unit tests pass
2013-03-28 23:25:28 -04:00
MauricioCarneiro a2b69790a6 Merge pull request #128 from broadinstitute/eb_rr_polyploid_compression_GSA-639 2013-03-28 06:39:43 -07:00
Mark DePristo 12475cc027 Display the active MappingQualityFilter if mmq > 0 in the HaplotypeCaller 2013-03-26 14:27:18 -04:00
Mark DePristo ad04fdb233 PerReadAlleleLikelihoodMap getMostLikelyAllele returns an MostLikelyAllele objects now
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users.  The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not.  That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves.  There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second.  For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads.   All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event.  In this case our annotations will all fall apart, returning their default values.  Added a JIRA to address this (should be discussed in group meeting)
2013-03-26 14:27:13 -04:00
Eric Banks 593d3469d4 Refactored the het (polyploid) consensus creation in ReduceReads.
* It is now cleaner and easier to test; added tests for newly implemented methods.
 * Many fixes to the logic to make it work
   * The most important change was that after triggering het compression we actually need to back it out if it
      creates reads that incorporated too many softclips at any one position (because they get unclipped).
   * There was also an off-by-one error in the general code that only manifested itself with het compression.
 * Removed support for creating a het consensus around deletions (which was broken anyways).
   * Mauricio gave his blessing for this.
 * Het compression now works only against known sites (with -known argument).
    * The user can pass in one or more VCFs with known SNPs (other variants are ignored).
    * If no known SNPs are provided het compression will automatically be disabled.
 * Added SAM tag to stranded (i.e. het compressed) reduced reads to distinguish their
   strandedness from normal reduced reads.
    * GATKSAMRecord now checks for this tag when determining whether or not the read is stranded.
    * This allows us to update the FisherStrand annotation to count het compressed reduced reads
       towards the FS calculation.
    * [It would have been nice to mark the normal reads as unstranded but then we wouldn't be
       backwards compatible.]
    * Updated integration tests accordingly with new het compressed bams (both for RR and UG).
 * In the process of fixing the FS annotation I noticed that SpanningDeletions wasn't handling
   RR properly, so I fixed it too.
    * Also, the test in the UG engine for determining whether there are too many overlapping
       deletions is updated to handle RR.
 * I added a special hook in the RR integration tests to additionally run the systematic
   coverage checking tool I wrote earlier.
    * AssessReducedCoverage is now run against all RR integration tests to ensure coverage is
       not lost from original to reduced bam.
    * This helped uncover a huge bug in the MultiSampleCompressor where it would drop reads
       from all but 1 sample (now fixed).
    * AssessReducedCoverage moved from private to protected for packaging reasons.
 * #resolve GSA-639

At this point, this commit encompasses most of what is needed for het compression to go live.
There are still a few TODO items that I want to get in before the 2.5 release, but I will save
those for a separate branch because as it is I feel bad for the person who needs to review all
these changes (sorry, Mauricio).
2013-03-25 09:34:54 -04:00
Mauricio Carneiro eb33da6820 Added support to reduce reads to Callable Loci
-- added calls to representativeCount() of the pileup instead of using ++
-- renamed CallableLoci integration test
-- added integration test for reduce read support on callable loci
2013-03-21 15:53:04 -04:00
Mark DePristo 7ae15dadbe HC now by default only uses reads with MAPQ >= 20 for assembly and calling
-- Previously we tried to include lots of these low mapping quality reads in the assembly and calling, but we effectively were just filtering them out anyway while generating an enormous amount of computational expense to handle them, as well as much larger memory requirements.  The new version simply uses a read filter to remove them upfront.  This causes no major problems -- at least, none that don't have other underlying causes -- compared to 10-11mb of the KB
-- Update MD5s to reflect changes due to no longer including mmq < 20 by default
2013-03-21 13:10:50 -04:00
Mark DePristo 3a8f001c27 Misc. fixes upon pull request review
-- DeBruijnAssemblerUnitTest and AlignmentUtilsUnitTest were both in DEBUG = true mode (bad!)
-- Remove the maxHaplotypesToConsider feature of HC as it's not useful
2013-03-20 22:54:37 -04:00
Mark DePristo 98c4cd060d HaplotypeCaller now uses SeqGraph instead of kmer graph to build haplotypes.
-- DeBruijnAssembler functions are no longer static.  This isn't the right way to unit test your code
-- An a HaplotypeCaller command line option to use low-quality bases in the assembly
-- Refactored DeBruijnGraph and associated libraries into base class
-- Refactored out BaseEdge, BaseGraph, and BaseVertex from DeBruijn equivalents.  These DeBruijn versions now inherit from these base classes.  Added some reasonable unit tests for the base and Debruijn edges and vertex classes.
-- SeqVertex: allows multiple vertices in the sequence graph to have the same sequence and yet be distinct
-- Further refactoring of DeBruijnAssembler in preparation for the full SeqGraph <-> DeBruijnGraph split
-- Moved generic methods in DeBruijnAssembler into BaseGraph
-- Created a simple SeqGraph that contains SeqVertex objects
-- Simple chain zipper for SeqGraph that reproduces the results for the mergeNode function on DeBruijnGraphs
-- A working version of the diamond remodeling algorithm in SeqGraph that converts graphs that look like A -> Xa, A -> Ya, Xa -> Z, Ya -> Z into A -> X -> a, A -Y -> a, a -> Z
-- Allow SeqGraph zip merging of vertices where the in vertex has multiple incoming edges or the out vertex has multiple outgoing edges
-- Fix all unit tests so they work with the new SeqGraph system.  All tests passed without modification.
-- Debugging makes it easier to tell which kmer graph contributes to a haplotype
-- Better docs and unit tests for BaseVertex, SeqVertex, BaseEdge, and KMerErrorCorrector
-- Remove unnecessary printing of cleaning info in BaseGraph
-- Turn off kmer graph creation in DeBruijnAssembler.java
-- Only print SeqGraphs when debugGraphTransformations is set to true
-- Rename DeBruijnGraphUnitTest to SeqGraphUnitTest.  Now builds DeBruijnGraph, converts to SeqGraph, uses SeqGraph.mergenodes and tests for equality.
-- Update KBestPathsUnitTest to use SeqGraphs not DebruijnGraphs
-- DebruijnVertex now longer takes kmer argument -- it's implicit that the kmer length is the sequence.length now
2013-03-20 22:54:36 -04:00
Mark DePristo ffea6dd95f HaplotypeCaller now has the ability to only consider the best N haplotypes for genotyping
-- Added a -dontGenotype mode for testing assembly efficiency
-- However, it looks like this has a very negative impact on the quality of the results, so the code should be deleted
2013-03-20 22:54:36 -04:00
Mark DePristo a8fb26bf01 A generic downsampler that reduces coverage for a bunch of reads
-- Exposed the underlying minElementsPerStack parameter for LevelingDownsampler
2013-03-20 22:54:35 -04:00
Mark DePristo 752440707d AlignmentUtils.calcNumDifferentBases computes the number of bases that differ between a reference and read sequence given a cigar between the two. 2013-03-20 22:54:35 -04:00
Geraldine Van der Auwera d70bf64737 Created new DeprecatedToolChecks class
--Based on existing code in GenomeAnalysisEngine
	--Hashmaps hold mapping of deprecated tool name to version number and recommended replacement (if any)
	--Using FastUtils for maps; specifically Object2ObjectMap but there could be a better type for Strings...
	--Added user exception for deprecated annotations
	--Added deprecation check to AnnotationInterfaceManager.validateAnnotations
	--Run when annotations are initialized
	--Made annotation sets instead of lists
2013-03-20 06:46:02 -04:00
Geraldine Van der Auwera 6b4d88ebe9 Created ListAnnotations utility (extends CommandLineProgram)
--Refactored listAnnotations basic method out of VA into HelpUtils
	--HelpUtils.listAnnotations() is now called by both VA and the new ListAnnotations utility (lives in sting.tools)
	--This way we keep the VA --list option but we also offer a way to list annotations without a full valid VA command-line, which was a pain users continually complained about
	--We could get rid of the VA --list option altogether ...?
2013-03-20 06:15:27 -04:00
Geraldine Van der Auwera 95a9ed853d Made some documentation updates & fixes
--Mostly doc block tweaks
	--Added @DocumentedGATKFeature to some walkers that were undocumented because they were ending up in "uncategorized". Very important for GSA: if a walker is in public or protected, it HAS to be properly tagged-in. If it's not ready for the public, it should be in private.
2013-03-20 06:15:20 -04:00
Mark DePristo d7bec9eb6e AssessNA12878 bugfixes
-- @Output isn't required for AssessNA12878
-- Previous version would could non-variant sites in NA12878 that resulted from subsetting a multi-sample VC to NA12878 as CALLED_BUT_NOT_IN_DB sites.  Now they are properly skipped
-- Bugfix for subsetting samples to NA12878.  Previous version wouldn't trim the alleles when subsetting down a multi-sample VCF, so we'd have false FN/FP sites at indels when the multi-sample VCF has alleles that result in the subset for NA12878 having non-trimmed alleles.  Fixed and unit tested now.
2013-03-18 15:48:08 -04:00
Ami Levy-Moonshine 0e9c1913ff fix typos in argument docs and in printed output in CoveredByNSamplesSites and rewrite an unaccurate comment 2013-03-18 13:54:21 -04:00
Mark DePristo 2b80068164 Merged bug fix from Stable into Unstable 2013-03-18 12:36:21 -04:00
Mark DePristo 7ab7c873a1 Temp. to PairHMM to avoid bad likelihoods
-- Simply caps PairHMM likelihoods from rising above 0 by taking the min of the likelihood and 0.  Will be properly fixed in GATK 2.5 with better PairHMM implementation.
2013-03-18 12:34:51 -04:00
David Roazen a67d8c8dd6 Bump timeout for MaxRuntimeIntegrationTest
Looks like returning this timeout to its original value was a
bit too aggressive -- adding 40 seconds to the tolerance limit.
2013-03-17 16:17:29 -04:00
David Roazen 742a7651e9 Further tweaking of test timeouts
Increase one timeout, restore others that were only timing out due to the
Java crypto lib bug to their original values.

-DOUBLE timeout for NanoSchedulerUnitTest.testNanoSchedulerInLoop()

-REDUCE timeout for EngineFeaturesIntegrationTest to its original value

-REDUCE timeout for MaxRuntimeIntegrationTest to its original value

-REDUCE timeout for GATKRunReportUnitTest to its original value
2013-03-15 14:49:21 -04:00
Mark DePristo 8317cc155e Merge pull request #108 from broadinstitute/eb_bqsr_out_of_bounds_fix
Added check in the MalformedReadFilter for reads without stored bases (i...
2013-03-14 17:29:35 -07:00
MauricioCarneiro 6f0269df2c Merge pull request #107 from broadinstitute/eb_fix_bqsr_clip_exception 2013-03-14 14:40:06 -07:00
Eric Banks 232afdcbea Added check in the MalformedReadFilter for reads without stored bases (i.e. that use '*').
* We now throw a User Error for such reads
  * User can override this to filter instead with --filter_bases_not_stored
  * Added appropriate unit test
2013-03-14 17:17:26 -04:00
droazen 0fd9f0e77c Merge pull request #104 from broadinstitute/eb_fix_output_annotation_GSA-837
Fixed the logic of the @Output annotation and its interaction with 'required'
2013-03-14 12:52:00 -07:00
Ryan Poplin 38914384d1 Changing CALLED_IN_DB_UNKNOWN_STATUS to count as TRUE_POSITIVEs in the simplified stats for AssessNA12878. 2013-03-14 14:44:18 -04:00
Eric Banks 6d6264b108 Merge pull request #105 from broadinstitute/gg_annotations_cleanup_45802765
Cleaned up annotations
2013-03-14 11:35:00 -07:00
Geraldine Van der Auwera 61349ecefa Cleaned up annotations
- Moved AverageAltAlleleLength, MappingQualityZeroFraction and TechnologyComposition to Private
  - VariantType, TransmissionDisequilibriumTest, MVLikelihoodRatio and GCContent are no longer Experimental
  - AlleleBalanceBySample, HardyWeinberg and HomopolymerRun are Experimental and available to users with a big bold caveat message
  - Refactored getMeanAltAlleleLength() out of AverageAltAlleleLength into GATKVariantContextUtils in order to make QualByDepth independent of where AverageAltAlleleLength lives
  - Unrelated change, bundled in for convenience: made HC argument includeUnmappedreads @Hidden
  - Removed unnecessary check in AverageAltAlleleLength
2013-03-14 14:26:48 -04:00
Eric Banks 7cab709a88 Fixed the logic of the @Output annotation and its interaction with 'required'.
ALL GATK DEVELOPERS PLEASE READ NOTES BELOW:

I have updated the @Output annotation to behave differently and to include a 'defaultToStdout' tag.
  * The 'defaultToStdout' tags lets walkers specify whether to default to stdout if -o is not provided.
  * The logic for @Output is now:
    * if required==true then -o MUST be provided or a User Error is generated.
    * if required==false and defaultToStdout==true then the output is assigned to stdout if no -o is provided.
      * this is the default behavior (i.e. @Output with no modifiers).
    * if required==false and defaultToStdout==false then the output object is null.
      * use this combination for truly optional outputs (e.g. the -badSites option in AssessNA12878).

  * I have updated walkers so that previous behavior has been maintained (as best I could).
    * In general, all @Outputs with default long/short names have required=false.
    * Walkers with nWayOut options must have required==false and defaultToStdout==false (I added checks for this)
  * I added unit tests for @Output changes with David's help (thanks!).
  * #resolve GSA-837
2013-03-14 11:58:51 -04:00
Eric Banks 573ed07ad0 Fixed reported bug in BQSR for RNA seq alignments with Ns.
* ClippingOp updated to incorporate Ns in the hard clips.
  * ReadUtils.getReadCoordinateForReferenceCoordinate() updated to account for Ns.
  * Added test that covers the BQSR case we saw.
  * Created GSA-856 (for Mauricio) to add lots of tests to ReadUtils.
    * It will require refactoring code and not in the scope of what I was willing to do to fix this.
2013-03-14 11:26:52 -04:00
Eric Banks ff87b62fe3 Fixed bug in SelectVariants where maxIndelSize argument wasn't getting applied to deletions.
Added unit tests and docs.
2013-03-13 15:11:34 -04:00
Mark DePristo b5b63eaac7 New GATKSAMRecord concept of a strandless read, update to FS
-- Strandless GATK reads are ones where they don't really have a meaningful strand value, such as Reduced Reads or fragment merged reads.  Added GATKSAMRecord support for such reads, along with unit tests
-- The merge overlapping fragments code in FragmentUtils now produces strandless merged fragments
-- FisherStrand annotation generalized to treat strandless as providing 1/2 the representative count for both strands.  This means that that merged fragments are properly handled from the HC, so we don't hallucinate fake strand-bias just because we managed to merge a lot of reads together.
-- The previous getReducedCount() wouldn't work if a read was made into a reduced read after getReducedCount() had been called.  Added new GATKSAMRecord method setReducedCounts() that does the right thing.  Updated SlidingWindow and SyntheticRead to explicitly call this function, and so the readTag parameter is now gone.
-- Update MD5s for change to FS calculation.  Differences are just minor updates to the FS
2013-03-13 11:16:36 -04:00
Mark DePristo 925846c65f Cleanup of FragmentUtils
-- Code was undocumented, big, and not well tested.  All three things fixed.
-- Currently not passing, but the framework works well for testing
-- Added concat(byte[] ... arrays) to utils
2013-03-13 07:36:20 -04:00
David Roazen 8ed78b453f Increase timeout for a test in the EngineFeaturesIntegrationTest
-This test was intermittently failing when run on the farm
2013-03-12 23:53:26 -04:00
Mark DePristo b3f67899b5 Merge pull request #101 from broadinstitute/dr_fix_failing_parallel_tests
Fix more tests that fail when run in parallel on the farm
2013-03-12 14:11:02 -07:00
David Roazen cdb1fa1105 Fix more tests that fail when run in parallel on the farm
-Allow the default S3 put timeout of 30 seconds for GATKRunReports
 to be overridden via a constructor argument, and use a timeout
 of 300 seconds for tests. The timeout remains 30 seconds in all
 other cases.

-Change integration tests that themselves dispatch farm jobs
 into pipeline tests. Necessary because some farm nodes are
 not set up as submit hosts. Pipeline tests are still run
 directly on gsa4.

-Bump up the timeout for the MaxRuntimeIntegrationTest even more
 (was still occasionally failing on the farm!)
2013-03-12 16:53:30 -04:00
Geraldine Van der Auwera f972963918 Fixed issues raised by Appistry QA (mostly small fixes, corrections & clarifications to GATKDocs)
GATK-73 updated docs for bqsr args
GATK-9 differentiate CountRODs from CountRODsByRef
GATK-76 generate GATKDoc for CatVariants
GATK-4 made resource arg required
GATK-10 added -o, some docs to CountMales; some docs to CountLoci
GATK-11 fixed by MC's -o change; straightened out the docs.
GATK-77 fixed references to wiki
GATK-76 Added Ami's doc block
GATK-14 Added note that these annotations can only be used with VariantAnnotator
GATK-15 specified required=false for two arguments
GATK-23 Added documentation block
GATK-33 Added documentation
GATK-34 Added documentation
GATK-32 Corrected arg name and docstring in DiffObjects
GATK-32 Added note to DO doc about reference (required but unused)
GATK-29 Added doc block to CountIntervals
GATK-31 Added @Output PrintStream to enable -o
GATK-35 Touched up docs
GATK-36 Touched up docs, specified verbosity is optional
GATK-60 Corrected GContent annot module location in gatkdocs
GATK-68 touched up docs and arg docstrings
GATK-16 Added note of caution about calling RODRequiringAnnotations as a group
GATK-61 Added run requirements (num samples, min genotype quality)
Tweaked template and generic doc block formatting (h2 to h3 titles)
GATK-62 Added a caveat to HR annot
Made experimental annotation hidden
GATK-75 Added setup info regarding BWA
GATK-22 Clarified some argument requirements
GATK-48 Clarified -G doc comments
GATK-67 Added arg requirement
GATK-58 Added annotation and usage docs
GSATDG-96 Corrected doc
Updated MD5 for DiffObjectsIntegrationTests (only change is link in table title)
2013-03-12 10:57:14 -04:00
Guillermo del Angel 695723ba43 Two features useful for ancient DNA processing.
Ancient DNA sequencing data is in many ways different from modern data, and methods to analyze it need to be adapted accordingly.
Feature 1: Read adaptor trimming. Ancient DNA libraries typically have very short inserts (in the order of 50 bp), so typical Illumina libraries sequenced in, say, 100bp HiSeq will have a large adaptor component being read after the insert.
If this adaptor is not removed, data will not be aligneable. There are third party tools that remove adaptor and potentially merge read pairs, but are cumbersome to use and require precise knowledge of the library construction and adaptor sequence.
-- New walker ReadAdaptorTrimmer walks through paired end data, computes pair overlap and trims auto-detected adaptor sequence.
-- Unit tests added for trimming operation.
-- Utility walker (may be retired later) DetailedReadLengthDistribution computes insert size or read length distribution stratified by read group and mapping status and outputs a GATKReport with data.
-- Renamed MaxReadLengthFilter to ReadLengthFilter and added ability to specify minimum read length as a filter (may be useful if, as a consequence of adaptor trimming, we're left with a lot of very short reads which will map poorly and will just clutter output BAMs).

Feature 2: Unbiased site QUAL estimation: many times ancestral allele status is not known and VCF fields like QUAL, QD, GQ, etc. are affected by the pop. gen. prior at a site. This might introduce subtle biases in studies where a species is aligned against the reference of another species, so an option for UG and HC not to apply such prior is introduced.
-- Added -noPrior argument to StandardCallerArgumentCollection.
-- Added option not to fill priors is such argument is set.
-- Added an integration test.
2013-03-09 18:18:13 -05:00
Yossi Farjoun baad965a57 - Changed loadContaminationFile file parser to delimit by tab only. This allows spaces in sampleIDs, which apparently are allowed.
- This was needed since samples with spaces in their names are regularly found in the picard pipeline.
- Modified the tests to account for this (removed spaces from the good tests, and changed the failing tests accordingly)
- Cleaned up the unit tests using a @DataProvider (I'm in love...).
- Moved AlleleBiasedDownsamplingUtilsUnitTest to public to match location of class it is testing (due to the way bamboo operates)
2013-03-07 13:04:24 -05:00
David Roazen 3ab78543a7 Fix tests that were consistently or intermittently failing when run in parallel on the farm
-Make MaxRuntimeIntegrationTest more lenient by assuming that startup overhead
 might be as long as 120 seconds on a very slow node, rather than the original
 assumption of 20 seconds

-In TraverseActiveRegionsUnitTest, write temp bam file to the temp directory, not
 to the current working directory

-SimpleTimerUnitTest: This test was internally inconsistent. It asserted that
 a particular operation should take no more than 10 milliseconds, and then asserted
 again that this same operation should take no more than 100 microseconds (= 0.1 millisecond).
 On a slow node it could take slightly longer than 100 microseconds, however.
 Changed the test to assert that the operation should require no more than 10000 microseconds
 (= 10 milliseconds)

-change global default test timeout from 20 to 40 minutes (things just take longer
 on the farm!)

-build.xml: allow runtestonly target to work with scala test classes
2013-03-06 13:56:54 -05:00
Eric Banks 3759d9dd67 Added the functionality to impose a relative ordering on ReadTransformers in the GATK engine.
* ReadTransformers can say they must be first, must be last, or don't care.
  * By default, none of the existing ones care about ordering except BQSR (must be first).
    * This addresses a bug reported on the forum where BAQ is incorrectly applied before BQSR.
  * The engine now orders the read transformers up front before applying iterators.
  * The engine checks for enabled RTs that are not compatible (e.g. both must be first) and blows up (gracefully).
  * Added unit tests.
2013-03-06 12:38:59 -05:00
Mark DePristo 446cd61f7e Merge pull request #84 from broadinstitute/eb_allelic_primitives
Added new walker to split MNPs into their allelic primitives (SNPs).
2013-03-06 09:02:21 -08:00
Menachem Fromer 5577715ae2 Have all significant XHMM commands be run with LongRunTime 2013-03-06 10:18:23 -05:00
Eric Banks 78721ee09b Added new walker to split MNPs into their allelic primitives (SNPs).
* Can be extended to complex alleles at some point.
  * Currently only works for bi-allelics (documented).
  * Added unit and integration tests.
2013-03-05 23:16:42 -05:00
Mauricio Carneiro e2d41f0282 Turning @Output required to false
By default all output is assigned to stdout if a -o is not provided. Technically this makes @Output a not required parameter, and the documentation is misleading because it's reading from the annotation.
GSA-820 #resolve
2013-03-05 17:26:16 -05:00
Eric Banks 2be57fbcfb Merged bug fix from Stable into Unstable 2013-03-05 13:28:46 -05:00
Eric Banks 5e89f01e10 Don't allow the use of compressed (.gz) references in the GATK. 2013-03-05 13:28:19 -05:00
Mauricio Carneiro d0c8105387 Cleaning up hilarious exception messages
Too many users (with RNASeq reads) are hitting these exceptions that were never supposed to happen. Let's give them (and us) a better and clearer error message.
2013-03-04 16:52:22 -05:00
Mark DePristo 42d3919ca4 Expanded functionality for writing BAMs from HaplotypeCaller
-- The new code includes a new mode to write out a BAM containing reads realigned to the called haplotypes from the HC, which can be easily visualized in IGV.
-- Previous functionality maintained, with bug fixes
-- Haplotype BAM writing code now lives in utils
-- Created a base class that includes most of the functionality of writing reads realigned to haplotypes onto haplotypes.
-- Created two subclasses, one that writes all haplotypes (previous functionality) and a CalledHaplotypeBAMWriter that will only write reads aligned to the actually called haplotypes
-- Extended PerReadAlleleLikelihoodMap.getMostLikelyAllele to optionally restrict set of alleles to consider best
-- Massive increase in unit tests in AlignmentUtils, along with several new powerful functions for manipulating cigars
-- Fix bug in SWPairwiseAlignment that produces cigar elements with 0 size, and are now fixed with consolidateCigar in AlignmentUtils
-- HaplotypeCaller now tracks the called haplotypes in the GenotypingEngine, and returns this information to the HC for use in visualization.
-- Added extensive docs to HaplotypeCaller on how to use this capability
-- BUGFIX -- don't modify the read bases in GATKSAMRecord in LikelihoodCalculationEngine in the HC
-- Cleaned up SWPairwiseAlignment.  Refactored out the big main and supplementary static methods.  Added a unit test with a bug TODO to fix what seems to be an edge case bug in SW
-- Integration test to make sure we can actually write a BAM for each mode.  This test only ensures that the code runs and doesn't exception out.  It doesn't actually enforce any MD5s
-- HaplotypeBAMWriter also left aligns indels in the reads, as SW can return a random placement of a read against the haplotype.  Calls leftAlign to make the alignments more clear, with unit test of real read to cover this case
-- Writes out haplotypes for both all haplotype and called haplotype mode
-- Haplotype writers now get the active region call, regardless of whether an actual call was made.  Only emitting called haplotypes is moved down to CalledHaplotypeBAMWriter
2013-03-03 12:07:29 -05:00
depristo 6204e6ccc9 Merge pull request #76 from broadinstitute/md_kb_bugfix_GSA-795
Bug fixes and optimizations for NA12878 KB
2013-03-01 10:52:16 -08:00
Eric Banks ebd5404124 Fixed the add functionality of GenomeLocSortedSet.
* Fixed GenomeLocSortedSet.add() to ensure that overlapping intervals are detected and an exception is thrown.
 * Fixed GenomeLocSortedSet.addRegion() by merging it with the add() method; it now produces sorted inputs in all cases.
 * Cleaned up duplicated code throughout the engine to create a list of intervals over all contigs.
 * Added more unit tests for add functionality of GLSS.
 * Resolves GSA-775.
2013-02-28 23:31:00 -05:00
Mark DePristo 4095a9ef32 Bugfixes for AssessNA12878
-- Refactor initialization routine into BadSitesWriter.  This now adds the GQ and DP genotype header lines which are necessarily if the input VCF doesn't have proper headers
-- GATKVariantContextUtils subset to biallelics now tolerates samples with bad GL values for multi-allelics, where it just removes the PLs and issues a warning.
2013-02-28 10:35:06 -05:00
depristo 92d6a4f441 Merge pull request #75 from broadinstitute/eb_missing_rg_error_GSA-407
Added better error message for BAMs with bad read groups.
2013-02-28 05:20:39 -08:00
Eric Banks 12fc198b80 Added better error message for BAMs with bad read groups.
* Split the cases into reads that don't have a RG at all vs. those with a RG that's not defined in the header.
  * Added integration tests to make sure that the correct error is thrown.
  * Resolved GSA-407.
2013-02-27 16:02:56 -05:00
Eric Banks 69b8173535 Replace uses of NestedHashMap with NestedIntegerArray.
* Removed from codebase NestedHashMap since it is unused and untested.
 * Integration tests change because the BQSR CSV is now sorted automatically.
 * Resolves GSA-732
2013-02-27 14:03:39 -05:00
David Roazen 752f4335a5 Merged bug fix from Stable into Unstable 2013-02-27 05:20:41 -05:00
David Roazen 2a7af43164 Fix improper dependencies in QScripts used by pipeline tests, and attempt to fix the flawed MisencodedBaseQualityUnitTest
-Some QScripts used by public pipeline tests unnecessarily used the (now protected) UnifiedGenotyper.
 Changed them to use PrintReads instead.

-Moved ExampleUnifiedGenotyperPipelineTest to protected

-Attempt to fix the flawed and sporadically failing MisencodedBaseQualityUnitTest:

   After looking at this class a bit, I think the problem was the use of global arrays for the quals
   shared across all reads in all tests (BAMRecord class definitely does not make a separate copy for
   each read!). One test (testFixBadQuals) modifies the bad quals array, and if this happens to run
   before the testBadQualsThrowsError test the bad quals array will have been "fixed" and no exception
   will be thrown.
2013-02-27 04:45:53 -05:00
David Roazen a53b4a7521 Merged bug fix from Stable into Unstable 2013-02-26 21:41:13 -05:00
David Roazen 65d31ba4ad Fix runtime public -> protected dependencies in the test suite
-replace unnecessary uses of the UnifiedGenotyper by public integration tests
 with PrintReads

-move NanoSchedulerIntegrationTest to protected, since it's completely dependent
 on the UnifiedGenotyper
2013-02-26 21:19:12 -05:00
depristo 93205154b5 Merge pull request #63 from broadinstitute/eb_fix_pairhmm_unittest_GSA-776
Eb fix pairhmm unittest gsa 776
2013-02-26 11:56:58 -08:00
Mauricio Carneiro 711cbd3b5a Archiving CoverageBySample
This walker was not updated since 2009, and users were getting wrong answers when running it with ReduceReads. I don't want to deal with this because DiagnoseTargets does everything this walker does.
2013-02-26 13:49:00 -05:00
depristo 51d618de97 Merge pull request #62 from broadinstitute/rp_increase_max_kmer_in_assembly
The maximum kmer length is derived from the reads.
2013-02-26 05:37:02 -08:00
Eric Banks 7519484a38 Refactored PairHMM.initialize to first take haplotype max length and then the read max length so that it is consistent with other PairHMM methods. 2013-02-25 15:04:23 -05:00
Ryan Poplin 89e2943dd1 The maximum kmer length is derived from the reads.
-- This is done to take advantage of longer reads which can produce less ambiguous haplotypes
-- Integration tests change for HC and BiasedDownsampling
2013-02-25 14:40:25 -05:00
David Roazen 3645ea9bb6 Sequence dictionary validation: detect problematic contig indexing differences
The GATK engine does not behave correctly when contigs are indexed
differently in the reads sequence dictionaries vs. the reference
sequence dictionary, and the inconsistently-indexed contigs are included
in the user's intervals. For example, given the dictionaries:

Reference dictionary = { chrM, chr1, chr2, ... }
BAM dictionary       = { chr1, chr2, ... }

and the interval "-L chr1", the engine would fail to correctly retrieve
the reads from chr1, since chr1 has a different index in the two dictionaries.

With this patch, we throw an exception if there are contig index differences
between the dictionaries for reads and reference, AND the user's intervals
include at least one of the mismatching contigs.

The user can disable this exception via -U ALLOW_SEQ_DICT_INCOMPATIBILITY

In all other cases, dictionary validation behaves as before.

I also added comprehensive unit tests for the (previously-untested)
SequenceDictionaryUtils class.

GSA-768 #resolve
2013-02-25 11:14:22 -05:00
Ryan Poplin 6a639c8ffc Replace Smith-Waterman alignment with the bubble traversal.
-- Instead of doing a full SW alignment against the reference we read off bubbles from the assembly graph.
-- Smith-Waterman is run only on the base composition of the bubbles which drastically reduces runtime.
-- Refactoring graph functions into a new DeBruijnAssemblyGraph class.
-- Bug fix in path.getBases().
-- Adding validation code to the assembly engine.
-- Renaming SimpleDeBruijnAssembler to match the naming of the new Assembly graph class.
-- Adding bug fixes, docs and unit tests for DeBruijnAssemblyGraph and KBestPaths classes.
-- Added ability to ignore bubbles that are too divergent from the reference
-- Max kmer can't be bigger than the extension size.
-- Reverse the order that we create the assembly graphs so that the bigger kmers are used first.
-- New algorithm for determining unassembled insertions based on the bubble traversal instead of the full SW alignment.
-- Don't need the full read span reference loc for anything any more now that we clip down to the extended loc for both assembly and likelihood evaluation.
-- Updating HaplotypeCaller and BiasedDownsampling integration tests.
-- Rebased everything into one commit as requested by Eric
-- improvements to the bubble traversal are coming as a separate push
2013-02-22 15:42:16 -05:00
depristo 2ad559cf58 Merge pull request #59 from broadinstitute/mc_reving_testng_GSA-695
Updating TestNG to the latest version
2013-02-22 10:39:04 -08:00
Mauricio Carneiro 4ac50c89ad Updating TestNG to the latest version
-- changed SkipException constructors that are now private in TestNG
-- Updated build.xml to use the latest testng
-- Added guice dependency to ivy
-- Fixed broken SampleDBUnitTest

The SampleDBUnitTest was only passing before because the map comparison in the old TestNG was broken. It was comparing two DIFFERENT samples and testing for "equals"

GSA-695 #resolve
2013-02-22 09:40:23 -05:00
Mark DePristo 182c32a2b7 Relax bounds checking in QualityUtils.boundQual
-- Previous version did runtime checking that qual >= 0 but BQSR was relying on boundQual to restore -1 to 1.  So relax the bound.
2013-02-22 08:46:59 -05:00
Mark DePristo 8ac6d3521f Vast improvements to AssessNA12878 code and functionality
-- AssessNA12878 now breaks out multi-allelics into bi-allelic components.  This means that we can properly assess multi-allelic calls against the bi-allelic KB
-- Refactor AssessNA12878, moving into assess package in KB.  Split out previously private classes in the walker itself into separate classes.  Added real docs for all of the classes.
-- Vastly expand (from 0) unit tests for NA12878 assessments
-- Allow sites only VCs to be evaluated by Assessor
-- Move utility for creating simple VCs from a list of string alleles from GATKVariantContextUtilsUnitTest to GATKVariantContextUtils
-- Assessor bugfix for discordant records at a site.  Previous version didn't handle properly the case where one had a non-matching call in the callset w.r.t. the KB, so that the KB element was eaten during the analysis.  Fixed.  UnitTested
-- See GSA-781 -- Handle multi-allelic variants in KB for more information
-- Bugfix for missing site counting in AssessNA12878.  Previous version would count N misses for every missed value at a site.  Not that this has much impact but it's worth fixing
-- UnitTests for BadSitesWriter
-- UnitTests for filtered and filtering sites in the Assessor
-- Cleanup end report generation code (simply the code).  Note that instead of "indel" the new code will print out "INDELS"
-- Assessor DoC calculations now us LIBS and RBPs for the depth calculation.  The previous version was broken for reduced reads.  Added unit test that reads a complex reduced read example and matches the DoC of this BAM with the output of the GATK DoC tool here.
-- Added convenience constructor for LIBS using just SAMFileReader and an iterator.  It's now easy to create a LIBS from a BAM at a locus.  Added advanceToLocus function that moves the LIBS to a specific position.  UnitTested via the assessor (which isn't ideal, but is a proper test)
2013-02-21 20:43:12 -05:00
Mark DePristo 29319bf222 Improved allele trimming code in GATKVariantContextUtils
-- Now supports trimming the alleles from both the reverse and forward direction.
-- Added lots of unit tests for forwrad allele trimming, as well as creating VC from forward and reverse trimming.
-- Added docs and tests for the code, to bring it up to GATK spec
2013-02-21 12:01:43 -05:00
Eric Banks 6996a953a8 Haplotype/Allele based optimizations for the HaplotypeCaller that knock off nearly 20% of the total runtime (multi-sample).
These 2 changes improve runtime performance almost as much as Ryan's previous attempt (with ID-based comparisons):
* Don't unnecessarily overload Allele.getBases() in the Haplotype class.
  * Haplotype.getBases() was calling clone() on the byte array.
* Added a constructor to Allele (and Haplotype) that takes in an Allele as input.
  * It makes a copy of he given allele without having to go through the validation of the bases (since the Allele has already been validated).
  * Rev'ed the variant jar accordingly.

For the reviewer: all tests passed before rebasing, so this should be good to go as far as correctness.
2013-02-21 10:14:11 -05:00
Geraldine Van der Auwera c3e01fea40 Added several more info types / annotations to GATKDocs
-- top-level walker type (locus, read etc)
-- parallelism options (nt or nct)
-- annotation type (for Variant Annotations)
-- downsampling settings that override engine defaults
-- reference window size
-- active region settings
-- partitionBy info
2013-02-21 03:12:40 -05:00
Geraldine Van der Auwera e674b4a524 Added new ReadFilter that allows users to specifically reassign one single mapping quality to a different value. Useful for TopHat and other RNA-seq software users. 2013-02-20 01:24:45 -05:00
MauricioCarneiro 76810465aa Merge pull request #40 from broadinstitute/gg_retrieve_readfilters_GSATDG-63 2013-02-19 19:42:35 -08:00
Mark DePristo 910d966428 Extend timeout of NanoScheduler deadlock tests
-- The previous timeout of 1 second was just dangerously short.  Increase the timeout to 10 seconds
2013-02-19 20:25:25 -05:00
Eric Banks 0055a6f1cd Merge pull request #45 from broadinstitute/mc_fix_indelrealigner_GSA-774
Fix to the Indel Realigner bug described in GSA-774
2013-02-19 16:16:48 -08:00
Geraldine Van der Auwera faef85841b Added GATKDocs fct to indicate default Read Filters for each tool
-- Added getClazzAnnotations() as hub to retrieve various annotations values and class properties through reflection
-- Added getReadFilters() method to retrieve Read Filter annotations
-- getReadFilters() uses recursion to walk up the inheritance to also capture superclass annotations
-- getClazzAnnotations() stores collected info in doc handler root, which is unit.forTemplate in Doclet
-- Modified FreeMarker template to use the Readfilters info (displayed after arg table, before additional capabilities)
-- Tadaaa :-) #GSATDG-63 resolve
2013-02-19 16:12:29 -05:00
Mauricio Carneiro 371ea2f24c Fixed IndelRealigner reference length bug (GSA-774)
-- modified ReadBin GenomeLoc to keep track of softStart() and softEnd() of the reads coming in, to make sure the reference will always be sufficient even if we want to use the soft-clipped bases
-- changed the verification from readLength to aligned bases to allow reads with soft-clipped bases
-- switched TreeSet -> PriorityQueue in the ConstrainedMateFixer as some different reads can be considered equal by picard's SAMRecordCoordinateComparator (the Set was replacing them)
-- pulled out ReadBin class so it can be testable
-- added unit tests for ReadBin with soft-clips
-- added tests for getMismatchCount (AlignmentUtils) to make sure it works with soft-clipped reads

GSA-774 #resolve
2013-02-19 16:00:36 -05:00
Mauricio Carneiro 815028edd4 Added verbose error message to the PluginManager
-- added a logger.error with a more descriptive message of what the most likely cause of the error is

Typical error happens when a walker's global variable is not initialized properly (usually in test conditions). The old error message was very hard to understand "Could not create module because of an exception of type NullPointerException ocurred caused by exception null"
2013-02-19 16:00:35 -05:00
Ryan Poplin c025e84c8b Fix for calculating read pos rank sum test with reads that are informative but don't actually overlap the variant due to some hard clipping.
-- Updated a few integration tests for HC, UG, and UG general ploidy
2013-02-19 14:09:24 -05:00
Mark DePristo be45edeff2 ActivityProfile and ActiveRegions respects engine interval boundaries
-- Active regions are created as normal, but they are split and trimmed to the engine intervals when added to the traversal, if there are intervals present.
-- UnitTests for ActiveRegion.splitAndTrimToIntervals
-- GenomeLocSortedSet.getOverlapping uses binary search to efficiently in ~ log N time find overlapping intervals
-- UnitTesting overlap function in GenomeLocSortedSet
-- Discovered fundamental implementation bug in that adding genome locs out of order (elements on 20 then on 19) produces an invalid GenomeLocSortedSet.  Created a JIRA to address this: https://jira.broadinstitute.org/browse/GSA-775
-- Constructor that takes a collection of genome locs now sorts its input and merges overlapping intervals
-- Added docs for the constructors in GLSS
-- Update HaplotypeCaller MD5s, which change because ActiveRegions are now restricted to the engine intervals, which changes slightly the regions in the tests and so the reads in the regions, and thus the md5s
-- GenomeAnalysisEngineUnitTest needs to provide non-null genome loc parser
2013-02-18 10:40:25 -05:00
Mark DePristo 3b67aa8aee Final edge case bug fixes to QualityUtil routines
-- log10 functions in QualityUtils allow -Infinity to allow log10(0.0) values
-- Fix edge condition of log10OneMinusX failing with Double.MIN_VALUE
-- Fix another edge condition of log10OneMinusX failing with a small but not min_value double
2013-02-16 07:31:38 -08:00
Mark DePristo b393c27f07 QualityUtils now uses runtime argument checks instead of contract
-- There's some runtime cost for these tests, but it's not big enough to outweigh the value of catching errors quickly
2013-02-16 07:31:38 -08:00
Mark DePristo 9a29d6d4be Fix an catastrophic bug (WoW!) in the reference calculation of the UG
-- The UG was using MathUtils binomial probability backward, so that the estimated confidence was always NaN, and was as a side effect other utils converted this to a meaningless 0.0.  This is all because there wasn't a unit test.
-- I've fixed the calculation, so it's now log10 based, uses robust MathUtils and QualityUtils functions to compute probabilities, and added a unit test.
2013-02-16 07:31:38 -08:00
Mark DePristo 9e28d1e347 Cleanup and unit tests for QualityUtils
-- Fixed a few conversion bugs with edge case quals (ones that were very high)
-- Fixed a critical bug in the conversion of quals that was causing near capped quals to fall below their actual value.  Will undoubtedly need to fix md5s
-- More precise prob -> qual calculations for very high confidence events in phredScaleCorrectRate, trueProbToQual, and errorProbToQual.  Very likely to improve accuracy of many calculations in the GATK
-- Added errorProbToQual and trueProbToQual calculations that accept an integer cap, and perform the (tricky) conversion from int to byte correctly.
-- Full docs and unit tests for phredScaleCorrectRate and phredScaleErrorRate.
-- Renamed probToQual to trueProbToQual
-- Added goodProbability and log10OneMinusX to MathUtils
-- Went through the GATK and cleaned up many uses of QualityUtils
-- Cleanup constants in QualityUtils
-- Added full docs for all of the constants
-- Rename MAX_QUAL_SCORE to MAX_SAM_QUAL_SCORE for clarity
-- Moved MAX_GATK_USABLE_Q_SCORE to RecalDatum, as it's s BQSR specific feature
-- Convert uses of QualityUtils.errorProbToQual(1-x) to QualityUtils.trueProbToQual(x)
-- Cleanup duplicate quality score routines in MathUtils.  Moved and renamed MathUtils.log10ProbabilityToPhredScale => QualityUtils.phredScaleLog10ErrorRate. Removed 3 routines from MathUtils, and remapped their usages into the better routines in QualityUtils
2013-02-16 07:31:37 -08:00
Yossi Farjoun aa99a5f47c Added an option to print out the version string
@argument (-)-version
(should this be @hidden?)

Prints out the version to System.out and quit(0)
No tests. (any ideas on how to test this would be happily accepted)
2013-02-15 12:42:59 -05:00
MauricioCarneiro bbfbe1bc26 Merge pull request #41 from broadinstitute/jt_cmi_queue_packaging
ValidatingPileup was renamed to CheckPileup
2013-02-15 09:19:00 -08:00
droazen 664960373d Merge pull request #31 from broadinstitute/yf_fast_BAM_index_traversal
-re-enables fast BAM indexing
2013-02-15 09:12:32 -08:00
Joel Thibault 182a950202 ValidatingPileup was renamed to CheckPileup 2013-02-15 11:56:19 -05:00
MauricioCarneiro 1dd284a5bb Merge pull request #39 from broadinstitute/tj_printreads_tag_for_bqsr_GSA-720
PrintReads writes a header when used with -BQSR
2013-02-15 07:18:28 -08:00
MauricioCarneiro b58a0eca6b Merge pull request #33 from broadinstitute/gg_more_gatkdocs_tweaks_GSATDG-62
Refactored GATKDocs categories some more ( GSATDG-62 )
2013-02-14 22:35:07 -08:00
Tad Jordan 6cb80591e3 PrintReads writes a header when used with -BQSR 2013-02-14 22:19:14 -05:00
Yossi Farjoun 3a7c8c13e2 Re-enabled fastBAMindexing by replacing the FileChannel with a SeekableBufferedStream
This helps a lot since FileChannel is very low-level and traversing the BAMIndex involves lots of short reads.

- Fixed a deterioration in BAMIndex due to rev'ed picard (see below)
- Added unit tests for SeekableBufferedStream
- Added integrationTests for GATKBAMIndex (in PileupWalkerIntegrationTest)
- Added a runtime-test to verify that the amount read equals the amount requested.
- Added failing tests with expectedExceptions
- Used a DataProvider to make code nicer
2013-02-14 17:51:15 -05:00
Mark DePristo f92328a1a1 Extend default timeout to 20 minutes
-- The default of 10 minutes is right on the edge for some tests, and we really want a default not to enforce a max time (test should be short) but to stop testng from failing to terminate ever in the case where some test is truly hung
2013-02-13 17:43:40 -08:00
Geraldine Van der Auwera 6208742f7c Refactored GATKDocs categories some more ( GSATDG-62 )
-- Renamed ValidatePileup to CheckPileup since validation is reserved word
-- Renamed AlignmentValidation to CheckAlignment (same as above)
-- Refactored category definitions to use constants defined in HelpConstants
-- Fixed a couple of minor typos and an example error
-- Reorganized the GATKDocs index template to use supercategories
-- Refactored integration tests for renamed walkers (my earlier refactoring had screwed them up or not carried over)
2013-02-13 16:49:18 -05:00
Guillermo del Angel 4308b27f8c Fixed non-determinism in HaplotypeCaller and some UG calls -
-- HaplotypeCaller and PerReadAlleleLikelihoodMap should use LinkedHashMaps instead of plain HashMaps. That way the ordering when traversing alleles is maintained. If the JVM traverses HashMaps with random ordering, different reads (with same likelihood) may be removed by contamination checker, and different alleles may be picked if they have same likelihoods for all reads.
-- Put in some GATKDocs and contracts in HaplotypeCaller files (far from done, code is a beast)
-- Update md5's due to different order of iteration in LinkedHashMaps instead of HashMaps inside HaplotypeCaller  (due to change in PerReadAlleleLikelihoodMap that also slightly modifies reads chosen by per-read downsampling).
-- Reenabled testHaplotypeCallerMultiSampleGGAMultiAllelic test
-- Added some defensive argument checks into HaplotypeCaller public functions (not intended to be done yet).
2013-02-12 15:43:29 -05:00
Geraldine Van der Auwera dff5ef562b Reorganized walker categories in GATKDocs (@DocumentedGATKFeature details)
-- Sorted out contents of BAM Processing vs. Diagnostics & QC Tools
-- Moved two validation-related walkers from Diagnostics & QC to Validation Utilities
-- Reworded some category names and descriptions to be more explicit and user-friendly
2013-02-12 13:36:15 -05:00
Mark DePristo e40d83f00e Final version of PairHMMs with correct edge conditions
-- Uses 1/N for N potential start sites as the probability of starting at any one of the potential start sites
-- Add flag that says to use the original edge condition, respected by all subclasses.  This brings the new code back to the original state, but with all of the cleanup I've done
-- Only test configurations where the read length <= haplotype length.  I think this is actually the contract, but we'll talk about this tomorrow
-- Fix egregious bug with the myLog10SumLog10 function doing the exact opposite of the requested arguments, so that doExact really meant don't do exact
-- PairHMM now exposes computeReadLikelihoodGivenHaplotypeLog10 but subclasses must overload subComputeReadLikelihoodGivenHaplotypeLog10.  This protected function does the work, and the public function will do argument and result QC
-- Have to be more tolerant of reference (approximate) HMM.  All unit tests from the original HMM implementations pass now
-- Added locs of docs
-- Generalize unit tests with multiple equivalent matches of read to haplotype
-- Added runtime argument checking for initial and computeReadLikelihoodGivenHaplotypeLog10
-- Functions to dumpMatrices for debugging
-- Fix nasty bug (without original unit tests) in LoglessPairHMM
-- Max read and haplotype lengths only worked in previous code if they were exactly equal to the provided read and haplotype sizes.  Fixed bug.  Added unit test to ensure this doesn't break again.
-- Added dupString(string, n) method to Utils
-- Added TODOs for next commit.  Need to compute number of potential start sites not in initialize but in the calc routine since this number depends not on the max sizes but the actual read sizes
-- Unit tests for the hapStartIndex functionality of PairHMM
-- Moved computeFirstDifferingPosition to PairHMM, and added unit tests
-- Added extensive unit tests for the hapStartIndex functionality of computeReadLikelihoodGivenHaplotypeLog10
-- Still TODOs left in the code that I'll fix up
-- Logless now compute constants, if they haven't been yet initialized, even if you forgot to say so
-- General: the likelihood penalty for potential start sites is now properly computed against the actual read and reference bases, not the maximum.  This involved moving some initialize() code into the computeLikelihoods function.  That's ok because all of the potential log10 functions are actually going to cached versions, so the slowdown is minimal
-- Added some unit tests to ensure that common errors (providing haplotypes too long, reads too long, not initializing the HMM) are captured as errors
2013-02-09 19:19:22 -05:00
Mark DePristo 09595cdeb9 Remove ExactPairHMM and OriginalPairHMM, everyone just uses Log10PairHMM with appropriate arguments 2013-02-09 13:06:54 -05:00
Mark DePristo 2d802e17a4 Delete the CachingPairHMM 2013-02-09 13:06:54 -05:00
Mark DePristo 7dcafe8b81 Preliminary version of LoglessCachingPairHMM that avoids positive likelihoods
-- Would have been squashed but could not because of subsequent deletion of Caching and Exact/Original PairHMMs
-- Actual working unit tests for PairHMMUnitTest
-- Fixed incorrect logic in how I compared hmm results to the theoretical and exact results
-- PairHMM has protected variables used throughout the subclasses
2013-02-09 13:06:54 -05:00
Mark DePristo ca76de0619 Move ProcessUtilsUnitTest to private 2013-02-09 12:34:45 -05:00
MauricioCarneiro f5e52b72ea Merge pull request #23 from broadinstitute/md_process_utils_unit_tests
UnitTests for ProcessUtils
2013-02-09 09:27:31 -08:00
MauricioCarneiro 3ff10ab277 Merge pull request #24 from broadinstitute/md_ngsplatform_unittests
Expand NGSPlatform to meet SAM 1.4 spec, with full unit tests
2013-02-09 09:27:03 -08:00
Mark DePristo b127fc6a1a Expand NGSPlatform to meet SAM 1.4 spec, with full unit tests
-- Added CAPILLARY and HELICOS platforms as required by spec 1.4
-- Added extensive unit tests to ensure NGSPlatform functions work as expected.
-- Fixed some NPE bugs for reads that don't have RGs or PLs in their RG fields
2013-02-09 11:16:21 -05:00
Mark DePristo fc3307a97f UnitTests for ProcessUtils 2013-02-09 10:13:01 -05:00
Mark DePristo 7fb620dce7 Generalize and fixup ContigComparator
-- Now uses a SAMSequenceDictionary to do the comparison of contigs (which is the right way to do it)
-- Added unit tests
2013-02-09 09:52:13 -05:00
Mark DePristo a3dc7dc5cb Extend AWS timeout for uploads of the GATK run reports to 30 seconds 2013-02-08 17:37:36 -05:00
Mauricio Carneiro 5f49c95cc1 Added distance across contigs calculation to GenomeLocs
-- distance across contigs is calculated given a sequence dictionary (from SAMFileHeader)
-- unit test added
GSATDG-45
2013-02-07 16:31:41 -05:00
Eric Banks 9826192854 Added contracts, docs, and tests for several methods in AlignmentUtils. There are over 74K tests being run now for this class!
* AlignmentUtils.getMismatchCount()
* AlignmentUtils.calcAlignmentByteArrayOffset()
* AlignmentUtils.readToAlignmentByteArray().
* AlignmentUtils.leftAlignIndel()
2013-02-07 13:04:24 -05:00
eitanbanks 584899329c Merge pull request #13 from broadinstitute/dr_variant_migration_GSA-692
Replace org.broadinstitute.variant with jar built from the Picard repo
2013-02-06 07:22:30 -08:00
Eric Banks 562f2406d7 Added check that BaseRecalibrator is not being run on a reduced bam.
- Throws user exception if it is.
 - Can be turned off with --allow_bqsr_on_reduced_bams_despite_repeated_warnings argument.
 - Added test to check this is working.
 - Added docs to BQSRReadTransformer explaining why this check is not performed on PrintReads end.
 - Added small bug fix to GenomeAnalysisEngine that I uncovered in this process.
 - Added comment about not changing the program record name, as per reviewer comments.
 - Removed unused variable.
2013-02-06 10:14:27 -05:00
Eric Banks 4e5ff3d6f1 Bug fix for NPE in HC with --dbsnp argument.
- I had added the framework in the VA engine but should not have hooked it up to the HC yet since the RefMetaDataTracker is always null.
 - Added contracts and docs to the relevant methods in the VA engine so that this doesn't happen in the future.
2013-02-05 21:59:19 -05:00
David Roazen e7e76ed76e Replace org.broadinstitute.variant with jar built from the Picard repo
The migration of org.broadinstitute.variant into the Picard repo is
complete. This commit deletes the org.broadinstitute.variant sources
from our repo and replaces it with a jar built from a checkout of the
latest Picard-public svn revision.
2013-02-05 17:24:25 -05:00
Mauricio Carneiro f6bc5be6b4 Fixing license on Yossi's file
Somebody needs to set up the license hook ;-)
2013-02-05 11:14:43 -05:00
MauricioCarneiro 050c4794a5 Merge pull request #11 from yfarjoun/per_sample2
-Added Per-Sample Contamination Removal to UnifiedGenotyper: Added an @A...
2013-02-05 08:04:29 -08:00
Eric Banks 00c98ff0cf Need to reset the static counter before tests are run or else we won't be deterministic.
Also need to give credit where credit is due: David was right that this was not a non-deterministic Bamboo failure...
2013-02-05 10:41:46 -05:00
Yossi Farjoun de03f17be4 -Added Per-Sample Contamination Removal to UnifiedGenotyper: Added an @Advanced option to the StandardCallerArgumentCollection, a file which should
contain two columns, Sample (String) and Fraction (Double) that form the Sample-Fraction map for the per-sample AlleleBiasedDownsampling.
-Integration tests to UnifiedGenotyper (Using artificially contaminated BAMs created from a mixure of two broadly concented samples) were added
-includes throwing an exception in HC if called using per-sample contamination file (not implemented); tested in a new integration test.
-(Note: HaplotypeCaller already has "Flat" contamination--using the same fraction for all samples--what it doesn't have is
   _per-sample_ AlleleBiasedDownsampling, which is what has been added here to the UnifiedGenotyper.
-New class: DefaultHashMap (a Defaulting HashMap...) and new function: loadContaminationFile (which reads a Sample-Fraction file and returns a map).
-Unit tests to the new class and function are provided.
-Added tests to see that malformed contamination files are found and that spaces and tabs are now read properly.
-Merged the integration tests that pertain to biased downsampling, whether HaplotypeCaller or unifiedGenotyper, into a new IntegrationTest class.
2013-02-04 18:24:36 -05:00
Mark DePristo a281fa6548 Resolves Genome Sequence Analysis GSA-750 Don't print an endless series of starting messages from the ProgressMeter
-- The progress meter isn't started until the GATK actually calls execute on the microscheduler.  Now we get a message saying "Creating shard strategy" while this (expensive) operation runs
2013-02-04 15:47:30 -05:00
Tad Jordan eb847fa102 Message "script failed" moved to the correct place in the code
GSA-719 fixed
2013-02-04 15:37:23 -05:00
Chris Hartl 3c99010be4 Part 1 of Variant Annotator Unit tests: PerReadAlleleLikelihoodMap
- Added contract enforcement for public methods
 - Refactored the conversion from read -> (allele -> likelihood) to allele -> list[read] into its own method
 - added method documentation for non getters/setters
 - finals, finals everywhere
 - Add in a unit test for the PerReadAlleleLikelihoodMap. Complete coverage except for .clear() and a method that is a straight call into a separately-tested utility class.
2013-02-04 14:16:06 -05:00
Guillermo del Angel 5521bf3dd7 Fix bad contract implementation 2013-02-03 16:15:14 -05:00
Guillermo del Angel f31bf37a6f First step in better BQSR unit tests for covariates (not done yet): more test coverage in basic covariates, test logging several read groups/read lengths and more combinations simultaneously.
Add basic Javadocs headers for PerReadAlleleLikehoodMap.
2013-02-03 15:31:30 -05:00
Mark DePristo 8d08780582 GATKRunReport now tracks the errorMessage and errorThrown during post for later analysis
-- This is primarily useful in the unit tests, as I now print out additional information on why a test might have failed, if it in fact did.
2013-02-02 19:24:31 -05:00
Mark DePristo 6382d5bdc9 Final cleanup and unit testing for GATKRunReport
-- Bringing code up to document, style, and code coverage specs
-- Move GATKRunReportUnitTest to private
-- Fully expand GATKRunReportUnitTests to coverage writing and reading GATKRunReport to local disk, to standard out, to AWS.
-- Move documentation URL from GATKRunReport to UserException
-- Delete a few unused files from s3GATKReport
-- Added capabilities to GATKRunReport to make testing easier
-- Added capabilities to deserialize GATKRunReports from an InputStream
2013-02-02 15:06:56 -05:00
Mark DePristo eb17230c2f Update AWS access and private keys to the new GATK2LogUploader user
-- Updated EncryptAWSKeys to write the key into the correct resources directory
2013-02-02 15:06:56 -05:00
Eric Banks 03df5e6ee6 - Added more comprehensive tests for consensus creation to RR. Still need to add tests for I/D ops.
- Added RR qual correctness tests (note that this is a case where we don't add code coverage but still need to test critical infrastructure).
- Also added minor cleanup of BaseUtils
2013-02-01 15:37:19 -05:00
David Roazen c6581e4953 Update MD5s to reflect version number change in the BAM header
I've confirmed via a script that all of these differences only
involve the version number bump in the BAM headers and nothing
else:

< @HD   VN:1.0  GO:none SO:coordinate
---
> @HD   VN:1.4  GO:none SO:coordinate
2013-02-01 13:51:31 -05:00
David Roazen c4b0ba4d45 Temporarily back out the Picard team's patches to GATKBAMIndex from December
These patches to GATKBAMIndex are causing massive BAM index reading errors in
combination with the latest version of Picard. The bug is either in the patches
themselves or in the underlying SeekableBufferedStream class they rely on. Until
the cause can be identified, we are temporarily backing out these changes so that
we can continue to run with the latest Picard/Tribble.

This reverts commits:
81483ec21e528790dfa719d18cdee27d577ca98e
68cf0309db490b79eecdabb4034987ff825ffea8
54bb68f28ad5fe1b3df01702e9c5e108106a0176
2013-02-01 13:51:31 -05:00
David Roazen 1fb182d951 Restore Utils.appendArray()
This utility method was used by the PipelineTest class, and deleting it
was causing tests to not compile.
2013-02-01 13:51:31 -05:00
Mark DePristo 6d9816f1a5 Cleanup unused utils functions, and add unit test for one (append) 2013-02-01 13:51:31 -05:00
Mark DePristo 206eab80e3 Expanded unit tests for AlignmentUtils
-- Added JIRA entries for the remaining capabilities to be fixed up and unit tested
2013-02-01 13:51:31 -05:00
David Roazen 292037dfda Rev picard, sam-jdk, and tribble
This is a necessary prerequisite for the org.broadinstitute.variant migration.

-Picard and sam-jdk go from version 1.67.1197 to 1.84.1337

-Picard-private goes from version 2375 to 2662

-Tribble goes from version 119 to 1.84.1337

-RADICALLY trimmed down the list of classes we extract from Picard-private
 (jar goes from 326993 bytes to 6445 bytes!)
2013-02-01 13:51:30 -05:00
Ryan Poplin e07cefb058 Updating AlignmentUtils.consolidateCigar() to the GATK coding standards. 2013-02-01 13:51:30 -05:00
Mark DePristo c3c4e2785b UnitTest for calcNumHighQualityBases in AlignmentUtils 2013-01-31 13:57:23 -05:00
David Roazen 6ec1e613a2 Move AWS keys to a resources subdirectory within the phonehome package
Resources must be in a subdirectory called "resources" in the package
hierarchy to be picked up by the packaging system. Adding each resource
manually to the jars in build.xml does not cause the resource to be
added to the standalone GATK jar when we package the GATK, so it's best
to always use this convention.
2013-01-31 11:56:34 -05:00
Ryan Poplin 496727ac5e Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-31 11:51:08 -05:00
Ryan Poplin ac033ce41a Intermediate commit of new bubble assembly graph traversal algorithm for the HaplotypeCaller. Adding functionality for a path from an assembly graph to calculate its own cigar string from each of the bubbles instead of doing a massive Smith-Waterman alignment between the path's full base composition and the reference. 2013-01-31 11:32:19 -05:00
Eric Banks 9c0207f8ef Fixing BQSR/BAQ bug:
If a read had an existing BAQ tag, was clipped by our engine, and couldn't have the BAQ recalculated (for whatever reason), then we would
fail in the BQSR because we would default to using the old tag (which no longer matched the length of the read bases).
The right thing to do here is to remove the old BAQ tag when RECALCULATE and ADD_TAG are the BAQ modes used but BAQ cannot be recalculated.
Added a unit test to ensure that the tags are removed in such a case.
2013-01-31 11:03:17 -05:00
Mark DePristo 404ee9a6e4 More aggressive checking of AWS key quality upon startup in the GATK 2013-01-31 09:08:38 -05:00
Ryan Poplin 438c98035b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-30 17:12:28 -05:00
Ryan Poplin bb29bd7df7 Use base List and Map types in the HaplotypeCaller when possible. 2013-01-30 17:09:27 -05:00
Mark DePristo b707331332 Encrypt GATK AWS keys using the GATK private key, and decrypt as needed as a resource when uploading to AWS logs
-- Has the overall effect that the GATK user AWS keys are no longer visible in the gatk source as plain text.  This will stop AWS from emailing me (they crawl the web looking for keys)
-- Added utility EncryptAWSKeys that takes as command line arguments the GATK user AWS access and secret keys, encrypts them with the GATK private key, and writes out the resulting file to resources in phonehome.
-- GATKRunReport now decrypts as needed these keys using the GATK public key as resources in the GATK bundle
-- Refactored the essential function of Resource (reading the resource) from IOUtils into the class itself.  Now how to get the data in the resouce is straightforward
-- Refactored md5 calculation code from a byte[] into Utils.  Added unit tests
-- Committing the encrypted AWS keys
-- #resolves https://jira.broadinstitute.org/browse/GSA-730
2013-01-30 16:42:23 -05:00
David Roazen 591df2be44 Move additional VariantContext utility methods back to the GATK
Thanks to Eric for his feedback
2013-01-30 13:58:17 -05:00
David Roazen 9985f82a7a Move BaseUtils back to the GATK by request, along with associated utility methods 2013-01-30 13:09:44 -05:00
Mark DePristo 1ff78679ca UnitTesting example for copying
-- Example combinatorial unit tests, plus unit tests that create reads and bam files, pileups, variant context (from scratch and from a file), and genome locs
2013-01-30 11:19:08 -05:00
Eric Banks d067c7f136 Resolving merge conflicts 2013-01-30 10:47:59 -05:00
Eric Banks 9025567cb8 Refactoring the SimpleGenomeLoc into the now public utility UnvalidatingGenomeLoc and the RR-specific FinishedGenomeLoc.
Moved the merging utility methods into GenomeLoc and moved the unit tests around accordingly.
2013-01-30 10:45:29 -05:00
Mark DePristo 4852c7404e GenomeLocs are already comparable, so I'm removing the less complete GenomeLocComparator class and updating ReduceReads and CompressionStash to use built-in comparator 2013-01-30 10:12:27 -05:00
Mark DePristo 45603f58cd Refactoring and unit testing GenomeLocParser
-- Moved previously inner class to MRUCachingSAMSequenceDictionary, and unit test to 100% coverage
-- Fully document all functions in GenomeLocParser
-- Unit tests for things like parsePosition (shocking it wasn't tested!)
-- Removed function to specifically create GenomeLocs for VariantContexts.  The fact that you must incorporate END attributes in the context means that createGenomeLoc(Feature) works correctly
-- Depreciated (and moved functionality) of setStart, setStop, and incPos to GenomeLoc
-- Unit test coverage at like 80%, moving to 100% with next commit
2013-01-30 09:47:47 -05:00
Mark DePristo 8562bfaae1 Optimize GenomeLocParser.createGenomeLoc
-- The new version is roughly 2x faster than the previous version.  The key here was to cleanup the workflow for validateGenomeLoc and remove the now unnecessary synchronization blocks from the CachingSequencingDictionary, since these are now thread local variables
-- #resolves https://jira.broadinstitute.org/browse/GSA-724
2013-01-30 09:47:47 -05:00
Mark DePristo 69dd5cc902 AutoFormattingTimeUnitTest should be in utils 2013-01-30 09:47:47 -05:00
Mark DePristo 92c5635e19 Cleanup, document, and unit test ActiveRegion
-- All functions tested.  In the testing / review I discovered several bugs in the ActiveRegion routines that manipulate reads.  New version should be correct
-- Enforce correct ordering of supporting states in constructor
-- Enforce read ordering when adding reads to an active region in add
-- Fix bug in HaplotypeCaller map with new updating read spans.  Now get the full span before clipping down reads in map, so that variants are correctly placed w.r.t. the full reference sequence
-- Encapsulate isActive field with an accessor function
-- Make sure that all state lists are unmodifiable, and that the docs are clear about this
-- ActiveRegion equalsExceptReads is for testing only, so make it package protected
-- ActiveRegion.hardClipToRegion must resort reads as they can become out of order
-- Previous version of HC clipped reads but, due to clipping, these reads could no longer overlap the active region.  The old version of HC kept these reads, while the enforced contracts on the ActiveRegion detected this was a problem and those reads are removed.  Has a minor impact on PLs and RankSumTest values
-- Updating HaplotypeCaller MD5s to reflect changes to ActiveRegions read inclusion policy
2013-01-30 09:47:12 -05:00
David Roazen 6449c320b4 Fix the CachingIndexedFastaSequenceFileUnitTest
BaseUtils.convertIUPACtoN() no longer throws a UserException,
since it's in org.broadinstitute.variant
2013-01-29 21:07:16 -05:00
Mauricio Carneiro 29fd536c28 Updating licenses manually
Please check that your commit hook is properly pointing at ../../private/shell/pre-commit

Conflicts:
	public/java/test/org/broadinstitute/variant/VariantBaseTest.java
2013-01-29 17:27:53 -05:00
David Roazen a536e1da84 Move some VCF/VariantContext methods back to the GATK based on feedback
-Moved some of the more specialized / complex VariantContext and VCF utility
 methods back to the GATK.

-Due to this re-shuffling, was able to return things like the Pair class back
 to the GATK as well.
2013-01-29 16:56:55 -05:00
Ami Levy-Moonshine a1908a0eca Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-29 16:33:20 -05:00
Ami Levy-Moonshine 4aaef495c6 correct the help message 2013-01-29 16:33:12 -05:00
Ryan Poplin bf25196a0b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-28 22:33:13 -05:00
Ryan Poplin e9c3a0acdf fix typo 2013-01-28 22:18:58 -05:00
Ami Levy-Moonshine a8a68697f1 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-28 20:18:51 -05:00
Guillermo del Angel 5995f01a01 Big intermediate commit (mostly so that I don't have to go again through merge/rebase hell) in expanding BQSR capabilities. Far from done yet:
a) Add option to stratify CalibrateGenotypeLikelihoods by repeat - will add integration test in next push.
b) Simulator to produce BAM files with given error profile - for now only given SNP/indel error rate can be given. A bad context can be specified and if such context is present then error rate is increased to given value.
c) Rewrote RepeatLength covariate to do the right thing - not fully working yet, work in progress.
d) Additional experimental covariates to log repeat unit and combined repeat unit+length. Needs code refactoring/testing
2013-01-28 19:55:46 -05:00
Ami Levy-Moonshine 3f5c2e4989 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-28 19:04:52 -05:00
Ami Levy-Moonshine c103623cf6 bug fix in my new function at SampleUtils.java 2013-01-28 19:04:39 -05:00
Ryan Poplin d665a8ba0c The Bayesian calculation of Qemp in the BQSR is now hierarchical. This fixes issues in which the covariate bins were very sparse and the prior estimate being used was the original quality score. This resulted in large correction factors for each covariate which breaks the equation. There is also now a new option, qlobalQScorePrior, which can be used to ignore the given (very high) quality scores and instead use this value as the prior. 2013-01-28 15:56:33 -05:00
Tad Jordan 8777e02aa5 R issue in Queue fixed.
GSA-721
2013-01-28 14:42:20 -05:00
David Roazen f63f27aa13 org.broadinstitute.variant refactor, part 2
-removed sting dependencies from test classes
-removed org.apache.log4j dependency
-misc cleanup
2013-01-28 09:03:46 -05:00
David Roazen 1599c9a20e Remove the ability to package GATK/Queue Lite from the build system
Still need to reconfigure Bamboo to open-source protected, but this
can be done during the 2.4 release freeze.
2013-01-28 02:42:37 -05:00
David Roazen 3744d1a596 Collapse the downsampling fork in the GATK engine
With LegacyLocusIteratorByState deleted, the legacy downsampling implementation
was already non-functional. This commit removes all remaining code in the
engine belonging to the legacy implementation.
2013-01-28 01:50:30 -05:00
Mark DePristo 63913d516f Add join call to Progress meter unit test so we actually know the daemon thread has finished 2013-01-27 16:52:45 -05:00
Mark DePristo 14d8afe413 Remove startSearchAt state variable from ActivityProfile
-- New algorithm will only try to create an active region if there's at least maxREgionSize + propagation distance states in the list.  When that's true, we are guaranteed to actually find a region.  So this algorithm is not only truly correct but as super fast, as we only ever do the search for the end of the region when we will certainly find one, and actually generate a region.
2013-01-27 14:10:08 -05:00
Mark DePristo c97a361b5d Added realistic BandPassFilterUnitTest that ensures quality results for 1000G phase I VCF and NA12878 VCF
-- Helped ID more bugs in the ActivityProfile, necessitating a new algorithm for popping off active regions.  This new algorithm requires that at least maxRegionSize + prob. propagation distance states have been examined.  This ensures that the incremental results are the same as you get reading in an entire profile and running getRegions on the full profile
-- TODO is to remove incremental search start algorithm, as this is no longer necessary, and nicely eliminates a state variable I was always uncomfortable with
2013-01-27 14:10:08 -05:00
Mark DePristo 72b2e77eed Linearize the findEndOfRegion algorithm in ActivityProfile, radically improving its performance
-- Previous algorithm was O(N^2)
-- #resolve GSA-723 https://jira.broadinstitute.org/browse/GSA-723
2013-01-27 14:10:06 -05:00
Mark DePristo 0fb238b61e TraverseActiveRegions Optimizations and Bugfixes: make sure to record position of current locus to discharge active regions when there's no data
-- Now records the position of the current locus, as well as that of the last read.  Necessary when passing through regions with no reads.  The previous version would keep accumulating empty active regions, and never discharge them until end of traversal (if there was no reads in the future) or until a read was finally found
-- Protected a call to logger.debug with if ( logger.isDebugEnabled()) to avoid a lot of overhead in writing unseen debugger logging information
2013-01-27 14:10:06 -05:00
Mark DePristo 93d88cdc68 Optimization: LocusReferenceView now passes along the contig index to createGenomeLoc, speeding up their creation
-- Also cleaned up some unused methods
2013-01-27 14:10:06 -05:00
Mark DePristo 52a28968a9 ART optimization: BandPassActivityProfile only applies the gaussian filter if the state probability > 0 2013-01-27 14:10:06 -05:00
Mauricio Carneiro 705cccaf63 Making SplitReads output FastQ's instead of BAM
- eliminates one step in my pipeline
   - BAM is too finicky and maintaining parameters that wouldn't be useful was becoming a headache, better avoided.
2013-01-27 02:36:31 -05:00
Mauricio Carneiro 6ea7133d95 Updating licenses of latest moved files 2013-01-26 13:46:52 -05:00
Mauricio Carneiro e7c9e3639e Making metrics a required parameter in MarkDuplicates
As requested by user (forum)
2013-01-25 17:49:49 -05:00
Ami Levy-Moonshine 99cb8d68e9 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-25 16:07:38 -05:00
Mark DePristo b8c0b05785 Add contract to ensure that getAdapterBoundary returns the right result
-- Also renamed the function to getAdaptorBoundary for consistency across the codebase
2013-01-25 16:05:17 -05:00
Mark DePristo e445c71161 LIBS optimization for adapter clipping
-- GATKSAMRecords now cache the result of the getAdapterBoundary, allowing us to avoid repeating a lot of work in LIBS
-- Added unittests to cover adapter clipping
2013-01-25 16:05:17 -05:00
Ami Levy-Moonshine f50db01742 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-25 15:55:56 -05:00
Ami Levy-Moonshine b4447cdca2 In cases where one uses VariantContextUtils.GenotypeMergeType.REQUIRE_UNIQUE we used to verify that the samples names are unique in VariantContextUtils.simpleMerge for each VCs. It couse to a bug that was reported on the forum (when a VCs had 2 VC from the same sample).
Now we will check it only in CombineVariants.init using the headers. A new function was added to SamplesUtils with unitTests in CVunitTest.java.
2013-01-25 15:49:51 -05:00
Khalid Shakir c58e02a3bd Added a QFunction.jobLocalDir for optionally tracking a node local directory that may have faster intermediate storage, with SGF ensuring that if the directory happens to be on the same machine that it get's a clone specific sub-directory to avoid collisions. 2013-01-25 14:28:04 -05:00
Ami Levy-Moonshine fc22a5c71c Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-25 11:47:38 -05:00
Ami Levy-Moonshine eaf6279d48 adding RBP to the general calling pipeline and few other small changes to it (to make it run with the current bundel file names 2013-01-25 11:47:30 -05:00
Mark DePristo 008b617577 Cleanup the getLIBS function in LocusIterator
-- Now throws an UnsupportedOperationException in the base class.  Only LocusView implements this function and actually returns the LIBS
2013-01-25 11:07:28 -05:00
Eric Banks 6dd0e1ddd6 Pulled out the --regenotype functionality from SelectVariants into its own tool: RegenotypeVariants.
This allows us to move SelectVariants into the public suite of tools now.
2013-01-25 09:42:04 -05:00
Mark DePristo c7a29b1d39 Fixed NPE in ActiveRegionUnitTest by allowing null supporting states in ActiveRegion 2013-01-24 13:48:00 -05:00
Mark DePristo 592f90aaef ActivityProfile now cuts intelligently at the best local minimum when in a larger than max size active region
-- This new algorithm is essential to properly handle activity profiles that have many large active regions generated from lots of dense variant events.  The new algorithm passes unit tests and passes visualize visual inspection of both running on 1000G and NA12878
-- Misc. commenting of the code
-- Updated ActiveRegionExtension to include a min active region size
-- Renamed ActiveRegionExtension to ActiveRegionTraversalParameters, as it carries more than just the traversal extension now
2013-01-24 13:48:00 -05:00
Mark DePristo c96b64973a Soft clip probability propagation is capped by the MAX_PROB_PROPAGATION_DISTANCE, which is 50 bp 2013-01-24 13:48:00 -05:00
Mark DePristo 0c94e3d96e Adaptively compute the band pass filter from the sigma, up to a maximum size of 50 bp
-- Previously we allowed band pass filter size to be specified along with the sigma.  But now that sigma is controllable from walkers and from the command line, we instead compute the filter size given the kernel from the sigma, including all kernel points with p > 1e-5 in the kernel.  This means that if you use a smaller kernel you get a small band size and therefore faster ART
-- Update, as discussed with Ryan, the sigma and band size to 17 bp for HC (default ART wide) and max band size of 50 bp
2013-01-24 13:47:59 -05:00
Mark DePristo 9e43a2028d Making band pass filter size, sigma, active region max size and extension all accessible from the command line 2013-01-24 13:47:59 -05:00
Mark DePristo cd91e365f4 Optimize getCurrentContigLength and getLocForOffset in ActivityProfile 2013-01-24 13:47:59 -05:00
Eric Banks 6790e103e0 Moving lots of walkers back from protected to public (along with several of the VA annotations).
Let's see whether Mauricio's automatic git hook really works!
2013-01-24 11:42:49 -05:00
Mark DePristo ee8039bf25 Fix trivial call in unit test 2013-01-23 13:51:58 -05:00
Mark DePristo 09edc6baeb TraverseActiveRegions now writes out very nice active region and activity profile IGV formatted files 2013-01-23 13:46:01 -05:00
Mark DePristo 8e8126506b Renaming IncrementalActivityProfile to ActivityProfile
-- Also adding a work in progress functionality to make it easy to visualize activity profiles and active regions in IGV
2013-01-23 13:46:01 -05:00
Mark DePristo e917f56df8 Remove old ActivityProfile and old BandPassActivityProfile 2013-01-23 13:46:01 -05:00
Mark DePristo 7fd27a5167 Add band pass filtering activity profile
-- Based on the new incremental activity profile
-- Unit Tested!  Fixed a few bugs with the old band pass filter
-- Expand IncrementalActivityProfileUnitTest to test the band pass filter as well for basic properties
-- Add new UnitTest for BandPassIncrementalActivityProfile
-- Added normalizeFromRealSpace to MathUtils
-- Cleanup unused code in new activity profiles
2013-01-23 13:46:01 -05:00
Mark DePristo eb60235dcd Working version of incremental active region traversals
-- The incremental version now processes active regions as soon as they are ready to be processed, instead of waiting until the end of the shard as in the previous version.  This means that ART walkers will now take much less memory than previously.  On chr20 of NA12878 the majority of regions are processed with as few as 500 reads in memory.  Over the whole chr20 only 5K reads were ever held in ART at one time.
-- Fixed bug in the way active regions worked with shard boundaries.  The new implementation no longer see shard boundaries in any meaningful way, and that uncovered a problem that active regions were always being closed across shard boundaries.  This behavior was actually encoded in the unit tests, so those needed to be updated as well.
-- Changed the way that preset regions work in ART.  The new contract ensures that you get exactly the regions you requested.  the isActive function is still called, but its result has no impact on the regions.  With this functionality is should be possible to use the HC as a generic assembly by forcing it to operate over very large regions
-- Added a few misc. useful functions to IncrementalActivityProfile
2013-01-23 13:46:00 -05:00
Mark DePristo ce160931d5 Optimize creation of reads in ArtificialBAMBuilder
-- Now caches the reads so subsequent calls to makeReads() don't reallocate the reads from scratch each time
2013-01-23 13:46:00 -05:00
Mark DePristo e050f649fd IncrementalActivityProfile, complete with extensive unit tests
-- This is an activity profile compatible with fetching its implied active regions incrementally, as activity profile states are added
2013-01-23 13:45:21 -05:00
Mark DePristo 8d9b0f1bd5 Restructure ActivityProfiler into root class ActivityProfile and derived class BandPassActivityProfile
-- Required before I jump in an redo the entire activity profile so it's can be run imcrementally
-- This restructuring makes the differences between the two functionalities clearer, as almost all of the functionality is in the base class. The only functionality provided by the BandPassActivityProfile is isolated to a finalizeProfile function overloaded from the base class.
-- Renamed ActivityProfileResult to ActivityProfileState, as this is a clearer indication of its actual functionality.  Almost all of the misc. walker changes are due to this name update
-- Code cleanup and docs for TraverseActiveRegions
-- Expanded unit tests for ActivityProfile and ActivityProfileState
2013-01-23 13:45:21 -05:00
Mark DePristo 42b807a5fe Unit tests for ActivityProfileResult 2013-01-23 13:45:20 -05:00
Mauricio Carneiro 7b8b064165 Last manual license update (hopefully)
if everyone updates their git hook accordingly, this will be the last time I have to manually run the script.

GSATDG-5
2013-01-18 16:13:07 -05:00
Ami Levy-Moonshine 0fb7b73107 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-18 15:03:42 -05:00
Ami Levy-Moonshine 826c29827b change the default VCFs gatherer of the GATK (not just the UG) 2013-01-18 15:03:12 -05:00
Eric Banks 6a903f2c23 I finally gave up on trying to get the Haplotype/Allele merging to work in the HaplotypeCaller.
I've resigned myself instead to create a mapping from Allele to Haplotype.  It's cheap so not a big deal, but really shouldn't be necessary.
Ryan and I are talking about refactoring for GATK2.5.
2013-01-18 01:21:08 -05:00
Eric Banks ded659232b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 22:49:56 -05:00
Eric Banks a623cca89a Bug fix for HaplotypeCaller, as reported on the forum: when reduced reads didn't completely overlap a deletion call,
we were incorrectly trying to find the reference position of a base on the read that didn't exist.
Added integration test to cover this case.
2013-01-16 22:47:58 -05:00
Mark DePristo 738c24a3b1 Add tests to ensure that all insertion reads appear in the active region traversal 2013-01-16 16:25:36 -05:00
Eric Banks 79bc818022 Bug fix for VariantsToVCF: old dbSNP files can have '-' as reference base and those records always need to be padded. 2013-01-16 16:15:58 -05:00
Mark DePristo 2a42b47e4a Massive expansion of ActiveRegionTraversal unit tests, resulting in several bugfixes to ART
-- UnitTests now include combinational tiling of reads within and spanning shard boundaries
-- ART now properly handles shard transitions, and does so efficiently without requiring hash sets or other collections of reads
-- Updating HC and CountReadsInActiveRegions integration tests
2013-01-16 15:30:00 -05:00
Mark DePristo ddcb33fcf8 Cache result of getLocation() in Shard so we don't performance expensive calculation over and over 2013-01-16 15:30:00 -05:00
Mark DePristo 4d0e7b50ec ArtificialBAMBuilder utility class for creating streams of GATKSAMRecords with a variety of properties
--  Allows us to make a stream of reads or an index BAM file with read having the following properties (coming from n samples, of fixed read length and aligned to the genome with M operator, having N reads per alignment start, skipping N bases between each alignment start, starting at a given alignment start)
-- This stream can be handed back to the caller immediately, or written to an indexed BAM file
-- Update LocusIteratorByStateUnitTest to use this functionality (which was refactored from LIBS unit tests and ArtificialSAMUtils)
2013-01-16 15:29:59 -05:00
Eric Banks ec1cfe6732 Oops, forgot to add 1 of my files 2013-01-16 15:05:49 -05:00
Eric Banks e47a389b26 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 14:59:11 -05:00
Eric Banks d18dbcbac1 Added tests for changing IUPAC bases to Ns, for failing on bad ref bases, and for the HaplotypeCaller not failing when running over a region with an IUPAC base.
Out of curiosity, why does Picard's IndexedFastaSequenceFile allow one to query for start position 0?  When doing so, that base is a line feed (-1 offset to the first base in the contig) which is an illegal base (and which caused me no end of trouble)...
2013-01-16 14:55:33 -05:00
Khalid Shakir 4ffb43079f Re-committing the following changes from Dec 18:
Refactored interval specific arguments out of GATKArgumentCollection into InvtervalArgumentCollection such that it can be used in other CommandLinePrograms.
Updated SelectHeaders to print out full interval arguments.
Added RemoteFile.createUrl(Date expiration) to enable creation of presigned URLs for download over http: or file:.
2013-01-16 12:43:15 -05:00
Eric Banks 445735a4a5 There was no reason to be sharing the Haplotype infrastructure between the HaplotypeCaller and the HaplotypeScore annotation since they were really looking for different things.
Separated them out, adding efficiencies for the HaplotypeScore version.
2013-01-16 11:10:13 -05:00
Eric Banks 392b5cbcdf The CachingIndexedFastaSequenceFile now automatically converts IUPAC bases to Ns and errors out on other non-standard bases.
This way walkers won't see anything except the standard bases plus Ns in the reference.
Added option to turn off this feature (to maintain backwards compatibility).

As part of this commit I cleaned up the BaseUtils code by adding a Base enum and removing all of the static indexes for
each of the bases.  This uncovered a bug in the way the DepthOfCoverage walker counts deletions (it was counting Ns instead!) that isn't covered by tests.  Fortunately that walker is being deprecated soon...
2013-01-16 10:22:43 -05:00
Eric Banks 4fb3e48099 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 00:13:38 -05:00
Eric Banks 0d282a7750 Bam writing from HaplotypeCaller seems to be working on all my test cases. Note that it's a hidden debugging option for now.
Please let me know if you notice any bad behavior with it.
2013-01-16 00:12:02 -05:00
Eric Banks d3baa4b8ca Have Haplotype extend the Allele class.
This way, we don't need to create a new Allele for every read/Haplotype pair to be placed in the PerReadAlleleLikelihoodMap (very inefficient).  Also, now we can easily get the Haplotype associated with the best allele for a given read.
2013-01-15 11:36:20 -05:00
Mark DePristo 3c37ea014b Retire original TraverseActiveRegion, leaving only the new optimized version
-- Required some updates to MD5s, which was unexpected, and will be sorted out later with more detailed unit tests
2013-01-15 10:24:45 -05:00
Eric Banks 94800771e3 1. Initial implementation of bam writing for the HaplotypeCaller with -bam argument; currently only assembled haplotypes are emitted.
2. Framework is set up in the VariantAnnotator for the HaplotypeCaller to be able to call in to annotate dbSNP plus comp RODs.  Until the HC uses meta data though, this won't work.
2013-01-15 10:19:18 -05:00
Mark DePristo 39bc9e999d Add a test to LocusIteratorByState to ensure that we aren't holding reads anywhere
-- Run an iterator with 100Ks of reads, each carrying MBs of byte[] data, through LIBS, all starting at the same position.  Will crash with an out-of-memory error if we're holding reads anywhere in the system.
-- Is there a better way to test this behavior?
2013-01-14 16:30:16 -05:00
Mark DePristo b8b2b9b2de ManagingReferenceOrderedView optimization: don't allow a fresh RefMetaDataTracker in the frequent case where there's no reference meta data 2013-01-14 16:30:16 -05:00
Mark DePristo 7eea6b8f92 ReservoirDownsampler optimizations
-- Add an option to not allocate always ArrayLists of targetSampleSize, but rather the previous size + MARGIN.  This helps for LIBS as most of the time we don't need nearly so much space as we allow
-- consumeFinalizedItems returns an empty list if the reservior is empty, which it often true for our BAM files with low coverage
-- Allow empty sample lists for SamplePartitioner as these are used by the RefTraversals and other non-read based traversals

Make the reservoir downsampler use a linked list, rather than a fixed sized array list, in the expectFewOverflows case
2013-01-14 16:30:16 -05:00
Mark DePristo c7f0ca8ac5 Optimization for LIBS: PerSampleReadStateManager now uses a simple LinkedList of AlignmentStateMachine
-- Instead of storing a list of list of alignment starts, which is expensive to manipulate, we instead store a linear list of alignment starts.  Not grouped as previously.  This enables us to simplify iteration and update operations, making them much faster
-- Critically, the downsampler still requires this list of list.  We convert back and forth between these two representations as required, which is very rarely for normal data sets (WGS NA12878 on chr20 is 0.2%, 4x WGS is even less).
2013-01-14 16:30:16 -05:00
Mark DePristo 5a5422e4f8 Refactor PerSampleReadStates into a separate class
-- No longer update the total counts in each per-sample state manager, but instead return delta counts that are updated by the overall ReadStateManager
-- One step on the way to improving the underlying representation of the data in PerSampleReadStateManager
-- Make LocusIteratorByState final
2013-01-14 16:30:16 -05:00
Mark DePristo 5c2799554a Refactor updateReadStates into PerSampleReadStateManager, add tracking of downsampling rate 2013-01-14 16:30:16 -05:00
Mark DePristo a4334a67e0 SamplePartitioner optimizations and bugfixes
-- Use a linked hash map instead of a hash map since we want to iterate through the map fairly often
-- Ensure that we call doneSubmittingReads before getting reads for samples.  This function call fell out before and since it wasn't enforced I only noticed the problem while writing comments
-- Don't make unnecessary calls to contains for map.  Just use get() and check that the result is null
-- Use a LinkedList in PassThroughDownsampler, since this is faster for add() than the existing ArrayList, and we were's using random access to any resulting
2013-01-14 16:30:16 -05:00
Mark DePristo 19288b007d LIBS bugfix: kept reads now only (correctly) includes reads that at least passed the reservoir
-- Added unit tests to ensure this behavior is correct
2013-01-14 16:30:16 -05:00
Mark DePristo 83fcc06e28 LIBS optimizations and performance tools
-- Made LIBSPerformance a full featured CommandLineProgram, and it can be used to assess the LIBS performance by reading a provided BAM
-- ReadStateManager now provides a clean interface to iterate in sample order the per-sample read states, allowing us to avoid many map.get calls
-- Moved updateReadStates to ReadStateManager
-- Removed the unnecessary wrapping of an iterator in ReadStateManager
-- readStatesBySample is now a LinkedHashMap so that iteration occurs in LIBS sample order, allowing us to avoid many unnecessary calls to map.get iterating over samples.  Now those are just map native iterations
-- Restructured collectPendingReads for simplicity, removing redundant and consolidating common range checks.  The new piece is code is much clearer and avoids several unnecessary function calls
2013-01-14 16:30:15 -05:00
Mark DePristo ec05ecef60 getAdaptorBoundary returns an int, not an Integer, as this was taking 30% of the allocation effort for LIBS 2013-01-14 16:30:15 -05:00
Mark DePristo 3a6b4b43b7 Backporting LIBSPerformance improvements to original commit 2013-01-13 09:53:10 -05:00
Mark DePristo f204908a94 Add some todos for future optimization to LIBS 2013-01-11 15:17:18 -05:00
Mark DePristo e88dae2758 LocusIteratorByState operates natively on GATKSAMRecords now
-- Updated code to reflect this new typing
2013-01-11 15:17:18 -05:00
Mark DePristo 94cb50d3d6 Retire LegacyLocusIteratorByState
-- Left in the remaining infrastructure for David to remove, but the legacy downsampler is no longer a functional option in the GATK
2013-01-11 15:17:18 -05:00
Mark DePristo cc0c1b752a Delete old LocusIteratorByState, leaving only new LIBS and legacy 2013-01-11 15:17:18 -05:00
Mark DePristo bd03511e35 Updating AlignmentStateMachinePerformance to include some more useful performance assessments 2013-01-11 15:17:18 -05:00
Mark DePristo 9e23c592e6 ReadBackedPileup cleanup
-- Only ReadBackedPileupImpl (concrete class) and ReadBackedPileup (interface) live, moved all functionality of AbstractReadBackedPileup into the impl
-- ReadBackedPileupImpl was literally a shell class after we removed extended events.  A few bits of code cleanup and we reduced a bunch of class complexity in the gatk
-- ReadBackedPileups no longer accept pre-cached values (size, nMapQ reads, etc) but now lazy load these values as needed
-- Created optimized calculation routines to iterator over all of the reads in the pileup in whatever order is most efficient as well.
-- New LIBS no longer calculates size, n mapq, and n deletion reads while making pileups.
-- Added commons-collections for IteratorChain
2013-01-11 15:17:18 -05:00
Mark DePristo e3e3ae29b2 Final documentation for LocusIteratorByState 2013-01-11 15:17:18 -05:00
Mark DePristo 6a91902aa2 Fix final merge conflicts 2013-01-11 15:17:18 -05:00
Mark DePristo b9a33d3c66 Split original and optimized ART into largely independent pieces
-- Allows us to cleanly run old and new art, which now have different traversal behavior (on purpose).  Split unit tests as well.
2013-01-11 15:17:18 -05:00
Mark DePristo 02130dfde7 Cleanup ART
-- Initialize routine captures essential information for running the traversal
2013-01-11 15:17:17 -05:00
Mark DePristo 9b2be795a7 Initial working version of new ActiveRegionTraversal based on the LocusIteratorByState read stream
-- Implemented as a subclass of TraverseActiveRegions
-- Passes all unit tests
-- Will be very slow -- needs logical fixes
2013-01-11 15:17:17 -05:00
Mark DePristo 8b83f4d6c7 Near final cleanup of PileupElement
-- All functions documented and unit tested
-- New constructor interface
-- Cleanup some uses of old / removed functionality
2013-01-11 15:17:17 -05:00
Mark DePristo fb9eb3d4ee PileupElement and LIBS cleanup
-- function to create pileup elements in AlignmentStateMachine and LIBS
-- Cleanup pileup element constructors, directing users to LIBS.createPileupFromRead() that really does the right thing
2013-01-11 15:17:17 -05:00
Mark DePristo 2f2a592c8e Contracts and documentation for AlignmentStateMachine and LocusIteratorByState
-- Add more unit tests for both as well
2013-01-11 15:17:17 -05:00
Mark DePristo cc1d259cac Implement get Length and Bases of OfImmediatelyFollowingIndel in PileupElement
-- Added unit tests for this behavior.  Updated users of this code
2013-01-11 15:17:17 -05:00
Mark DePristo 2c38310868 Create LIBS using new AlignmentStateMachine infrastructure
-- Optimizations to AlignmentStateMachine
-- Properly count deletions.  Added unit test for counting routines
-- AlignmentStateMachine.java is no longer recursive
-- Traversals now use new LIBS, not the old one
2013-01-11 15:17:17 -05:00
Mark DePristo 80d9b7011c Complete rewrite of low-level machinery of LIBS, not hooked up
-- AlignmentStateMachine does what SAMRecordAlignmentState should really do.  It's correct in that it's more accurate than the LIB_position tests themselves.  This is a non-broken, correct implementation.  Needs cleanup, contracts, etc.
-- This version is like 6x slower than the original implementation (according to the google caliper benchmark here).  Obvious optimizations for future commit
2013-01-11 15:17:16 -05:00
Mark DePristo 0ac4352614 LIBS can now (optionally) track the unique reads it uses from the underlying read iterator
-- This capability is essential to provide an ordered set of used reads to downstream users of LIBS, such as ART, who want an efficient way to get the reads used in LIBS
-- Vastly expanded the multi-read, multi-sample LIBS unit tests to make sure this capability is working
-- Added createReadStream to ArtificialSAMUtils that makes it relatively easy to create multi-read, multi-sample read streams for testing
2013-01-11 15:17:16 -05:00
Mark DePristo b3ecfbfce8 Refactor LIBS into component parts, expand unit tests, some code cleanup
-- Split out all of the inner classes of LIBS into separate independent classes
-- Split / add unit tests for many of these components.
-- Radically expand unit tests for SAMRecordAlignmentState (the lowest level piece of code) making sure at least some of it works
-- No need to change unit tests or integration tests.  No change in functionality.
-- Added (currently disabled) code to track all submitted reads to LIBS, but this isn't accessible or tested
2013-01-11 15:17:16 -05:00
Mark DePristo 2e5d38fd0e Updating to latest google caliper code 2013-01-11 15:17:16 -05:00
Mark DePristo b2990497e2 Refactor LIBS into utils.locusiterator before refactoring 2013-01-11 15:17:16 -05:00
Mauricio Carneiro 9ed922d562 Updating licenses to Eric's last commit
- for now we're still running the script by hand, soon automated solution will be in place.

GSATDG-5
2013-01-11 14:33:00 -05:00
Mauricio Carneiro bc64d4240f Licensing update -- batch #2
- caught all scala files that didn't have proper package information / class names
   - included all source files in archive as well

GSATDG-5
2013-01-11 13:38:11 -05:00
Mauricio Carneiro 28235f57f2 Adding package information to scala scripts that were missing it. Including archived ones.
GSATDG-5
2013-01-11 13:38:05 -05:00
Eric Banks e7906713d9 Moving some random walkers back to public as requested by Mark. Mauricio will the licenses get updated automatically? 2013-01-11 02:03:43 -05:00
Ami Levy-Moonshine 352cb831d0 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-10 21:27:06 -05:00
Ami Levy-Moonshine fac0bce916 add RunCoveredByNSamplesSites; changes in CoveredByNSamplesSites so it can work in parallel; also, move it to diagnostics 2013-01-10 21:26:49 -05:00
Mauricio Carneiro ea8c8573d2 Fixing ParseLicense script for scala syntax
- Scala allows package objects in its syntax, so the script needs to be aware of that and not add "*/" every time it sees it.

GSATDG-5
2013-01-10 18:24:24 -05:00
Mauricio Carneiro e5913e50b2 Updating licenses for all scala files
GSATDG-5
2013-01-10 17:46:10 -05:00
Mauricio Carneiro 2a4ccfe6fd Updated all JAVA file licenses accordingly
GSATDG-5
2013-01-10 17:06:41 -05:00
Joel Thibault 3e52ce5fa8 Remove DepthOfCoverage.java because it is no longer public
- Move Pileup.java and PrintReads.java to their new homes
2013-01-10 11:45:38 -05:00
Ryan Poplin 487fb2afb4 Bug fix for the case of overlapping assembled and partially-assembled events created by the HC. Unfortunately the symbolic allele can't be combined with the indel allele because the reference basis will change. 2013-01-09 15:30:46 -05:00
Eric Banks 4fa439d89e Move some classes back to public because they are used in the engine. Move some test classes to protected. We should have no more public->protected dependancies now 2013-01-09 11:06:10 -05:00
Eric Banks 676e79542a Bring CombineVariants back to public since it's used for SG. I needed to break ChromosomeCountConstants out of ChromosomeCounts to make this work. 2013-01-09 10:39:48 -05:00
Ryan Poplin c87ad8c0ef Bug fixes related to HC's GGA mode. Tracking just the artificial allele isn't sufficient when there are multiple GGA records that change the reference basis. Also, duplicated records screw up the tracking of merged alleles. 2013-01-09 10:00:46 -05:00
Ami Levy-Moonshine 15ca5015cd Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-08 21:53:36 -05:00
Ami Levy-Moonshine d6071728e8 add new walker to find sites with good coverage 2013-01-08 17:10:38 -05:00
Eric Banks 264cc9e78d Resolve protected->public dependencies for BQSR by wrapping the BQSR-specific arguments in a new class.
Instead of the GATK Engine creating a new BaseRecalibrator (not clean), it just keeps track of the arguments (clean).

There are still some dependency issues, but it looks like they are related to Ami's code.  Need to look into it further.
2013-01-08 16:23:29 -05:00
Eric Banks f0bd1b5ae5 Okay, all public->protected dependencies are gone except for the BQSR arguments. I'll need to think through this but should be able to make that work too. 2013-01-08 15:46:32 -05:00
Eric Banks 245fcc8bb5 Merged bug fix from Stable into Unstable 2013-01-08 12:59:15 -05:00
Eric Banks d6146d369a Remove all of the references to ProgramElementDoc 2013-01-08 12:58:31 -05:00
Eric Banks b099e2b4ae Moving integration tests to protected 2013-01-08 09:34:08 -05:00
Eric Banks 47d030a52d Oops, move the covariates over too 2013-01-07 15:47:25 -05:00
Eric Banks 35699a8376 Move bqsr utils to protected 2013-01-07 15:41:21 -05:00
Eric Banks 5371613ad1 Tests seem to pass (can't be positive though because I ran before Tad's recent push), so I'm going to push now (this push touches so many files that I don't want to keep it around much longer).
Merge branch 'master' of github.com:broadinstitute/gsa-unstable
2013-01-07 15:27:43 -05:00
Ami Levy-Moonshine 8bbb9e1cc2 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-07 15:07:25 -05:00
Ami Levy-Moonshine d4b4f95e12 move CatVariants to public 2013-01-07 15:07:16 -05:00
Eric Banks 1a4b112865 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-07 15:00:35 -05:00
Eric Banks a0219acfaa Collapse the PerReadAlleleLikelihoodMap classes into 1 now that Lite is gone 2013-01-07 14:55:21 -05:00
Mauricio Carneiro d3e2352072 Moved processing pipelines to private
These pipelines were supposed to serve as an example for the community, they were written a long-long-long time ago and are being used today by users as the 'best practice pipeline'. Unless we decide we want to support and maintain an example best-practices pipeline, I'm moving these to private.
2013-01-07 14:49:57 -05:00
Eric Banks 35d9bd377c Moved (nearly) all Walkers from public to protected and removed GATKLite utils 2013-01-07 14:42:40 -05:00
Eric Banks 78f7a4e300 Received permission from Mauricio to archive the DPP and PBPP PipelineTests 2013-01-07 14:03:08 -05:00
Eric Banks b4e7b3d691 Fixed precision problem in the Bayesian calculation of Qemp: we need to cap below max integer because the MathUtils code add +1.
Added unit tests for handling large number of observations.
2013-01-07 13:07:36 -05:00
Tad Jordan 04e3978b04 Fixed VariantEval tests
-Added sorting by rows to VariantEval
2013-01-07 12:45:32 -05:00
Ryan Poplin 4f95f850b3 Bug fix in the HC's allele mapping for multi-allelic events. Using the allele alone as a key isn't sufficient because alleles change when the reference allele changes during VariantContextUtils.simpleMerge for multi-allelic events. 2013-01-07 11:05:44 -05:00
Ami Levy-Moonshine d3c2c97fb2 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-06 23:35:47 -05:00
Ami Levy-Moonshine c554d9db25 add TODO 2013-01-06 23:04:38 -05:00
Ami Levy-Moonshine 81eef3aa37 merge development branchs of log-less HMM and FastGatherer to master 2013-01-06 23:01:58 -05:00
Eric Banks 0249e1f497 Resolving merge conflicts from VCF move 2013-01-06 14:32:31 -05:00
Eric Banks 8822b8e7c8 Moving HelpConstants out of HelpUtils so that we stop getting these ProgramElementDoc errors when com.sun.javadoc cannot load on a user's system. 2013-01-06 14:30:45 -05:00
Eric Banks ef638489d5 Fixing BQSR gatherer test to keep up to date with latest changes 2013-01-06 14:07:59 -05:00
Eric Banks ea21dc9cfb I just committed this - why didn't it work before? Trying again... 2013-01-06 12:44:13 -05:00
Eric Banks 52067f0549 Handle merge conflicts 2013-01-06 12:29:12 -05:00
Eric Banks bf25e151ff Handle long->int precision in Bayesian estimate 2013-01-06 12:26:32 -05:00
Eric Banks b73d72fe94 update docs for LEftAlignVariants 2013-01-06 01:56:57 -05:00
Mark DePristo b403c269e9 Make multi-threaded progress meter daemon unit test more robust 2013-01-05 12:59:18 -05:00
Mark DePristo 2ab55e4ee7 Fixing bug in TraverseDuplicates.printProgress call: only passes in single location of genome loc 2013-01-05 12:50:27 -05:00
Mark DePristo 69bf70c42e Cleanup and more unit tests for RecalibrationTables in BQSR
-- Added unit tests for combining RecalibrationTables.  As a side effect now has serious tests for incrementDatumOrPutIfNecessary
-- Removed unnecessary enum.index system from RecalibrationTables.
-- Moved what were really static utility methods out of RecalibrationEngine and into RecalUtils.
2013-01-05 12:50:27 -05:00
Chris Hartl 9df30880cb Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-04 17:15:22 -05:00
Joel Thibault 01738e70c3 Archive the experimental Active Region Traversals 2013-01-04 17:05:31 -05:00
Chris Hartl 7b7efa0fff Add in the AAL as an experimental covariate, in case it's wanted. 2013-01-04 16:47:26 -05:00
Chris Hartl 41bc416b65 Remove AAL and update MD5s. 2013-01-04 16:46:14 -05:00
Eric Banks bce6fce58d Resolving merge conflicts after Mark's latest push 2013-01-04 14:46:39 -05:00
Eric Banks dd7f5e2be7 Hooking up the Bayesian estimate code for calculating Qemp in BQSR; various fixes after adding unit tests. 2013-01-04 14:43:11 -05:00
Ami Levy-Moonshine 80b531f695 emit all sites where more than 90% of the samples have good coverage 2013-01-04 14:27:50 -05:00
Joel Thibault ab5526b372 More TODOs 2013-01-04 14:09:02 -05:00
Tad Jordan fe06912a87 Removed sorting by row from walkers 2013-01-04 11:52:33 -05:00
Mark DePristo 810e2da1d4 Cleanup and unit tests for EventType and ReadRecalibrationInfo in BQSR
-- Added unit tests for EventType and ReadRecalibrationInfo
-- Simplified interface of EventType.  Previously this enum carried an index with it, but this is redundant with the enum.ordinal function.  Now just using that function instead.
2013-01-04 11:39:25 -05:00
Mark DePristo a5901cdd20 Bugfix for printProgress in TraverseReadsNano
-- Must provide a single bp position (1:10) not the range of the read (1:1-50).  ProgressMeter now checks at runtime for this problem as well.
2013-01-04 11:39:24 -05:00
Mark DePristo bbdf9ee91b BQSR cleanup: merge Advanced and Standard recalibration engine into just the RecalibrationEngine
-- As we are no longer maintaining a public/protected system we need only have one RecalibrationEngine.
-- Misc. code cleanup and docs along the way
2013-01-04 11:39:24 -05:00
Mark DePristo 7df47418d8 BQSR optimization: make RecalibrationTables thread-local, and merge results in onTraversalDone
-- With the newer, faster BQSR, scaling was limited by the NestedIntegerArray.  The solution to this is to make the entire table thread-local, so that each nct thread has its own data and doesn't have any collisions.
-- Removed the previous partial solution of having a thread-local quality score table
-- Added a new argument -lowMemory
2013-01-04 11:39:24 -05:00
Mark DePristo 1ba8d47a81 Unit tests for ProgressMeterDaemon 2013-01-04 11:39:24 -05:00
Mark DePristo fbee4c11f1 Unit tests for ProgressMeterData 2013-01-04 11:39:23 -05:00
Joel Thibault 319d651e4a Initial updates for ActiveRegionShard 2013-01-03 17:00:13 -05:00
Joel Thibault e7553545ef Initial updates for ReadShard 2013-01-03 17:00:13 -05:00
Joel Thibault 14a3ac0e3c Enable the use of alternate shards 2013-01-03 17:00:13 -05:00
Joel Thibault 4cc372f53b LocusShardDataProvider doesn't need its own GenomeLocParser 2013-01-03 17:00:13 -05:00
Joel Thibault ffbd4d85f2 No need to pass fields as parameters 2013-01-03 17:00:12 -05:00
Joel Thibault 47e620dfbc Create BAM index to test shard boundaries 2013-01-03 17:00:12 -05:00
Tad Jordan c1ba12d71a Added unit test for outputting sorted GATKReport Tables
- Made few small modifications to code
- Replaced the two arguments in GATKReportTable constructor with an enum used to specify way of sorting the table
2013-01-03 16:53:59 -05:00
Ami Levy-Moonshine 10a705b27f Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-03 13:42:31 -05:00
Ami Levy-Moonshine 2018285a39 better error message 2013-01-03 13:41:03 -05:00
Eric Banks c7039a9b71 Pushing in implementation of the Bayesian estimate of Qemp for the BQSR.
This isn't hooked up yet with BQSR; it's just a static method used in my testing walker.  I'll hook this into BQSR after more testing and the addition of unit tests.
Most of the changes in this commit are actually documentation-related.
2013-01-02 15:21:44 -05:00
Joel Thibault c515175313 Ensure that active region extensions stay on contig 2013-01-02 14:46:24 -05:00
Joel Thibault dcb7735d3c Active Region extensions must stay on contig 2013-01-02 14:46:24 -05:00
Chris Hartl 09199366b7 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-02 14:44:49 -05:00
Chris Hartl e1d09ab0db QD is now divided by the average length of the alternate allele (weighted by the allele count). The average length is stored in a related annotation, "AAL", which can be used to re-compute the "old" QD by simple multiplication. Integration tests *should* all pass. 2013-01-02 14:41:29 -05:00
Joel Thibault a15f368bdc Re-enable testIsActiveRangeLow/High 2013-01-02 11:57:50 -05:00
Mark DePristo 12f4c6307e AutoFormattingTime cleanup and complete unittests
-- Underlying system now uses long nano times to be more consistent with standard java practice
-- Updated a few places in the code that were converting from nanoseconds to double seconds to use the new nanoseconds interface directly
-- Bringing us to 100% test coverage with clover with AutoFormattingTimeUnitTest
2013-01-02 11:29:25 -05:00
Joel Thibault 429567cd3f Rename to TraverseActiveRegionsUnitTest 2013-01-01 19:20:30 -05:00
Joel Thibault 57d38aac8a Temporarily disable due to unknown contracts problem 2013-01-01 19:20:04 -05:00
Joel Thibault 7748b3816f Delete the test BAI file as well as the BAM 2013-01-01 19:20:02 -05:00
Joel Thibault 5afeb465aa TODOs 2013-01-01 19:19:17 -05:00
Mark DePristo 5558a6b8f7 Deleting / archiving no longer classes
-- AminoAcidTable and AminoAcid goes to the archive
-- Removing two unused SAMRecord classes
2012-12-29 14:34:17 -05:00
Mark DePristo 38cc496de8 Move SomaticIndelDetector and associated tools and libraries into private/andrey package
-- Intermediate commit on the way to archiving SomaticIndelDetector and other tools.
-- SomaticIndelDetector, PairMaker and RemapAlignments tools have been refactored into the private andrey package.  All utility classes refactored into here as well.  At this point, the SomaticIndelDetector builds in this version of the GATK.
-- Subsequent commit will put this code into the archive so it no longer builds in the GATK
2012-12-29 14:34:08 -05:00
Ami Levy-Moonshine f450cbc1a3 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-27 21:23:59 -05:00
Eric Banks 75d5b88a3d Enabling the Recal Report unit test (which looks like it was never ever enabled) 2012-12-26 15:35:50 -05:00
Eric Banks efceb0d48c Check for well-encoded reads while fixing mis-encoded ones 2012-12-26 14:30:51 -05:00
Ami Levy-Moonshine fe427cdd77 add few queue script and the CatVariantsGatherer scala class 2012-12-26 13:06:36 -05:00
Mark DePristo af9746af52 Fix merge failure 2012-12-24 13:43:04 -05:00
Mark DePristo 04cc75aaec Minor cleanup and expansion of the RecalDatum unit tests 2012-12-24 13:35:58 -05:00
Mark DePristo 7bf1f67273 BQSR optimization: read group x quality score calibration table is thread-local
-- AdvancedRecalibrationEngine now uses a thread-local table for the quality score table, and in finalizeData merges these thread-local tables into the final table.  Radically reduces the contention for RecalDatum in this very highly used table
-- Refactored the utility function to combine two tables into RecalUtils, and created UnitTests for this function, as well as all of RecalibrationTables.  Updated combine in RecalibrationReport to use this table combiner function
-- Made several core functions in RecalDatum into final methods for performance
-- Added RecalibrationTestUtils, a home for recalibration testing utilities
2012-12-24 13:35:58 -05:00
Mark DePristo 7d250a789a ArtificialReadPileupTestProvider now creates GATKSamRecords with good header values 2012-12-24 13:35:57 -05:00
Mark DePristo 295455eee2 NanoScheduler optimizations and simplification
-- The previous model was to enqueue individual map jobs (with a resolution of 1 map job per map call), to track the number of map calls submitted via a counter and a semaphore, and to use this information in each map job and reduce to control the number of map jobs, when reduce was complete, etc.  All hideously complex.
-- This new model is vastly simply.  The reducer basically knows nothing about the control mechanisms in the NanoScheduler.  It just supports multi-threaded reduce.  The NanoScheduler enqueues exactly nThread jobs to be run, which continually loop reading, mapping, and reducing until they run out of material to read, when they shut down.  The master thread of the NS just holds a CountDownLatch, initialized to nThreads, and when each thread exits it reduces the latch by 1.  The master thread gets the final reduce result when its free by the latch reaching 0.  It's all super super simple.
-- Because this model uses vastly fewer synchronization primitives within the NS itself, it's naturally much faster at getting things done, without any of the overhead obvious in profiles of BQSR -nct 2.
2012-12-24 13:35:57 -05:00
Mark DePristo aa3ee29929 Handle case where the ReadGroup is null in GATKSAMRecord 2012-12-24 13:35:57 -05:00
Mark DePristo bf81db40f7 NanoScheduler reducer optimizations
-- reduceAsMuchAsPossible no longer blocks threads via synchronization, but instead uses an explicit lock to manage access.  If the lock is already held (because some thread is doing reduce) then the thread attempting to reduce immediately exits the call and continues doing productive work.  They removes one major source of blocking contention in the NanoScheduler
2012-12-24 13:35:57 -05:00
Mark DePristo 161487b4a4 MapResult compareTo() is now unit tested
-- Thanks clover!
2012-12-24 13:35:57 -05:00
Mark DePristo 940816f16a GATKSamRecord now checks that the read group is a GATKReadGroupRecord, and if not makes one 2012-12-24 13:35:57 -05:00
Mark DePristo 14944b5d73 Incorporating clover into build.xml
-- See http://gatkforums.broadinstitute.org/discussion/2002/clover-coverage-analysis-with-ant for use docs
-- Fix for artificial reads not having proper read groups, causing NPE in some tests
-- Added clover itself to private/resources
2012-12-24 13:35:57 -05:00
Mark DePristo 7796ba7601 Minor optimizations for NanoScheduler
-- Reducer.maybeReleaseLatch is no longer synchronized
-- NanoScheduler only prints progress every 100 or so map calls
2012-12-24 13:35:56 -05:00
Mark DePristo 0f04485c24 NanoScheduler optimization: don't use a PriorityBlockingQueue for the MapResultsQueue
-- Created a separate, limited interface MapResultsQueue object that previously was set to the PriorityBlockingQueue.
-- The MapResultsQueue is now backed by a synchronized ExpandingArrayList, since job ids are integers incrementing from 0 to N.  This means we avoid the n log n sort in the priority queue which was generating a lot of cost in the reduce step
-- Had to update ReducerUnitTest because the test itself was brittle, and broken when I changed the underlying code.
-- A few bits of minor code cleanup through the system (removing unused constructors, local variables, etc)
-- ExpandingArrayList called ensureCapacity so that we increase the size of the arraylist once to accommodate the upcoming size needs
2012-12-24 13:35:56 -05:00
Mark DePristo b92f563d06 NanoScheduler optimization for TraverseReadsNano
-- Pre-read MapData into a list, which is actually faster than dealing with future lock contention issues with lots of map threads
-- Increase the ReadShard default size to 100K reads by default
2012-12-24 13:35:56 -05:00
Mark DePristo f849910c4e BQSR optimization: only compute BAQ when there's at least one error to delocalize
-- Saves something like 2/3 of the compute cost of BQSR
2012-12-24 13:35:56 -05:00
Mark DePristo 0f0188ddb1 Optimization of BQSR
-- Created a ReadRecalibrationInfo class that holds all of the information (read, base quality vectors, error vectors) for a read for the call to updateDataForRead in RecalibrationEngine.  This object has a restrictive interface to just get information about specific qual and error values at offset and for event type.  This restrict allows us to avoid creating an vector of byte 45 for each read to represent BI and BD values not in the reads.  Shaves 5% of the runtime off the entire code.
-- Cleaned up code and added lots more docs
-- With this commit we no longer have much in the way of low-hanging fruit left in the optimization of BQSR.  95% of the runtime is spent in BAQing the read, and updating the RecalData in the NestedIntegerArrays.
2012-12-24 13:35:09 -05:00
Mark DePristo f6d5499582 The GATK engine now ensures that incoming GATKSAMRecords have GATKSAMReadGroupRecord objects in their header
-- Update SAMDataSource so that the merged header contains GATKSAMReadGroupRecord
-- Now getting the NGSPlatform for a GATKSAMRecord is actually efficient, instead of computing the NGS platform over and over from the PL string
-- Updated a few places in the code where the input argument is actually a GATKSAMRecord, not a SAMRecord for type safety
2012-12-24 13:35:09 -05:00
Ami Levy-Moonshine 8be01af145 add the new gather tool to GATKExtensionsGenerator 2012-12-21 15:09:00 -05:00
Ami Levy-Moonshine 3ca3fd4b3e keep working on loglessHMM in UG 2012-12-21 11:06:12 -05:00
Ami Levy-Moonshine 6590039bc3 add fast gather to UG; change UG to work with log-lessHMM (work in prograss) 2012-12-20 14:58:57 -05:00
Tad Jordan b491c177ff Added functionality of outputting sorted GATKReport Tables
- Added an optional argument to BaseRecalibrator to produce sorted GATKReport Tables
- Modified BSQR Integration Tests to include the optional argument. Tests now produce sorted tables
2012-12-20 14:02:21 -05:00
Eric Banks 6c3f5eefe9 Merged bug fix from Stable into Unstable 2012-12-19 22:29:21 -05:00
xingwei2012 22d13ccdab Bug fix for Queue LSF v8.3
the function ls_getLicenseUsage() is not supported by LSF v8.x, comment the line:

public static native lsfLicUsage.ByReference ls_getLicenseUsage()

Signed-off-by: Eric Banks <ebanks@broadinstitute.org>
2012-12-19 22:28:53 -05:00
Ryan Poplin 54e5c84018 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-19 11:31:40 -05:00
David Roazen 07b369ca7e Move VCF/BCF2/VariantContext to new standalone org.broadinstitute.variant package
This is an intermediate commit so that there is a record of these changes in our
commit history. Next step is to isolate the test classes as well, and then move
the entire package to the Picard repository and replace it with a jar in our repo.

-Removed all dependencies on org.broadinstitute.sting (still need to do the test classes,
though)

-Had to split some of the utility classes into "GATK-specific" vs generic methods
(eg., GATKVCFUtils vs. VCFUtils)

-Placement of some methods and choice of exception classes to replace the StingExceptions
and UserExceptions may need to be tweaked until everyone is happy, but this can be
done after the move.
2012-12-19 10:25:22 -05:00
Ryan Poplin cda0c48570 auto-merge 2012-12-19 10:12:49 -05:00
Mark DePristo 1ca13f9581 Fundamentally better model for the NanoScheduler
-- Now each map job reads a value, performs map, and does as much reducing as possible.  This ensures that we scale performance with the nct value, so -nct 2 should result in 2x performance, -nct 3 3x, etc.  All of this is accomplished using exactly NCT% of the CPU of the machine.
-- Has the additional value of actually simplifying the code
-- Resolves a long-standing annoyance with the nano scheduler.
2012-12-19 09:31:31 -05:00
David Roazen d0cd29cb36 Merged bug fix from Stable into Unstable 2012-12-19 02:20:28 -05:00
David Roazen 0d93330ab9 Fix bug in the PerSampleDownsamplingReadsIterator that could lead to excessive memory usage at traversal startup
This is a MUST-HAVE update for GATK 2.3 users who want to try out the new
ability to use -dcov with ReadWalkers.
2012-12-19 02:05:36 -05:00
Joel Thibault a29df3e094 oops 2012-12-18 19:03:12 -05:00
Joel Thibault ee22c1bf44 More TODOs 2012-12-18 18:47:43 -05:00
Joel Thibault 2b1db519d7 Add reads which overstep a boundary by a single base 2012-12-18 18:47:43 -05:00
Joel Thibault 9828b2990f Reads off the end of a contig fail SAM validation when using actual BAMs 2012-12-18 18:47:43 -05:00
Joel Thibault 72e2394b26 Create actual BAM 2012-12-18 18:47:43 -05:00
Joel Thibault d69d1f8988 Fun with varargs 2012-12-18 18:47:42 -05:00
Joel Thibault 1158c1529f Refactor region/read comparisons 2012-12-18 18:47:42 -05:00
Yossi Farjoun 6ed9eb3da9 GATKBAMIndex now passes unit test! Problem was that SeekableBufferedStream seems to have a bug: it will read beyond the end of a file if asked to. 2012-12-18 17:32:26 -05:00
Ryan Poplin 902ca7ea70 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-18 15:45:33 -05:00
Ryan Poplin 3950f7b3e3 Increasing the INFORMATIVE_LIKELIHOOD_THRESHOLD value to 0.2 2012-12-18 15:45:12 -05:00
Ryan Poplin b5d590ba92 Based on NA12878 knowledge base experiments updating HC to allow for a much smaller minimum kmer length in the assembly graph. 2012-12-18 15:43:56 -05:00
eitanbanks 002ce9c1d5 Merge pull request #8 from yfarjoun/master
Huge speedup in initial traversal of BAM index files (x20 speed!)
2012-12-18 10:16:53 -08:00
Eric Banks 18728ec5bd Updates to the bundle script:
1. Add the symbolic 'current' link for the new bundle dir
2. Don't gzip and copy .out files
3. Don't call chr20 SNPs on the example BAM because it's now just a few reads on chr1
2012-12-18 11:16:42 -05:00
Mark DePristo 16eb1c5436 Optimization to TraverseReadsNano
-- Don't just read all inputs into a list, and then provide an iterator to that list, actually make a real iterator so NanoScheduler input thread can contribute meaningfully to the work load
-- Use NanoScheduler progress function, instead of home-grown updater
2012-12-18 10:14:47 -05:00
Mark DePristo b33f804cdc Inline increment function in RecalDatum to avoid minor duplication of work and multiple synchronized method calls 2012-12-17 16:47:27 -05:00
Mark DePristo 66d32f646b Minor cleanup of BAQ calculation (final variables, etc) 2012-12-17 16:47:27 -05:00
Mark DePristo 67fe81391c ProgressMeter optimization: don't do genome loc formatting, but instead create an object that only formats when printing is actually needed 2012-12-17 16:47:27 -05:00
Mark DePristo 1de2f527b9 Optimization of recalibrateRead
-- Refactor calculation so that upfront constant values are pre-computed, and cached, and their values just looked up during application
-- Trivial comment on how we might use BAQ better in BaseRecalibrator
2012-12-17 16:47:27 -05:00
Mark DePristo bd6cda7542 Trivial optimization of TraverseReadsNano -- don't format the shard toString if logger isn't debug enabled 2012-12-17 16:47:27 -05:00
Mark DePristo a481d006f0 Optimizations for applying BQSR table with PrintReads
-- Cleaned up code in updateDataForRead so that constant values where not computed in inner loops
-- BaseRecalibrator doesn't create it's own fasta index reader, it just piggy backs on the GATK one
-- ReadCovariates <init> now uses a thread local cache for it's int[][][] keys member variable.  This stops us from recreating an expensive array over and over.  In order to make this really work had to update recordValues in ContextCovariate so it writes 0s over base values its skipping because of low quality base clipping.  Previously the values in the ReadCovariates keys were 0 because they were never modified by ContextCovariates. Now these values are actually zero'd out explicitly by the covariates.
2012-12-17 16:47:27 -05:00
Mark DePristo 5ec25797b3 Optimizations for BaseRecalibrator
-- No longer computes at each update the overall read group table.  Now computes this derived table only at the end of the computation, using the ByQual table as input.  Reduces BQSR runtime by 1/3 in my test
2012-12-17 16:47:27 -05:00
Eric Banks e6f468b647 Refactored the quasi-useful IndelType annotation into the more useful VariantType.
The indels are still annotated as before, but now all other variant types are annotated too.
I'm doing this because of requests on the forum but am not making it standard.  If we find it to be useful we can turn it on by default later.
2012-12-17 11:54:47 -05:00
Eric Banks 762f184262 Bug fix for strict validation: rsID checking wasn't working if there were multiple IDs 2012-12-17 10:32:41 -05:00
Yossi Farjoun ea704d688f chose smaller buffer size for the bufferedStream 2012-12-15 13:01:38 -05:00
Yossi Farjoun 6da2338ea7 removed comments and uneeded imports 2012-12-15 12:31:37 -05:00
Yossi Farjoun 19dd2d628a some changes.
some changes.
2012-12-14 17:21:32 -05:00
Mauricio Carneiro 74344a3871 Bringing in the changes from the CMI repo 2012-12-13 21:59:37 -05:00
Eric Banks 696bf95fba Fix for PBT bug reported on the forum: the AD is actually output correctly now (rather than with 'null' or some gibberish memory pointer). 2012-12-13 23:28:30 +00:00
Mark DePristo aeab932c63 Actual working version of unflushing VCFWriter
-- Uses high-performance local writer backed by byte array that writes the entire VCF line in some write operation to the underlying output stream.
-- Fixes problems with indexing of unflushed writes while still allowing efficient block zipping
-- Same (or better) IO performance as previous implementation
-- IndexingVariantContextWriter now properly closes the underlying output stream when it's closed
-- Updated compressed VCF output file
2012-12-13 16:15:08 -05:00
Yossi Farjoun 5e66109268 Replaced a useless getInt with a skipInt to remove 1/4 of the initial seek time in the BAM Index. 2012-12-12 17:08:11 -05:00
Eric Banks 62eaffdf0a Fix docs for ReadBackedPhasing 2012-12-12 20:28:04 +00:00
Eric Banks bba63a3b0e Fix for GSA-615: UnifiedGenotyperEngine.getGLModelsToUse takes 5% of the runtime of UG, should be optimized away. 2012-12-12 20:25:45 +00:00
Mauricio Carneiro a52e3c7e15 Revert "Bug fix for RR: don't let the softclip start position be less than 1"
this introduced a bug in reduce reads by de-activating it's hard clipping of the out of bounds soft-clips (specially in the MT).
DEV-322 #resolve #time 4m

This reverts commit 42acfd9d0bccfc0411944c342a5b889f5feae736.
2012-12-12 13:09:39 -05:00
Mark DePristo 5632c13bf2 Resolves GSA-681 / Compressed VCF.gz output is too big because of unnecessary call to flush().
-- Now compressed output VCFs are properly blocked compressed (i.e., they are actually smaller than the uncompressed VCF)
2012-12-12 10:27:07 -05:00
Mark DePristo dd52a70d45 Fix AFCalcResult unit test
-- I was simply passing in the wrong values into the function.  Fixed the calls, and expanded the docs on what needs to be passed in.
2012-12-11 10:40:12 -05:00
Ami Levy-Moonshine 6bf31065e3 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-11 10:34:50 -05:00
Ami Levy-Moonshine 2f99569dda change the md5 in one of the CV intergration tests, since it wasn't use the priority list when printing the origin of the annotation (the setValue field) 2012-12-10 22:48:15 -05:00
Ami Levy-Moonshine 2e3284f306 Continue to fix the case where PRIORITIZE is used but no priority list is given. While fixing that case I also removed unnecessary sorting, when the prioeity list is not provied. When the priority list is not provided, it will continue to be null. Thus, the number of original Variant Contexts should be given as a new parameter to simpleMerge (since priority might be null). This new parameter is used for checking if there are filtered VC, when annotationOrigin is true. 2012-12-10 22:23:58 -05:00
Mauricio Carneiro 19372225af Merge Broad's GATK and CMI gatk 2012-12-10 15:33:38 -05:00
Mauricio Carneiro 8a115edbaf ReduceReads is now scattered by contig
It's no longer safe to scatter/gather by interval because now we don't hard-clip to the intervals anymore.
2012-12-10 15:25:27 -05:00
Ami Levy-Moonshine 573ace4403 restore the right version of VariantContextUtils.java in my unstable dir 2012-12-10 10:28:56 -05:00
David Roazen 46edab6d6a Use the new downsampling implementation by default
-Switch back to the old implementation, if needed, with --use_legacy_downsampler

-LocusIteratorByStateExperimental becomes the new LocusIteratorByState, and
the original LocusIteratorByState becomes LegacyLocusIteratorByState

-Similarly, the ExperimentalReadShardBalancer becomes the new ReadShardBalancer,
with the old one renamed to LegacyReadShardBalancer

-Performance improvements: locus traversals used to be 20% slower in the new
downsampling implementation, now they are roughly the same speed.

-Tests show a very high level of concordance with UG calls from the previous
implementation, with some new calls and edge cases that still require more examination.

-With the new implementation, can now use -dcov with ReadWalkers to set a limit
on the max # of reads per alignment start position per sample. Appropriate value
for ReadWalker dcov may be in the single digits for some tools, but this too
requires more investigation.
2012-12-10 09:44:50 -05:00
Ami Levy-Moonshine 5460c96137 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-09 23:43:57 -05:00
Ami Levy-Moonshine 3a420d163e (1) changes in catVariants (work still under development) (2) changes to CV to throw an error when GenotypeMergeType is PRIORITIZE but no priority (rod_priority_list) is not given. Reported by TechnicalVault on the forum on Nov 14 2012 2012-12-09 23:40:03 -05:00
Eric Banks 574d5b467f Bug fix for indel HMM: protect against situation where long reads (e.g. Sanger) in a pileup can lead to a read starting after the haplotype end for a given haplotype. 2012-12-09 02:09:34 -05:00
Mauricio Carneiro 6d22f4f737 Bringing latest performance updates from the GATK to CMI 2012-12-05 21:40:03 -05:00
Mark DePristo dbf721968d PrintReads large-scale test to protect against another major low-level performance issue 2012-12-05 21:36:27 -05:00
Ami Levy-Moonshine 5d78a61f7a Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-05 15:07:12 -05:00
Mark DePristo 465694078e Major performance improvement to the GATK engine
-- The NanoSchedule timing code (in NSRuntimeProfile) was crazy expensive, but never showed up in the profilers.  Removed all of the timing code from the NanoScheduler, the NSRuntimeProfile itself, and updated the unit tests.
-- For tools that largely pass through data quickly, this change reduces runtimes by as much as 10x.  For the RealignerTargetCreator example, the runtime before this commit was 3 hours, and after is 30 minutes (6x improvement).
-- Took this opportunity to improve the GATK ProgressMeter.  NotifyOfProgress now just keeps track of the maximum position seen, and a separate daemon thread ProgressMeterDaemon periodically wakes up and prints the current progress.  This removes all inner loop calls to the GATK timers.
-- The history of the bug started here: http://gatkforums.broadinstitute.org/discussion/comment/2402#Comment_2402
2012-12-05 14:49:22 -05:00
Mark DePristo 2b601571e7 Better error handling in NanoScheduler
-- The previous nanoscheduler would deadlock in the case where an Error, not an Exception, was thrown.  Errors, like out of memory, would cause the whole system to die.  This bugfix resolves that issue
2012-12-05 14:49:22 -05:00
Eric Banks 0c925856cb Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-05 02:00:39 -05:00
Eric Banks ef87b18e09 In retrospect, it wasn't a good idea to have FisherStrand handle reduced reads since they are always on the forward strand. For now, FS ignores reduced reads but I've added a note (and JIRA) to make this work once the RR het compression is enabled (since we will have directionality in reads then). 2012-12-05 02:00:35 -05:00
Mauricio Carneiro 30f013aeb0 Added a copy() method for ReadBackedPileups
necessary to create new alignment contexts with hard-copies of the pileup.
2012-12-05 01:32:18 -05:00
Mauricio Carneiro 6feda540a4 Better error message for SimpleGATKReports 2012-12-05 01:32:18 -05:00
kshakir 61bde6210b Restored RemoteFile push and pull in base QScript. 2012-12-04 12:34:07 -05:00
Randal Moore 8d2d0253a2 introduce a level of indirection for the forum URLs - this new function will allow me a place to morph the URL into something that is supported by Confluence
Signed-off-by: Eric Banks <ebanks@broadinstitute.org>
2012-12-03 22:33:02 -05:00
Eric Banks 67932b357d Bug fix for RR: don't let the softclip start position be less than 1 2012-12-03 15:59:14 -05:00
Ryan Poplin a47da9bb2f Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-03 14:30:14 -05:00
Eric Banks 5fed9df295 Quick fix: base qual array in the GATKSAMRecord stores the actual phred values (-33) and not the original bytes (duh). 2012-12-03 12:18:20 -05:00
Eric Banks b6839b3049 Added checking in the GATK for mis-encoded quality scores.
The check is performed by a Read Transformer that samples (currently set to once
every 1000 reads so that we don't hurt overall GATK performance) from the input
reads and checks to make sure that none of the base quals is too high (> Q60). If
we encounter such a base then we fail with a User Error.

* Can be over-ridden with --allow_potentially_misencoded_quality_scores.
* Also, the user can choose to fix his quals on the fly (presumably using PrintReads
  to write out a fixed bam) with the --fix_misencoded_quality_scores argument.

Added unit tests.
2012-12-03 11:18:41 -05:00
Ryan Poplin 18b002c99c Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-03 10:08:56 -05:00
Ryan Poplin 1bdf17ef53 Reworking of how the likelihood calculation is organized in the HaplotypeCaller to facilitate the inclusion of per allele downsampling. We now use the downsampling for both the GL calculations and the annotation calculations. 2012-12-02 11:58:32 -05:00
Ami Levy-Moonshine d0b8cc7773 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-01 00:08:25 -05:00
Ami Levy-Moonshine 969c995298 work under development - catVariants. Changes to AssessRRQuals based on Eric todo comments. bug fix in CombineVariants 2012-12-01 00:08:19 -05:00
Mark DePristo 8020ba14db Minor cleanup of SAMDataSource as part of my system review
-- Changed a few function from public to protected, as they are only used by the package contents, to simplify the SAMDataSource interface
2012-11-30 15:04:41 -05:00
Mauricio Carneiro fc7fab5f3b Fixed ReadBackedPileup downsampling
Downsampling in the PerSampleReadBackedPileup was broken, it didn't downsample anything, always returning a copy the original pileup.
2012-11-30 00:42:05 -05:00
Joel Thibault 97d29f203e Add walltime changes to LSF
- Check whether the specified attribute is available
- Add pipeline test (disabled due to missing attribute)
2012-11-29 15:23:37 -05:00
Johan Dahlberg daf6269b65 Setting the walltime
Signed-off-by: Joel Thibault <thibault@broadinstitute.org>
2012-11-29 15:23:36 -05:00
kshakir a6c1fcd151 Removed default use of @Output syntax.
If compile completes for QScripts, sending runtime errors during execute.
2012-11-29 13:40:36 -05:00
David Roazen b2e699169c Update GATK packaging settings to package arbitrary resources
With the newly-added support for packaging arbitrary resources, the
resources were getting packaged in a normal build but not when
creating a standalone GATK jar. This corrects this oversight.
2012-11-28 15:26:05 -05:00
Joel Thibault c76c808268 Reads are required to be sorted
- Remove the extended_only case because it's outside intervals
2012-11-28 13:59:58 -05:00
Joel Thibault 198923b597 Add ActiveRegionReadState handling 2012-11-28 13:59:57 -05:00
Ryan Poplin f0395b457a Adding the work-in-progress, experimental RepeatLengthCovariate to the BQSR so Chris can continue the development. 2012-11-28 13:56:32 -05:00
Eric Banks 3463774f2a Merged bug fix from Stable into Unstable 2012-11-28 13:26:52 -05:00
Eric Banks 6030605242 Added quick check for creation of bad BAQ values associated with badly encoded base qualities; hopefully this can help us debug the non-reproducible issue seen by many users. 2012-11-28 13:26:31 -05:00
Mark DePristo c676853731 Merged bug fix from Stable into Unstable. Updating md5s
Conflicts:
	protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java
2012-11-28 12:54:36 -05:00
Mark DePristo a1d6461121 Critical bugfix to AFCalcResult affecting UG/HC quality score emission thresholds
As reported by Menachem Fromer: a critical bug in AFCalcResult:

Specifically, the implementation:
    public boolean isPolymorphic(final Allele allele, final double log10minPNonRef) {
        return getLog10PosteriorOfAFGt0ForAllele(allele) >= log10minPNonRef;
    }

seems incorrect and should probably be:

getLog10PosteriorOfAFEq0ForAllele(allele) <= log10minPNonRef

The issue here is that the 30 represents a Phred-scaled probability of *error* and it's currently being compared to a log probability of *non-error*.

Instead, we need to require that our probability of error be less than the error threshold.
This bug has only a minor impact on the calls -- hardly any sites change -- which is good.  But the inverted logic effects multi-allelic sites significantly.  Basically you only hit this logic with multiple alleles, and in that case it'\s including extra alt alleles incorrectly, and throwing out good ones.

Change was to create a new function that properly handles thresholds that are PhredScaled quality scores:

    /**
     * Same as #isPolymorphic but takes a phred-scaled quality score as input
     */
    public boolean isPolymorphicPhredScaledQual(final Allele allele, final double minPNonRefPhredScaledQual) {
        if ( minPNonRefPhredScaledQual < 0 ) throw new IllegalArgumentException("phredScaledQual " + minPNonRefPhredScaledQual + " < 0 ");
        final double log10Threshold = Math.log10(QualityUtils.qualToProb(minPNonRefPhredScaledQual));
        return isPolymorphic(allele, log10Threshold);
    }
2012-11-28 12:08:02 -05:00
Menachem Fromer 79bc878e6a Allow debugging to be set from the command line 2012-11-27 22:37:41 -05:00
Eric Banks b40d3eb8aa Merged bug fix from Stable into Unstable 2012-11-27 14:41:07 -05:00
Eric Banks 01abcc3e0f Tests didn't like my note to Geraldine in the output logs; apparently it's tested in integration tests 2012-11-27 14:40:49 -05:00
Mark DePristo 7e4b9c9e6e Fix failing unit tests for VariantContextUtilsUnitTest
-- Previous version was adding multiple samples with the same name to the variant context
2012-11-27 14:26:23 -05:00
Joel Thibault 9bfe39411e Equal overlap should match right/later region 2012-11-27 13:03:13 -05:00
Joel Thibault d83ad906ef Add profile range contract 2012-11-27 13:03:13 -05:00
Joel Thibault cc550b4145 Add a read and interval on a different contig 2012-11-27 13:03:13 -05:00
Eric Banks 9531e58445 Merged bug fix from Stable into Unstable 2012-11-27 11:00:50 -05:00
Eric Banks 4543ece088 Fixing parsing of genomelocs that contain colons in the contig names (which is allowed by the spec) as reported on the forum. Added unit test for this case. 2012-11-27 11:00:33 -05:00
Eric Banks a82ec7ad80 Merged bug fix from Stable into Unstable 2012-11-27 10:27:08 -05:00
Eric Banks e199562c25 I have pulled out all of the documentation URLs and put them into the HelpUtils class as static variables; this way, Appistry can change links as needed to point commercial users to their own internal forum without having to muck things up all over our source. Added some TODOs for Geraldine to update links in the GATK docs that still point to the old wiki. Sorry that I am pushing into stable, but that's what Appistry is pulling from for their release next week (and unstable has been failing forever). 2012-11-27 10:26:17 -05:00
Mauricio Carneiro 97fd5de260 Merging latest CMI updates with UNSTABLE 2012-11-27 09:08:00 -05:00
Eric Banks b1969a66bd Update docs 2012-11-27 08:24:41 -05:00
Eric Banks cc72aaefeb Minor efficiency: use >= instead of > in test 2012-11-27 01:11:23 -05:00
Eric Banks 405f3c675d Fix for GSA-649: GenomeLocSortedSet.overlaps is crazy slow. Also improved GenomeLocSortedSet.sizeBeforeLoc. 2012-11-27 01:07:00 -05:00
Ryan Poplin e27d677c13 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-11-26 12:20:32 -05:00
Ryan Poplin c3b7dd1374 Misc cleanup in the HaplotypeCaller. Cleaning up unused arguments after recent changes to HC-GenotypingEngine 2012-11-26 12:19:11 -05:00
Eric Banks 4f7fa3009a I forget why I thought that the VariantAnnotator couldn't run multi-threaded because it works just fine. Now you can specify -nt with VA. 2012-11-26 11:34:59 -05:00
Mauricio Carneiro a3f5932501 Fixed null pointer exception in Integration Tests
When running Utils.setupWriter with NO_PG_TAG set, the writer was attempting to create a program record with the null pointer. Fixed.
2012-11-26 11:12:27 -05:00
Ryan Poplin fedc4fde6c Merged bug fix from Stable into Unstable 2012-11-25 21:55:55 -05:00
Ryan Poplin d978cfe835 Soft clipped bases shouldn't be counted in the delocalized BQSR. 2012-11-25 21:55:29 -05:00
Eric Banks 9719ba7adc Remove -number example from the docs since it's no longer supported. 2012-11-22 21:53:42 -05:00
Menachem Fromer 2306518ab6 Fix to deal with 'proper' options of casting 2012-11-22 01:45:18 -05:00
Menachem Fromer d33a412b5f Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-11-22 01:42:29 -05:00
Mark DePristo 48f271c5bd Adding 80% support for multi-allelic variants
-- Multi-allelic variants are split into their bi-allelic version, trimmed, and we attempt to provide a meaningful genotype for NA12878 here.  It's not perfect and needs some discussion on how to handle het/alt variants
-- Adding splitInBiallelic funtion to VariantContextUtils as well as extensive unit tests that also indirectly test reverseTrimAlleles (which worked perfectly FYI)
2012-11-21 17:24:59 -05:00
Joel Thibault c68bc95db6 Initial read mapping tests
- Failing tests are commented out
2012-11-21 17:16:46 -05:00
Joel Thibault 3ad9128800 Add some reads
- Move intervals and reads to init
- Update intervals and reads
2012-11-21 17:16:46 -05:00
Joel Thibault 3fa3b00f4a Add ActiveRegion tests and refactor 2012-11-21 17:16:45 -05:00
Joel Thibault e8defcb20d Test multiple bases and intervals 2012-11-21 17:16:45 -05:00
Joel Thibault c08b782743 Count isActive calls directly 2012-11-21 17:16:45 -05:00
Eric Banks 4f2229d399 As per the TODO message, I removed a check that was no longer necessary. Now ID is an allowable INFO field key. 2012-11-21 16:01:26 -05:00
Menachem Fromer a8c7edca05 Fixed fragment handling in DepthOfCoverage 2012-11-21 16:01:10 -05:00
Menachem Fromer 06261b58c2 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-11-21 15:57:08 -05:00
Eric Banks ed50814ccb Finally found a case where user errors were being masked behind other errors and could debug. It turns out that the checkForMaskedUserErrors() method needs to run recursively over all levels (calling exception.getCause()) to check for the original cause. 2012-11-21 15:57:05 -05:00
Menachem Fromer c8be7c3102 Keep SNPs and indels separately for batch merging; Add options to DepthOfCoverage to count fragments (to not double-count overlapping reads of same fragment); DepthOfCoverage should now support ReducedReads; Replace recusrion with loop in DoC/package.scala (for lists longer than 5000 elements) 2012-11-21 15:56:53 -05:00
Ami Levy-Moonshine 4714ccc284 change the way CombineVariants check the priority arguments in order to throw error when the genotypeMergeOption argument is set to PRIORITIZE but PRIORITY_STRING is not provided 2012-11-21 10:47:35 -05:00
Eric Banks 2e1a055aca Merged bug fix from Stable into Unstable 2012-11-20 23:20:33 -05:00
Eric Banks c54fc94505 Protect against features that start off the end of the read (otherwise, Arrays.fill fails) 2012-11-20 23:19:59 -05:00
Eric Banks c2efb04657 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-11-20 22:43:15 -05:00
Eric Banks 72e2d569c5 The user can now set the maximum allowable cycle on the command-line with --maximum_cycle_value. This value is (now) enforced in the Cycle covariate and a User Error is thrown if the maximum value is passed (with a helpful error message). Added unit tests to cover this new functionality. 2012-11-20 22:41:57 -05:00
Eric Banks ff87642a91 Enable cycle covariate unit tests 2012-11-20 22:29:56 -05:00
Mark DePristo cc7680e601 NA12878 knowledge base backed by MongoDB
-- Idea is simply to create a persistent database of all TP/FP sites on chr20 in NA12878.  Individual callsets can be imported, and a consensus algorithm is run over all callsets in the database to create a consensus collection, which can be used to assess NA12878 callsets for GATK and methods development
-- Framework for representing simple VariantContexts and Genotypes in MongoDB, querying for records, and iterating over them in the GATK
-- Not hooked up to Tribble, but could be done reasonably easily now (future TODO)
-- Tools to import callsets, create consensus callsets, import and export reviews
-- Scripts to reset the knowledge base and repopulate it with the standard data files (Eric will expand)
-- Actually scales to all of chr20, includes AssessNA12878 that reads a VCF and itemizes it against the truth data set
-- ImportCallset can load OMNI, HM3, CEU best practices, mills/devine sites and genotypes, properly marking sites as poly/mono/unk as well as TP/FP/UNK based on command line parameters
-- Added shell scripts that start up a local mongo db, that connect to a local or BI hosted mongo for NA12878.db for debugging, and a setupNA12878db script that can load OMNI, HM3, CEU best practices, Mills/Devine into the db and then update the consensus.
-- Reviewed sites can be exported to a VCF, and imported again, as a mechanism to safely store the only non-recoverable data from the Mongo DB.
-- Created a NA12878DBWalker that manages the outer DB interaction, and that all MongoDB interacting walkers inherit from.  Added a NA12878DBArgumentCollection.java consolating all of the common command line arguments (though strictly not necessary as all of this occurs in the root walker)

UnitTests
-- Can connect to a test knowledge base for development and unit testing
-- PolymorphicStatus, TruthStatus, SiteIterator
-- NA12878KBUnitTestBase provides simple utilities for connecting to the test mongo db, getting calls, etc
-- MongoVariantContext tests creation, matching, and encoding -> writing -> read -> decoding from the mongodb

AssessNA12878
-- Generic tool for comparing a NA12878 callset against the knowledge base.  See http://gatkforums.broadinstitute.org/discussion/1848/using-the-na12878-knowledge-base for detailed documentation
-- Performs trivial filtering on FS, MQ, QD for SNPs and non-SNPs to separate out variants likely to be filtered from those that are honest-to-goodness FPs

Misc
-- Ability to provide Description for Simplified GATK report
2012-11-20 18:50:52 -05:00
Eric Banks 937ac7290f Lots more GGA fixes for the HC now that I understand what's going on internally. Integration tests pass except for the GGA test which I believe now produces better results. 2012-11-20 16:13:29 -05:00
Menachem Fromer 9111966261 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-11-20 12:19:58 -05:00
Eric Banks 4f243acaa6 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-11-19 10:34:44 -05:00
Eric Banks f0b8a0228f Quick fix for HC refactoring: when copying over Haplotype objects, make sure to copy over the artificial allele used to create it too. 2012-11-19 09:57:55 -05:00
Eric Banks ff180a8e02 Significant refactoring of the Haplotype Caller to handle problems with GGA. The main fix is that we now maintain a mapping from 'original' allele to 'Smith-Waterman-based' allele so that we no longer need to do a (buggy) matching throughout the calling process. 2012-11-19 09:09:57 -05:00
Eric Banks 78ce822b6f Protect against NPE when using non-GATK reports for inputs expecting valid GATK reports 2012-11-19 09:07:04 -05:00
Joel Thibault b70fd4a242 Initial testing of the Active Region Traversal contract
- TODO: many more tests and test cases
2012-11-15 10:08:00 -05:00
Guillermo del Angel a68e6810c9 Back off experimental code that escaped last commit, not for general use yet 2012-11-14 14:45:15 -05:00
Guillermo del Angel 89bbe73a43 Commenting out CMI pipeline test that wasn't meant to be in GATK repository (why was this merged??) 2012-11-14 14:39:04 -05:00
Guillermo del Angel 3771d074dc Merge branch 'master' of ssh://gsa3/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-11-14 14:37:43 -05:00
Eric Banks 843384e435 Rename hg19 files in bundle to b37 since that's what they are 2012-11-14 11:47:09 -05:00
Mauricio Carneiro e35fd1c717 Merging CMI-0.5.0 and GATK-2.2 together. 2012-11-14 10:42:03 -05:00
Mauricio Carneiro a079d8d0d1 Breaking the utility to write @PG tags for SAMFileWriters and StingSAMFileWriters 2012-11-14 10:33:22 -05:00
Mauricio Carneiro dba31018f4 Implementation of BySampleSAMFileWriter
ReduceReads now works with the n-way-out capability, splitting by sample.
DEV-27 #resolve #time 3m
2012-11-14 10:33:22 -05:00
Mauricio Carneiro a17cd54b68 Co-Reduction implementation in ReduceReads
ReduceReads now co-reduces bams if they're passed in toghether with multiple -I. Co-reduction forces every variant region in one sample to be a variant region in all samples.
Also:
  * Added integrationtest for co-reduction
  * Fixed bug with new no-recalculation implementation of the marksites object where the last object wasn't being removed after finalizing a variant region (updated MD5's accordingly)

DEV-200 #resolve #time 8m
2012-11-14 10:33:21 -05:00
kshakir 6d59dd3455 Scala classes were only returning direct subclasses (confirmed when inspected in debugger) so changed PluginManager to allow specifying the explicit subclass.
Removed some generics from PluginManager for now until able to figure out syntax for requesting explicit subclass.
QStatusMessenger uses a slightly more primitive Map[String, Seq[RemoteFile]] instead of Map[ArgumentSource, Seq[RemoteFile]].
Added an QCommandPlugin.initScript utility method for handling specialized script types.
2012-11-14 10:33:20 -05:00
Eric Banks 42ddf51156 Merged bug fix from Stable into Unstable 2012-11-14 10:29:09 -05:00
Eric Banks ba41f65759 Protect against NPEs in SelectVariants by checking for missing Genotypes 2012-11-13 11:53:39 -05:00
Eric Banks c7335c9902 Having a malformed GATK report is a User Error 2012-11-13 11:53:12 -05:00
Eric Banks 525cf331f4 Don't catch a User Error and re-throw as a Reviewed Exception. That makes Eric unhappy. 2012-11-13 11:52:47 -05:00
Eric Banks ee776e996a Merged bug fix from Stable into Unstable 2012-11-09 08:35:51 -05:00
Eric Banks 66cbaaee31 Fixed nasty bug in BQSR csv file creation:
numbers larger than 999 in the Errors column were printed out with commas (which looks like a separate column).

This wasn't caught earlier because there are no integration tests covering the csv.  I'll add one into unstable in a sec.
2012-11-09 08:33:55 -05:00
Eric Banks e9183d9fe0 Fix bugs as reported on the forum: BED needs to be explicitly set as the default output format and the output didn't actually adhere to the BED spec. 2012-11-08 15:07:47 -05:00
Eric Banks 17ab3a39d5 Make the --intermediate_csv_file argument un-hidden. 2012-11-08 14:35:23 -05:00
Eric Banks f4d4846435 Merged bug fix from Stable into Unstable 2012-11-06 20:53:54 -08:00
Eric Banks 15b8c08132 Apparently CIGAR elements can have 0 length according to the spec, but 0Ms were causing left alignment of indels to fail. Fixed. 2012-11-06 20:53:33 -08:00
David Roazen 73157ae3d3 Allow each pipeline test the max of 10 hours to run
The runtime of these tests is extremely variable -- sometimes they will complete almost instantly,
other times they will wait in an LSF queue for 5-10+ hours. Minimize timeout errors by setting the
timeout for these tests to the maximum of 10 hours.
2012-11-02 12:40:56 -04:00
Mark DePristo f8a0a947e3 Critical bugfix for GSA-652 / Multi-threaded VCF -> BCF writing produces invalid intermediate file that fails on merging
-- New tribble library now uses 64 bit sizes.  The 26K VCF has so much data that low-level tribble block indices where overflowing their int size values.  This includes a to-be-committed tribble jar that fixes this problem
-- See https://jira.broadinstitute.org/browse/GSA-652
-- Minor cleanup of error messages that were useful on the way to solving this monster problem
2012-11-02 09:09:59 -04:00
David Roazen 6185e8c432 Allow large-scale tests 5 hours each to run 2012-11-01 17:48:58 -04:00
Ryan Poplin 386b45e94d This VE eval module isn't useful anymore. 2012-11-01 15:44:41 -04:00
Mark DePristo 872abddfce Add custom TestNGTestTransformer that adds a maximum test runtime of 10 minutes to all testng tests
-- Closes GSA-494 / Add maximum runtime for integration tests, running them in timeout thread
-- Needed to debug locking issues
-- Needed to debug excessively long running integrationtests
-- Added build.xml maximum runtime for all testng tests of 10 hours.  We will ultimately fail the build if it goes on for more than 10 hours
2012-11-01 15:34:12 -04:00
Mark DePristo 1444cd753b Bugfix for GSA-647 HaplotypeCaller misses good variant because the active region doesn't trigger for an exome
-- The logic for determining active regions was a bit broken in the HC when intervals were used in the system
-- TraverseActiveRegions now uses the AllLocus view, since we always want to see all reference sites, not just those covered.  Simplifies logic of TAR
-- Non-overlapping intervals are always treated as separate objects for determing active / inactive state.  This means that each exon will stand on its own when deciding if it should be active or inactive
-- Misc. cleanup, docs of some TAR infrastructure to make it safer and easier to debug in the future.
-- Committing the SingleExomeCalling script that I used to find this problem, and will continue to use in evaluating calling of a single exome with the HC
-- Make sure to get all of the reads into the set of potentially active reads, even for genomic locations that themselves don't overlap the engine intervals but may have reads that overlap the regions
-- Remove excessively expensive calls to check bases are upper cased in ReferenceContext
-- Update md5s after a lot of manual review and discussion with Ryan
2012-11-01 15:34:04 -04:00
Mark DePristo 9cd04c335c Work on GSA-508 / CachingIndexedFastaReader should internally upper case bases loading data
-- As one might expect, CachingIndexedFastaSequenceFile now internally upper cases the FASTA reference bases.  This is now done by default, unless requested explicitly to preserve the original bases.
-- This is really the correct place to do this for a variety of reasons.  First, you don't need to work about upper casing bases throughout the code.  Second, the cache is only upper cased once, no matter how often the bases are accessed, which walkers cannot optimize themselves.  Finally, this uses the fastest function for this -- Picard's toUpperCase(byte[]) which is way better than String.toUpperCase()
-- Added unit tests to ensure this functionality works correct.
-- Removing unnecessary upper casing of bases in some core GATK tools, now that RefContext guarentees that the reference bases are all upper case.
-- Added contracts to ensure this is the case.
-- Remove a ton of sh*t from BaseUtils that was so old I had no idea what it was doing any longer, and didn't have any unit tests to ensure it was correct, and wasn't used anywhere in our code
2012-11-01 15:34:03 -04:00
Eric Banks 94a13c05ed Merged bug fix from Stable into Unstable 2012-10-31 22:57:26 -04:00
Eric Banks 47a0f5859e Don't run these tests if not GAKT lite 2012-10-31 22:56:38 -04:00
Eric Banks 881c843307 Merged bug fix from Stable into Unstable 2012-10-31 21:28:27 -04:00
Eric Banks f8af8a2355 Moving UG integration tests to protected since they use protected-only contamination filtering. Adding a new UGLite integration test to confirm that contamination filtering is ignored in lite. 2012-10-31 21:28:07 -04:00
Guillermo del Angel 24e6da25cc Merge branch 'master' of ssh://gsa3/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-31 14:17:41 -04:00
Eric Banks 96344c6b62 Add note to realigner docs 2012-10-31 12:35:45 -04:00
Guillermo del Angel 4580e99c0c Merge branch 'master' of ssh://gsa3/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-31 10:50:54 -04:00
Guillermo del Angel 02b790c8db Merge fix 2012-10-31 10:50:36 -04:00
Guillermo del Angel 51a9ce28e1 Merge remote-tracking branch 'unstable/master' into develop 2012-10-31 10:29:48 -04:00
Eric Banks eccb76c304 Only run UG in the bundle for chr20 2012-10-30 15:09:46 -04:00
Eric Banks e1e480a0b9 Bug fix: don't add no-call alleles to the list of ALT alleles being validated. 2012-10-30 14:54:29 -04:00
Eric Banks 2aa28abe0a Fixing md5s to reflect the new HapMap file 2012-10-30 14:27:10 -04:00
Guillermo del Angel c8e17a7adf totally experimental UG feature, to be removed 2012-10-30 13:57:54 -04:00
Eric Banks 8a402024c2 Updating bundle script to handle new naming convention of CEU trio best practices callset 2012-10-30 09:11:56 -04:00
Eric Banks c95e893920 Better error message for unused ALT alleles 2012-10-29 21:51:35 -04:00
Eric Banks b6a1967f12 Better documentation for ValidateVariants so that people realize it's used for strict validation of the VCF file. Added an option to turn off strict validation and an integration test to cover it. 2012-10-29 21:47:09 -04:00
Ryan Poplin 21fa5f70ca Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-29 18:53:41 -04:00
Ryan Poplin 5ee2feb2a3 updating pipeline test md5s 2012-10-29 18:53:27 -04:00
Eric Banks be902375ac 'Bug' fix: fix the error message from the vcf validator so people realize that the file fails strict validation but still adheres to the spec. 2012-10-29 16:29:27 -04:00
Ryan Poplin 4e661847b2 DelocalizedBaseRecalibrator becomes the BaseRecalibrator. 2012-10-29 12:53:39 -04:00
Menachem Fromer 5070304ef4 Merge branch 'master' of ssh://gsa3.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-29 11:50:29 -04:00
Eric Banks ac99437eec Bug fixes to hapmap conversion in VariantsToVCF 2012-10-29 01:45:33 -04:00
Eric Banks 43625f652e Shoot, mixed up the md5s last time. 2012-10-27 19:43:46 -04:00
Andrey Sivachenko f3ac5d404d updating vcf header attribute descriptions in order to reflect correctly what's actually being written... 2012-10-26 23:52:21 -04:00
Andrey Sivachenko b4fbf6280a fixing missing sample genotype bug, missing AD/DP bug, and putting annotations in more natural order (Ref/Alt) 2012-10-26 23:48:40 -04:00
Mark DePristo ac5e58a265 Bugfix for GSA-540 / Update metadata maps when adding lines to VCFHeader
-- https://jira.broadinstitute.org/browse/GSA-540
-- http://gatkforums.broadinstitute.org/discussion/1433/possible-bug-and-fix-in-java-code-of-vcfheader-org-broadinstitute-sting-utils-codecs-vcf-vcfheader
2012-10-26 16:34:16 -04:00
Mark DePristo fa9b2a91d0 Bugfix for GSA-552
-- https://jira.broadinstitute.org/browse/GSA-552
-- User reports a null exception while using VariantsToVCF:
   http://gatkforums.broadinstitute.org/discussion/1461/nullpointerexception-converting-vcf3-to-vcf-using-variantstovcf
   The problem is that he left out an input VCF file for the --variant argument and the command-line argument parsing code didn't catch this, so we NPE out later on.
2012-10-26 16:34:16 -04:00
Eric Banks 682a72faf7 Hmm, thought I got all the md5s last time. Apparently not. 2012-10-26 16:10:12 -04:00
Eric Banks f66d812778 Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-26 13:20:41 -04:00
Eric Banks a8704ca73f Adding TODO notes for Ami 2012-10-26 13:20:27 -04:00
Mark DePristo 251983b8fb Add GATK-wide command line argument to control the maximum runtime allowed for the GATK
-- Providing this optional argument -maxRuntime (in -maxRuntimeUnits units) causes the GATK to exit gracefully when the max. runtime has been exceeded.  By cleanly I mean that the engine simply stops at the next available cycle in the walker as through the end of processing had been reached.  This means that all output files are closed properly, etc.
-- Emits an info message that looks like "INFO  10:36:52,723 MicroScheduler - Aborting execution (cleanly) because the runtime has exceeded the requested maximum 10.0000 s".  Otherwise there's currently no way to differentiate a truly completed run from a timelimit exceeded run, which may be a useful thing for a future update
-- Resolves GSA-630 / GATK max runtime to deal with bad LSA calling?
-- Added new JIRA entry for Ami to restart chr1 macarthur with this argument set to -maxRuntime 1 -maxRuntimeUnits DAYS to see if we can do all of chr1 in one weekend.
2012-10-26 13:18:34 -04:00
Eric Banks ed11b7dab2 Fix UG parallelization test 2012-10-26 12:10:44 -04:00
Eric Banks 7a706ed345 Fix some of the broken integration tests 2012-10-26 11:23:44 -04:00
Menachem Fromer 28393e9b30 Merge branch 'master' of ssh://gsa3.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-26 03:55:02 -04:00
Eric Banks ebebec7fdb Accidentally left one test disabled 2012-10-26 02:15:32 -04:00
Eric Banks b06f689d4b Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-26 02:13:26 -04:00
Eric Banks a53e03d525 Do not let reduced reads get removed in the contamination down-sampling 2012-10-26 02:13:04 -04:00
Menachem Fromer 9af4b34fd8 Changed @Input to @Argument for non-File types 2012-10-26 01:21:05 -04:00
Eric Banks bf3d61ce82 The default value for --contamination_fraction_to_filter is now 0.05 (5%) in both UG and HC. Users of GATK-lite get pushed down to 0% by default (since it's not enabled) or get a user error if they try to set it. 2012-10-26 01:04:51 -04:00
Eric Banks 91f2c847a3 Fixing problem reported on forum for VF: DP couldn't be filtered from the FORMAT field, only from the INFO field. Fixed and added integration test. 2012-10-26 00:57:40 -04:00
Menachem Fromer e0fa7d1497 Merge branch 'master' of ssh://gsa3.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-26 00:14:58 -04:00
Mark DePristo 6b8b7df651 Queue now understands -nct and requests the appropriate number of cores from LSF, SGE, etc
-- NCT wasn't previously recognized by Queue as needing more processors per machine.  This commit fixes this.  Also a potential cause of poor GATKPerformanceOverTime, in that runs with -nct could flood a node and cause it to have hundreds of cores in contention.
2012-10-25 17:26:58 -04:00
David Roazen 422e16c62e BaseRecalibration: don't cache instances of ReadCovariates across reads
Caching and reusing ReadCovariates instances across reads sounds good in theory, but:

-it doesn't work unless you zero out the internal arrays before each read
-the internal arrays must be sized proportionally to the maximum POSSIBLE
recalibrated read length (5000!!!), instead of the ACTUAL read lengths

By contrast, creating a new instance per read is basically equivalent to doing an
efficient low-level memset-style clear on a much smaller array (since we use the actual
rather than the maximum read length to create it). So this should be faster than caching
instances and calling clear() but slower than caching instances and not calling clear().

Credit to Ryan to proposing this approach.
2012-10-25 17:02:55 -04:00
Guillermo del Angel 92fa7e953a Merge branch 'master' of ssh://gsa3/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-25 16:33:14 -04:00
Menachem Fromer 0fe36b1c72 Merge branch 'master' of ssh://gsa3.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-25 16:18:57 -04:00
Menachem Fromer cde4f037d3 Begin moving XHMM scripts to public 2012-10-25 16:18:25 -04:00
Ami Levy Moonshine dde3060bb8 add the CEUtrio best practices results (UG + PBT) to the bundle 2012-10-25 15:36:17 -04:00
Ami Levy Moonshine 90b9971033 Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-25 15:32:29 -04:00
David Roazen 884d031e72 NestedIntegerArray: Pre-allocate only the first two dimensions
It turns out that pre-allocating the entire tree was too expensive in
terms of memory when using large values for the -mcs and -ics parameters.

Pre-allocating the first two dimensions prevents us from ever locking the
root node during a put(). Contention between threads over lower levels
of the tree should be minimal given that puts are rare compared to gets.

Also output dimensions and pre-allocation info at startup. If pre-allocation
takes longer than usual this gives the user a sense of what is causing the
delay.
2012-10-25 15:17:42 -04:00
Mark DePristo cc8c12b954 Committing a broken version of BaseRecalibration
-- I'm committing because there's some kind of fundamental problem with the ReadCovariates cache, in that historical data isn't being cleared / computed properly, and I'd rather it fail for a while than leave it in JIRA.
-- The integration tests test the -nct with PrintReads to get 1, 2, 4 and the 4 fails.  But that's because of this incorrect calculation
-- Updating GATKPerformanceOverTime with the new @ClassType annotation
2012-10-25 14:46:35 -04:00
Eric Banks e93ff3ea6e Let's go back to having the SB/SLOD NOT computed by default. If you recall, it was only enabled by default because we thought we were going to use it when we made VQSR use random forests. But since we decided not to change VQSR, there's no reason to triple the computation for every variant site anymore. 2012-10-25 12:45:23 -04:00
Guillermo del Angel a838653822 Merge branch 'master' of ssh://gsa3/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-25 10:35:58 -04:00
Guillermo del Angel 596c1723ae Hidden, unsupported ability of VariantEval to run AlleleCount stratification on sites-only VCFs. I'll expose it/add tests on it if people think this is generaly useful. User needs to specify total # of samples as command line argument since genotypes are not available.
Also, fixes to large-scale validation script: lower -minIndelFrac threshold or else we'll kill most indels since default 0.25 is too high for pools, fix also VE stratifications and add one VE run where eval=1KG, comp=pool data and AC stratification based on 1KG annotation
2012-10-25 10:35:43 -04:00
Eric Banks 6dc7d872ec Fix GenotypeAndValidate to handle SNPs and indels as reported on the forum. Recent changes to the UnifiedArgumentCollection made this stop working. Adding in JIRA to create integration tests for this tool. 2012-10-25 10:06:13 -04:00
Eric Banks c53c55da12 Re-enable tests 2012-10-25 09:37:08 -04:00
Eric Banks e6652f7777 Added integration test for contamination down-sampling 2012-10-25 09:36:05 -04:00
Eric Banks df9e0b7045 Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-25 02:49:54 -04:00
Eric Banks 72714ee43e Minor patches to get the contamination down-sampling working for indels. Adding @Hidden logging output for easy debugging. 2012-10-25 02:47:42 -04:00
Eric Banks c6b57fffda Added allele biased down-sampling capabilities to the PerReadAlleleLikelihoodMap object, which means that both the UG and HC can use this functionality. Note that it's only available in protected, so GATK-lite users won't be allowed to enable it. Needs more testing. 2012-10-24 22:52:25 -04:00
Ami Levy Moonshine bcf3582095 Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-24 21:50:41 -04:00
Eric Banks 9da7bbf689 Refactoring the PerReadAlleleLikelihoodMap in preparation for adding contntamination downsampling into protected only. 2012-10-24 15:49:07 -04:00
David Roazen d9aa9855f8 Better comments in NestedIntegerArray 2012-10-24 15:29:13 -04:00
David Roazen 02018ca764 Legacy BaseRecalibrator walker is neither TreeReducible nor NanoSchedulable
The old BaseRecalibrator walker is and never will be thread-safe, since it's a
LocusWalker that uses read attributes to track state.

ONLY the newer DelocalizedBaseRecalibrator is believed likely to be thread-safe
at this point. It is safe to run the DelocalizedBaseRecalibrator with -nct > 1
for testing purposes, but wait for further testing to be done before using it
for production purposes in multithreaded mode.
2012-10-24 15:22:50 -04:00
David Roazen 32a6d7000a Thread-safe ReadGroupCovariate
The ReadGroupCovariate class was not thread-safe. This led to horrible race conditions
in multithreaded runs of the BQSR where (for example) the same read group could get
inserted into the reverse lookup table twice with different IDs.

Should fix the intermittent crash reported in GSA-492.
2012-10-24 15:22:50 -04:00
David Roazen 991658acf4 BQSR: use more granular locking for concurrency control
-With this change, BQSR performance scales properly by thread rather
 than gaining nothing from additional threads.
-Benefits are seen when using either -nt (HierarchicalMicroScheduler) or -nct
 (NanoScheduler)
-Removes high-level locks in the recalibration engines and NestedIntegerArray
 in favor of maximally-granular locks on and around manipulation of the leaf
 nodes of the NestedIntegerArray.
-NestedIntegerArray now creates all interior nodes upfront rather than on
 the fly to avoid the need for locking during tree traversals. This uses
 more memory in the initial part of BQSR runs, but the BQSR would eventually
 converge to use this memory anyway over the course of a typical run.

IMPORTANT NOTE: This does not mean it's safe to run the old BaseRecalibrator
walker with multiple threads. The BaseRecalibrator walker is and will never be
thread-safe, as it's a LocusWalker that uses read attributes to track
state information. ONLY the newer DelocalizedBaseRecalibrator can be made
thread-safe (and will hopefully be made so in my subsequent commits). This
commit addresses performance, not correctness.
2012-10-24 15:22:50 -04:00
Eric Banks 5b7b42356b Fix bug in GenotypeAndValidate where it doesn't check vc.hasAttribute() before using vc.getAttribute(). 2012-10-24 14:02:50 -04:00
Mark DePristo 6e421a72d6 Add more exhaustive unit tests for input errors to NanoScheduler
-- Resolves issue GSA-515 / Nanoscheduler GSA-605 / Seems that -nct may deadlock as not reproducible
-- It seems that it's not an input error problem (or at least cannot be provoked with unit tests)
-- I'll keep an eye on this later
2012-10-23 20:11:29 -04:00
kshakir 8dfa24df7b Sending a version of per job status messages.
In addition to outputs, inputs are passed to QStatusMessenger.done()
CloneFunction.cloneIndex has a new CloneFunction.cloneCount companion useful for display purposes.
2012-10-23 15:55:47 -04:00
Guillermo del Angel 5fac5bf12e Fixed issues with Queue packaging of Picard QC classes: separate jar's are needed fromPicard. User needs to specify the -picardBase argument to point to input path for jars.
> Also, reenable joint cleaning as now it works.
> DEV-125 #resolve
> DEV-90 #resolve
2012-10-23 14:08:31 -04:00
kshakir 0cce1ae8b2 When gathering VCFs, using CombineVariants from the current classpath, and not the GATK used to run the command. This was a concern for external modules that bundled the engine but not CombineVariants. 2012-10-23 12:44:06 -04:00
Mauricio Carneiro c210b7cde4 Merge GATK repo into CMI-GATK
Bringing in the following relevant changes:
	* Fixes the indel realigner N-Way out null pointer exception DEV-10
	* Optimizations to ReduceReads that bring the run time to 1/3rd.

Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SlidingWindow.java

DEV-10 #resolve #time 2m
2012-10-23 10:59:11 -04:00
Mark DePristo f838815343 Updating MD5s for confidence ref site estimation in IndependentAllelesDiploidExactAFCalc
-- Included logic to only add priors for alleles with sufficient evidence to be called polymorphic.  If no alleles are poly make sure to add priors of first allele
2012-10-23 06:47:53 -04:00
Guillermo del Angel 7860ff7981 a) Resolve [#DEV-56] - test data with indels in new directory private/testdata/CMITestData/. b) Skeleton (not yet working) of fastq-BAM unit test, c) misc bug fixes for QC functions to work (not done yet) 2012-10-22 19:59:15 -04:00
Mark DePristo 15b28e61cd Retiring TraverseReads and TraverseLoci after testing confirms nano scheduler version in single threaded version is fine
-- There's been no report of problems with the nano scheduled version of TraverseLoci and TraverseReads, so I'm removing the old versions since they are no longer needed
-- Removing unnecessary intermediate base classes
-- GSA-515 / Nanoscheduler GSA-549 / https://jira.broadinstitute.org/browse/GSA-549
2012-10-22 16:55:06 -04:00
Khalid Shakir fd59e7d5f6 Better error message when generic types are erased from scala collections. 2012-10-22 16:27:31 -04:00
Ryan Poplin 008df54575 Bug fix in GATKSAMRecord.getSoftEnd() for reads that are entirely clipped. 2012-10-22 14:21:52 -04:00
Mark DePristo 90f59803fd MaxAltAlleles now defaults to 6, no more MaxAltAllelesForIndels
-- Updated StandardCallerArgumentCollection to remove MaxAltAllelesForIndels. Previous argument is deprecated with meaningful doc message for people to use maxAltAlleles
-- All constructores, factory methods, and test builders and their users updated to provide just a single argument
-- Updating MD5s for integration tests that change due to genotyping more alleles
-- Adding more alleles to genotyping results in slight changes in the QUAL value for multi-allelic loci where one or more alleles aren't polymorphic.  That's simply due to the way that alternative hypotheses contribute as reference evidence against each true allele.  The effect can be large (new qual = old qual / 2 in one case here).
-- If we want more precision in our estimates we could decide (Eric, should we discuss?) to actually separately do a discovery phase in the genotyping, eliminate all variants not considered polymorphic, and then do a final round of calling to get the exact QUAL value for only those that are segregating.  This would have the value of having the QUAL stay constant as more alleles are genotyped, at the cost of some code complexity increase and runtime.  Might be worth it through
2012-10-22 13:47:56 -04:00
Khalid Shakir 97dc3664c9 Fixed yet another NPE related to the ArgumentTypeDescriptor vs. ArgumentMatchValue. Added integration test based on GSA-621. 2012-10-22 12:05:32 -04:00
Ami Levy Moonshine 1da4ad9607 new class to test the quals of reduced bam vs non-reduced bam 2012-10-22 10:45:53 -04:00
Mark DePristo eb6c9a1a79 Disable EfficiencyMonitoringThreadFactoryUnitTest
-- This is no longer a core GATK activity, and the tests need to run for so long (2 min each) that it's just too painful to run them.  Should be re-eabled if we come to care about this capability again, or if we can run these tests all in parallel in the future.
2012-10-21 12:43:46 -04:00
Mark DePristo 5296de8251 Fix UnifiedArgumentCollection constructor logic error
-- The old way of overloading constructors and calling super didn't work (might have been a consequence of merge).  This is the right way to do the copy constructor with the call to super()
2012-10-21 12:43:46 -04:00
Mark DePristo d21e42608a Updating integration tests for minor changes due to switching to EXACT_INDEPENDENT model by default 2012-10-21 12:43:46 -04:00
Mark DePristo 6b6caf8e3a Bugfix for indel DP calculations using reduced reads
-- Adding tests for SNP and indel calling on reduced BAM
2012-10-21 12:42:32 -04:00
Mark DePristo 0fcd358ace Original EXACT model implementation lives, providing another reference (bi-allelic only) EXACT model
-- Potentially a very fast implementation (it's very clean) but restricted to the biallelic case
-- A starting point for future bi-allelic only optimized (logless) or generalized (bi-allelic general ploidy) implementations
-- Added systematic unit tests covering this implementation, and comparing it to others
-- Uncovered a nasty normalization bug in StateTracker that was capping our likelihoods at 0, even after summing up multiple likelihoods, which is just not safe to do and was causing us to lose likelihood in some cases
-- Removed the restriction that a likelihood be <= 0 in StateTracker, and the protection for these cases in GeneralPloidyExactAFCalc which just wasn't right
2012-10-21 12:42:31 -04:00
Mark DePristo 0fb8274507 Fix contact on sorting of AFCalcResults
-- The thing that must be sorted is the pre-theta^N list, which is not checked in the routine that applies the theta^N prior.
2012-10-21 12:42:31 -04:00
Mark DePristo eaffb814d3 IndependentExactAFCalc is now the default EXACT model implementation
-- Changed UG / HC to use this one via the StandardCallerArgumentCollection
-- Update the AFCalcFactory.Calculation to have a getDefault() value instead of having a duplicate entry in the enums
2012-10-21 12:42:31 -04:00
Mark DePristo 326f429270 Bugfixes to make new AFCalc system pass integrationtests
-- GeneralPloidyExactAFCalc turns -Infinity values into -Double.MAX_VALUE, so our calculations pass unit tests
-- Bugfix for GeneralPloidyGenotypeLikelihoodsCalculationModel, return a null VC when the only allele we get from our final alleles to use method is the reference base
-- Fix calculation of reference posteriors when P(AF == 0) = 0.0 and P(AF == 0) = X for some meaningful value of X.  Added unit test to ensure this behavior is correct
-- Fix horrible sorting bug in IndependentAllelesDiploidExactAFCalc that applied the theta^N priors in the wrong order.  Add contract to ensure this doesn't ever happen again
-- Bugfix in GLBasedSampleSelector, where VCs without any polymorphic alleles were being sent to the exact model
--
2012-10-21 12:42:31 -04:00
Mark DePristo 695cf83675 More docs and contracts for classes in genotyper.afcalc
-- Future protection of the output of GeneralPloidyExactAFCalc, which produces in some cases bad likelihoods (positive values)
2012-10-21 12:42:31 -04:00
Mark DePristo 99c9031cb4 Merge AFCalcResultTracker into StateTracker, cleanup
-- These two classes were really the same, and now they are actually the same!
-- Cleanuped the interfaces, removed duplicate data
-- Added lots of contracts, some of which found numerical issues with GeneralPloidyExactAFCalc (which have been patched over but not fixed)
-- Moved goodProbability and goodProbabilityVector utilities to MathUtils.  Very useful for contracts!
2012-10-21 12:42:31 -04:00
Mark DePristo 9c63cee9fc Moving pnrm to UnifiedArgumentCollection so it's available with the HaplotypeCaller 2012-10-21 12:42:31 -04:00
Eric Banks d44d5b8275 Fix RawHapMapCodec so that it can build indexes. Minor fixes to VCF codec. 2012-10-21 01:29:59 -04:00
Eric Banks 841a906f21 Adding a hidden (for now) argument to UG (and HC) that tells the caller that the incoming samples are contaminated by N% and to fix it by aggressively down-sampling all alleles. This actually works. Yes, you read that right: given that we know what N is, we can make good calls on bams that have N% contamination. Only hooked up for SNPS right now. No tests added yet. 2012-10-20 23:31:56 -04:00
Eric Banks 2c624f76c8 Refactoring the Unified (and Standard) Argument Collections because it was really ugly that the subclass had to do all the cloning for the super class. The clone() method is really not recommended best practice in Java anyways, so I changed it so that we use standard overloaded constructors. Confirmed that the Haplotype Caller --help docs do not include UG-specific arguments. 2012-10-20 20:35:54 -04:00
Ryan Poplin a647f1e076 Refactoring the PairHMM util class to allow for multiple implementations which can be specified by the callers via an enum argument. Adding an optimized PairHMM implementation which caches per-read calculations as well as a logless implementation which drastically reduces the runtime of the HMM while also increasing the precision of the result. In the HaplotypeCaller we now lexicographically sort the haplotypes to take maximal benefit of the haplotype offset optimization which only recalculates the HMM matrices after the first differing base in the haplotype. Many thanks to Mauricio for all the initial groundwork for these optimizations. The change to the one HC integration test is in the fourth decimal of HaplotypeScore. 2012-10-20 16:38:18 -04:00
Joel Thibault 45f64425a3 Update read metrics per shard rather than locus 2012-10-19 15:29:01 -04:00
Joel Thibault 637e0cf151 CountReads does not permit the use of output files 2012-10-19 15:29:01 -04:00
Khalid Shakir 2ef456d51a Added explicit @ClassType annotations to @Argument for Option[Int] or Option[Double] since scala seems to change the reflected type to Option[Object] on some systems.
Changed ReflectionUtils.getGenericTypes' order of looking for @ClassType since the primitive generic wasn't completely erased, only changed to Object which is incorrect.
More fixes to @Arguments labeled as java.io.File via incorrect @Input annotation.
Put in a default undocumented implementation of @Argument doc() to match the one added to @Input.
2012-10-19 13:20:29 -04:00
Eric Banks 9c088fe3fe Actually a better implementation of GATKSAMRecord.getSoftStart(). Last commit was all wrong. Oops. 2012-10-19 12:41:24 -04:00
Guillermo del Angel 4f768e2f58 redo QC picard parts 2012-10-19 12:25:46 -04:00
Eric Banks f08e5a44da Better implementation of GATKSAMRecord.getSoftStart() 2012-10-19 12:11:18 -04:00
Eric Banks deca564aef Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-19 12:01:49 -04:00
Khalid Shakir 403654d40a Fixed null checkes in ArgumentTypeDescriptor due to ArgumentMatchValue updates.
Fixed @Arguments such as scatter count that were labeled as java.io.File via incorrect @Input annotation.
2012-10-18 16:57:15 -04:00
Guillermo del Angel a4184716d8 Merge branch 'master' of ssh://gsa3/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-18 15:42:31 -04:00
Guillermo del Angel 3db38c5a93 Bug fix: inbreeding coeff shouldn't be computed in ref-only sites 2012-10-18 15:42:14 -04:00
Ami Levy Moonshine a0381f15af Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-18 14:49:34 -04:00
Ryan Poplin b4e69239dd In order to be considered an informative read in the PerReadAlleleLikelihoodMap it has to be informative compared to all other alleles not just the worst allele. Also, fixing a bug when there is only one allele in the map. 2012-10-18 14:31:15 -04:00
Mauricio Carneiro 3504f71b6b Fixing a null pointer exception bug for DEV-10 2012-10-18 13:58:38 -04:00
Mark DePristo d3fc797cfe SelectVariants is actually *NOT* NanoSchedulable 2012-10-18 10:42:20 -04:00
Mark DePristo f20fa9d082 SelectVariants is actually NanoSchedulable 2012-10-18 10:27:05 -04:00
Mark DePristo 97abb98c0b Bugfix for bad nt / nct argument detection in MicroScheduler 2012-10-18 10:27:05 -04:00
Eric Banks 54f698422c Better implementation for getSoftEnd() in GATKSAMRecord 2012-10-18 09:01:51 -04:00
Ami Levy Moonshine acc0fb2f7a Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-17 22:16:02 -04:00
kshakir 55ac4ba70b Added another utility that can convert to RemoteFiles.
QScripts will now generate remote versions of files if the caller has not already passed in remote versions (or the QScript replaces the passed in remote references... not good)
Instead of having yet another plugin, combined QStatusMessenger and RemoteFileConverter under general QCommandPlugin trait.
2012-10-17 20:00:03 -04:00
Mauricio Carneiro 32ee2c7dff Refactored the compression interface per sample in ReduceReadsa
The CompressionStash is now responsible for keeping track of all intervals that must be kept uncompressed by all samples. In general this is a list generated by a tumor sample that will enforce all normal samples to abide.
  - Updated ReduceReads integration tests
  - Sliding Window is now using the CompressionStash (single sample).

DEV-104 #resolve #time 3m
2012-10-17 16:40:40 -04:00
Mauricio Carneiro b57df6cac8 Bringing CMI changes into the main GATK repo.
Merge remote-tracking branch 'cmi/master'
2012-10-17 15:23:19 -04:00
Mark DePristo 8288c30e36 Use buffered output for ExactCallLogger 2012-10-17 14:15:11 -04:00
Mark DePristo c9e7a947c2 Improve interface of ExactCallLogger, use it to have a more informative AFCalcPerformanceTest 2012-10-17 14:15:11 -04:00
kshakir 0196dbeaca Added more logging to push/pull of RemoteFiles. 2012-10-17 09:52:17 -04:00
kshakir f93b279151 Moved the class field caching from QScript to a ClassFieldCache utility.
Using ClassFieldCache to pull values from QScript for passing to done() method of QStatusMessenger.
2012-10-16 18:49:31 -04:00
David Roazen b30e2a5b7d BQSR: tool to profile the effects of more-granular locking on scalability by # of threads 2012-10-16 14:43:16 -04:00
Mark DePristo 9bcefadd4e Refactor ExactCallLogger into a separate class
-- Update minor integration tests with NanoSchedule due to qual accuracy update
2012-10-16 13:30:09 -04:00
Mark DePristo c74d7061fe Added AFCalcResultUnitTest
-- Ensures that the posteriors remain within reasonable ranges.  Fixed bug where normalization of posteriors = {-1e30, 0.0} => {-100000, 0.0} which isn't good.  Now tests ensure that the normalization process preserves log10 precision where possible
-- Updated MathUtils to make this possible
2012-10-16 08:11:06 -04:00
Mark DePristo 9b0ab4e941 Cleanup IndependentAllelesDiploidExactAFCalc
-- Remove capability to truncate genotype likelihoods -- this wasn't used and isn't really useful after all
-- Added lots of contracts and docs, still more to come.
-- Created a default makeMaxLikelihoods function in ReferenceDiploidExactAFCalc and DiploidExactAFCalc so that multiple subclasses don't just do the default thing
-- Generalized reference bi-allelic model in IndependentAllelesDiploidExactAFCalc so that in principle any bi-allelic reference model can be used.
2012-10-16 08:11:06 -04:00
Mark DePristo 6bd0ec8de4 Proper likelihoods and posterior probability of the joint allele frequency in IndependentAllelesDiploidExactAFCalc
-- Fixed minor numerical stability issue in AFCalcResult
-- posterior of joint A/B/C is 1 - (1 - P(D | AF_b == 0)) x (1 - P(D | AF_c == 0)), for any number of alleles, obviously.  Now computes the joint posterior like this, and then back-calculates likelihoods that generate these posteriors given the priors.  It's not pretty but it's the best thing to do
2012-10-16 08:11:06 -04:00
Mark DePristo d1511e38ad Removing ConstrainedAFCalculationModel; AFCalcPerformanceTest
-- Superceded by IndependentAFCalc
-- Added support to read in an ExactModelLog in AFCalcPerformanceTest and run the independent alleles model on it.
-- A few misc. bug fixes discovered during running the performance test
2012-10-16 08:11:06 -04:00
kshakir 9fcf71c031 Updated google reflections due to stale slf4j version conflicting with other projects also trying to use Queue as a component.
Added targets to build.xml to effectively 'mvn install' packaged GATK/Queue from ant.
TODO: Versions during 'mvn install' are hardcoded at 0.0.1 until a better versioning scheme that works with maven dependencies has been identified.
2012-10-16 02:22:30 -04:00
Ryan Poplin 31be807664 Updating missed integration test. 2012-10-15 22:31:52 -04:00
Ryan Poplin d27ae67bb6 Updating the multi-step UG integration test. 2012-10-15 22:30:01 -04:00
kshakir c4ee31075c Fixed package error and a few deprecated scala warnings. 2012-10-15 15:29:40 -04:00
kshakir 213cc00abe Refactored argument matching to support other plugins in addition to file lists.
Added plugin support for sending Queue status messages.
Argument parsing can store subclasses of java.io.File, for example RemoteFile.
2012-10-15 15:10:45 -04:00
Mauricio Carneiro 80d92e0c63 Allowing the GATK to have non-required outputs
Modified the SAMFileWriterArgumentTypeDescriptor to accept output bam files that are null if they're not required (in the @Output annotation).

This change enables the nWayOut parameter for the IndeRealigner and ReduceReads to operate optionally while maintaining the original single way out.

[#DEV-10 transition:31 resolution:1]
2012-10-15 13:49:08 -04:00
Kristian Cibulskis dad7ca281e upgraded mutation caller with VCF output
raw indel calls (non filtered,non vcf)
2012-10-15 13:49:08 -04:00
Guillermo del Angel 22b79fb4dd Resolve [DEV-7]: add single-sample VCF calling at end of FASTQ-BAM pipeline. Initial steps of [DEV-4]: queue extensions for Picard QC metrics 2012-10-15 13:49:08 -04:00
Kristian Cibulskis 658f355171 initial cancer pipeline with mutations and partial indel support 2012-10-15 13:49:07 -04:00
Mauricio Carneiro 322ea1262c First implementation of a generic 'bundled' Data Processing Pipeline for germline and cancer.
not ready for prime time yet!
2012-10-15 13:49:06 -04:00
Mauricio Carneiro f1fb51b222 Reverting the DPP to the original version, going to create a new simplified version for CMI in private. 2012-10-15 13:49:06 -04:00
Mauricio Carneiro 429c96e723 Generic input file name recognition (still need to implement support to FastQ, but it now can at least accept it) 2012-10-15 13:49:06 -04:00
Ryan Poplin 25be94fbb8 Increasing the precision of MathUtils.approximateLog10SumLog10 from 1E-3 to 1E-4. Genotyper integration tests change as a result. Expanding the unit tests of MathUtils.log10sumLog10. 2012-10-15 13:24:32 -04:00
Ami Levy Moonshine 0d93effa4d Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-15 11:19:12 -04:00
Mark DePristo 57e231610b New framework for EXACT calculations, with new 3 new implementations
-- Before this branch, the EXACT calculation implementation was largely based on historical choices in the UnifiedGenotyper.  The code was badly organized, there were no unit tests, and the Diploid EXACT calculation was super slow O(n.samples ^ n.alt.alleles)
-- Reorganized code into a single class AFCalc superclass that carries out the calculation and an AFCalcResult object that contains only the information we should expose to code users, and is well-validated.
-- Implement a new model for the multi-allelic exact calculation that sweeps for each alt allele B all likelihoods into a bi-allelic model XB where X is all alleles != B, and calls these all separately using the reference bi-allelic model.  It produces identical quals for the bi-allelic case but slightly different results for multi-allelics due to a genuine model difference in that this Independent model doesn't penalize fully all genotype configurations as occurs in the Reference multi-allelic implementation.  However, it seems after much debate that the reference model is doing the wrong thing, so in fact the Independent model seems correct.  This code isn't the default implementation yet, simply because I want to do some cleanup and discuss with the methods group before enabling.
-- Constrained search model implemented, but will be deleted in a subsequent code cleanup
-- Massive (40K) suite of unit tests the exact models, which are passing for the reference and the independent alleles exact model.
-- Restored -- but isn't 100% hooked up -- the original clean bi-allelic model for Ryan to pass his optimized logless version on.
-- The only way to create these AFCalc objects is through an AFCalcFactory, which again validates its arguments.  The AFCalcFactory.Calculation enum exposes calculations to the UG / HC as the AFModel.
-- Separated AFCalc from UG, into its own package that could in principle be pushed into utils now
-- Created a simple main[] function to run performance tests of the EXACT model.
2012-10-15 08:32:32 -04:00
Mark DePristo dcf8af42a8 Finalizing IndependentAllelesDiploidExactAFCalc
-- Updating integration tests, confirming that results for the original EXACT model are as expected given our new more rigorous application of likelihoods, priors, and posteriors
-- Fix basic logic bug in AFCalcResult.isPolymorphic and UnifiedGenotypeEngine, where isNonRef really meant isRef.  Not ideal.  Finally caught by some tests, but good god it almost made it into the code
-- Now takes the Math.abs of the phred-scaled confidence so that we don't see -0.0
-- Massive new suite of unit tests to ensure that bi-allelic and tri-allele events are called properly with all models, and that the IndependentAllelesDiploidExactAFCalc calls events with up to 4 alt alleles correctly.  ID'd some of the bugs below
-- Fix sort order bug in IndependentAllelesDiploidExactAFCalc caught by new unit tests
-- Fix bug in GeneralPloidyExactAFCalc where the AFCalcResult has meaningless values in the likelihoods when no there we no informative GLs.
2012-10-15 08:21:03 -04:00
Mark DePristo 1ac09ca81e More bugfixes on the way to a final push with new Exact model framework
-- UnifiedGenotyperEngine uses only the alleles used in genotyping, not the original alleles, when considering which alleles to include in output
-- AFCalcFactory has a more informative info message when looking for and selecting an exact model to use in genotyping
2012-10-15 07:53:57 -04:00
Mark DePristo 6b639f51f0 Finalizing new exact model and tests
-- New capabilities in IndependentAllelesDiploidExactAFCalc to actually apply correct theta^n.alt.allele prior.
-- Tests that theta^n.alt.alleles is being applied correctly
-- Bugfix: keep in logspace when computing posterior probability in toAFCalcResult in AFCalcResultTracker.java
-- Bugfix: use only the alleles used in genotyping when assessing if an allele is polymorphic in a sample in UnifiedGenotyperEngine
2012-10-15 07:53:57 -04:00
Mark DePristo cb857d1640 AFCalcs must be made by factory method now
-- AFCalcFactory is the only way to make AFCalcs now.  There's a nice ordered enum there describing the models and their ploidy and max alt allele restrictions.  The factory makes it easy to create them, and to find models that work for you given your ploidy and max alt alleles.
-- AFCalc no longer has UAC constructor -- only AFCalcFactory does.  Code cleanup throughout
-- Enabling more unit tests, all of which almost pass now (except for IndependentAllelesDiploidExactAFCalc which will be fixed next)
-- It's now possible to run the UG / HC with any of the exact models currently in the system.
-- Code cleanup throughout the system, reorganizing the unit tests in particular
2012-10-15 07:53:56 -04:00
Mark DePristo 6bbe750e03 Continuing work on IndependentAllelesDiploidExactAFCalc
-- Continuing to get IndependentAllelesDiploidExactAFCalc working correctly.  A long way towards the right answer now, but still not there
-- Restored (but not tested) OriginalDiploidExactAFCalc, the clean diploid O(N) version for Ryan
-- MathUtils.normalizeFromLog10 no longer returns -Infinity when kept in log space, enforces the min log10 value there
-- New convenience method in VariantContext that looks up the allele index in the alleles
2012-10-15 07:53:56 -04:00
Mark DePristo 176b74095d Intermediate commit on the path to getting a working IndependentAllelesDiploidExact calculation
-- Still not work, but I know what's wrong
-- Many tests disabled, that need to be reanabled
2012-10-15 07:53:56 -04:00
Mark DePristo 91aeddeb5a Steps on the way to a fully described and semantically meaningful AFCalcResult
-- AFCalcResult now sports a isPolymorphic and getLog10PosteriorAFGt0ForAllele functions that allow you to ask individually whether specific alleles we've tried to genotype are polymorphic given some confidence threshold
-- Lots of contracts for AFCalcResult
-- Slowly killing off AFCalcResultsTracker
-- Fix for the way UG checks for alt alleles being polymorphic, which is now properly conditioned on the alt allele
-- Change in behavior for normalizeFromLog10 in MathUtils: now sets the log10 for 0 values to -10000, instead of -Infinity, since this is really better to ensure that we don't have -Infinity values traveling around the system
-- ExactAFCalculationModelUnitTest now checks for meaningful pNonRef values for each allele, uncovering a bug in the GeneralPloidy (not fixed, related to Eric's summation issue from long ago that was reverted) in that we get different results for diploid and general-ploidy == 2 models for multi-allelics.
2012-10-15 07:53:56 -04:00
Mark DePristo 4f1b1c4228 Intermediate commit II on simplifying AFCalcResult
-- All of the code now uses the AFCalc object, not the not package protected AFCalcResultTracker.  Nearly all unit tests pass (expect for a contract failing one that will be dealt with in subsequent commit), due to -Infinity values from normalizeLog10.
-- Changed the way that UnifiedGenotyper decides if the best model is non-ref.  Previously looked at the MAP AC, but the MAP AC values are no longer provided by AFCalcResult.  This is on purpose, because the MAP isn't a meaningful quantity for the exact model (i.e., everything is going to go to MLE AC in some upcoming commit).  If you want to understand why come talk to me.  Now uses the isPolymorphic function and the EMIT confidence, so that if pNonRef > EMIT then the site is poly, otherwise it's mono.
2012-10-15 07:53:56 -04:00
Mark DePristo 06687bfaf6 Intermediate commit on simplifying AFCalcResult
-- Renamed old class AFCalcResultTracker.  This object is now allocated by the AFCalc itself, since it is heavy-weight and was badly optimized in the UG with a thread-local variable. Now, since there's already a AFCalc thread-local there, we get that optimization for free.
-- Removed the interface to provide the AFCalcResultTracker to getlog10PNonRef.
-- Wrote new, clean but unused AFCalcResult object that will soon replace the tracker as the external interface to the AFCalc model results, leaving the tracker as an internal tracker structure.  This will allow me to (1) finally test things exhaustively, as the contracts on this class are clear (2) finalize the IndependentAllelesDiploidExactAFCalc class as it can work with a meaningfully defined result across each object
2012-10-15 07:53:56 -04:00
Mark DePristo c82aa01e0e Generalize testing infrastructure to allow us to run specific n.samples calculation 2012-10-15 07:53:55 -04:00
Mark DePristo ec935f76f6 Initial implementation and tests for IndependentAllelesDiploidExactAFCalc
-- This model separates each of N alt alleles, combines the genotype likelihoods into the X/X, X/N_i, and N_i/N_i biallelic case, and runs the exact model on each independently to handle the multi-allelic case.  This is very fast, scaling at O(n.alt.alleles x n.samples)
-- Many outstanding TODOs in order to truly pass unit tests
-- Added proper unit tests for the pNonRef calculation, which all of the models pass
2012-10-15 07:53:55 -04:00
Mark DePristo ee2f12e2ac Simpler naming convention for AlleleFrequencyCalculation => AFCalc 2012-10-15 07:53:55 -04:00
Mark DePristo cf3f9d6ee8 Reorganize and cleanup AFCalculations
-- Now contained in a package called afcalc
-- Extracted standard alone classes from private static classes in ExactAF
-- Most fields are now private, with accessors
-- Overall cleaner organization now
2012-10-15 07:53:55 -04:00
Mark DePristo 13211231c7 Restructure and cleanup ExactAFCalculations
-- Now there's no duplication between exact old and constrained models.  The behavior is controlled by an overloaded abstract function
-- No more static function to access the linear exact model -- you have to create the surrounding class.  Updated code in the system
-- Everything passes unit tests
2012-10-15 07:53:54 -04:00
Mark DePristo f800f3fb88 Optimized diploid exact AF calculation uses maxACs to stop the calculation by maxAC by allele
-- Added unit tests to ensure the approximation isn't so far from our reference implementation (DiploidExactAFCalculation)
2012-10-15 07:53:54 -04:00
Mark DePristo efad215edb Greedy version of function to compute the max achievable AC for each alt allele
-- walks over the genotypes in VC, and computes for each alt allele the maximum AC we need to consider in that alt allele dimension.  Does the calculation based on the PLs in each genotype g, choosing to update the max AC for the alt alleles corresponding to that PL.  Only takes the first lowest PL, if there are multiple genotype configurations with the same PL value.  It takes values in the order of the alt alleles.
2012-10-15 07:53:54 -04:00
Mark DePristo 7666a58773 Function to compute the max achievable AC for each alt allele
-- Additional minor cleanup of ExactAFCalculation
2012-10-15 07:53:53 -04:00
Eric Banks a8efa5451a Protect against bad bases users have screwy data (or try to use zipped references) 2012-10-12 15:05:03 -04:00
Eric Banks 81532a0529 Missing file are user errors. 2012-10-12 09:48:12 -04:00
Eric Banks fa77a83783 Update the out of space error to include another permutation 2012-10-12 09:38:12 -04:00
Eric Banks 85525d9e6e Make Geraldine's life easier: from now on we treat problems where a temp file cannot be found when running the GATK with multiple threads as User Errors (since they are 99.9% of the time). This is an extremely large class of errors in Tableau and on the forums. Helpful error message tells users exactly what we tell them on the forums anyways (Geraldine: feel free to edit). 2012-10-12 09:19:50 -04:00
Eric Banks ad60300bee Catch malformed BAM files at the source since this is the largest class of errors in Tableau. 2012-10-12 09:07:57 -04:00
Eric Banks 593c8065d9 Fix docs for BadMateFilter 2012-10-12 08:35:45 -04:00
Christopher Hartl 6b9987cf1b Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2012-10-12 00:48:42 -04:00
David Roazen 3861212dab Fix inefficiency in FilePointer GenomeLoc validation
Validation of GenomeLocs in the FilePointer class was extremely inefficient
when the GenomeLocs were added one at a time rather than all at once.

Appears to mostly fix GSA-604
2012-10-11 19:55:14 -04:00
Ami Levy Moonshine ef3882f439 PhaseByTransmission: small typo /n. variantCallQC_summaryTablesOnly.R: small changes (more to come) /n GeneralCallingPipeline.scala: the new pipeline script. It is not as clean as I want it to be, but it works. I still going to work on it a little bit more. Also, it does not include yet: (1) the RR step (2) need better eval step (3) need to include other targets (currently it eork on the CEU Trio) 2012-10-11 14:51:41 -04:00
Ryan Poplin 08b8ce6903 Fixing merge conflicts related to the comment formatting in the BQSR. 2012-10-10 16:03:58 -04:00
Ryan Poplin 45717349dc Fixing BQSR bug reported on the forum for reads that begin with insertions. 2012-10-10 16:01:37 -04:00
Ryan Poplin 15b405d458 Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-10 10:47:40 -04:00
Ryan Poplin 2a9ee89c19 Turning on allele trimming for the haplotype caller. 2012-10-10 10:47:26 -04:00
Khalid Shakir f66284658d RetryMemoryLimit now works with Scatter/Gather. 2012-10-09 21:51:03 -04:00
Johan Dahlberg e9b9e2318c Fixed SortSam bug, for .done file
The *.bai.done file for the .bai file was written in the run directory instead of in the specified output directory.
Changing getName() to getAbsolutePath() fixes this.

Signed-off-by: Joel Thibault <thibault@broadinstitute.org>
2012-10-09 16:25:18 -04:00
Ryan Poplin b543bddbb7 Fixing merge conflicts related to the comment formatting in the BQSR. 2012-10-08 10:23:08 -04:00
Ryan Poplin b3cc04976f Fixing BQSR bug reported on the forum for reads that being with insertions. 2012-10-08 10:18:29 -04:00
Eric Banks 36a26a7da6 md5s failed because I forgot to add --no_cmdline_in_header so it is different depending on where you run from. Fixed. 2012-10-07 08:35:55 -04:00
Eric Banks a5aaa14aaa Fix for GSA-601: Indels dropped during liftover. This was a true bug that was an effect of the switch over to the non-null representation of alleles in the VariantContext. Unfortunately, this tool didn't have integration tests - but it does now. 2012-10-07 01:19:52 -04:00
Eric Banks 82e40340c0 Use StringBuilder over StringBuffer 2012-10-07 00:02:15 -04:00
Eric Banks 5d6aad67e2 Fix for bug reported on forums: VariantsToTable does not handle lists and nested arrays correctly. Added an integration test to cover printing of PLs. 2012-10-07 00:01:27 -04:00
Eric Banks e7798ddd2a Fix for JIRA GSA-598: AD field not handled properly by CombineVariants. It was also not handled by SelectVariants either. We now strip the AD field out whenever combining/selecting makes it invalid due to a changing of the number of ALT alleles. 2012-10-06 23:02:36 -04:00
Eric Banks bfc551f612 Fix for GSA-589: SelectVariants with -number gives biased results. The implementation was not good and it's not worth keeping this busted code around given that we have a working implementation of a fractional random sampling already in place, so I removed it. 2012-10-06 22:39:49 -04:00
Eric Banks e8a6460a33 After merging with Yossi's fix I can confirm that the AD is fixed when going through the HC too. Added similar fixes to DP and FS annotations too. 2012-10-05 16:37:42 -04:00
Eric Banks 52326942cf Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-05 16:15:07 -04:00
Eric Banks 04853252a0 Possible fix for reduced reads coming from the HaplotypeCaller in the AD 2012-10-05 16:15:04 -04:00
Yossi Farjoun d419a33ed1 * Added an integration test for AD annotation in the Haplotype caller.
* Corrected FS Anotation for UG as for AD.
* HC still does not annotate ReducedReads correctly (for FS nor AD)
2012-10-05 15:23:59 -04:00
Yossi Farjoun dc4dcb4140 fixed AD annotation for a ReducedReads BAM file. Added an integration test for this case with a new reduced BAM in private/testdata 2012-10-05 14:20:07 -04:00
Eric Banks c66ef17cd0 Add a separate max alt alleles argument for indels that defaults to 2 instead of 3. PLEASE TAKE NOTE. 2012-10-04 13:52:14 -04:00
Mark DePristo b6e20e083a Copied DiploidExactAFCalc to placeholder OptimizedDiploidExact
-- Will be removed.  Only commiting now to fix public -> private dependency
2012-10-03 20:16:38 -07:00
Mark DePristo 51cafa73e6 Removing public -> private dependency 2012-10-03 20:05:03 -07:00
Mark DePristo f6a2ca6e7f Fixes / TODOs for meaningful results with AFCalculationResult
-- Right now the state of the AFCaclulationResult can be corrupt (ie, log10 likelihoods can be -Infinity).  Forced me to disable reasonable contracts.  Needs to be thought through
-- exactCallsLog should be optional
-- Update UG integration tests as the calculation of the normalized posteriors is done in a marginally different way so the output is rounded slightly differently.
2012-10-03 19:55:12 -07:00
Mark DePristo 50e4a832ea Generalize framework for evaluating the performance and scaling of the ExactAF models to tri-allelic variants
-- Wow, big performance problems with multi-allelic exact model!
2012-10-03 19:55:11 -07:00
Mark DePristo 3663fe1555 Framework for evaluating the performance and scaling of the ExactAF models 2012-10-03 19:55:11 -07:00
Mark DePristo 17ca543937 More ExactModel cleanup
-- UnifiedGenotyperEngine no longer keeps a thread local double[2] array for the normalized posteriors array.  This is way heavy-weight compared to just making the array each time.
-- Added getNormalizedPosteriorOfAFGTZero and getNormalizedPosteriorOfAFzero to AFResult object.  That's the place it should really live
-- Add tests for priors, uncovering bugs in the contracts of the tri-allelic priors w.r.t. the AC of the MAP.  Added TODOs
2012-10-03 19:55:11 -07:00
Mark DePristo f8ef4332de Count the number of evaluations in AFResult; expand unit tests
-- AFResult now tracks the number of evaluations (turns through the model calculation) so we can now compute the scaling of exact model itself as a function of n samples
-- Added unittests for priors (flat and human)
-- Discovered nasty general ploidy bug (enabled with Guillermo_FIXME)
2012-10-03 19:55:11 -07:00
Mark DePristo 33c7841c4d Add tests for non-informative samples in ExactAFCalculationModel 2012-10-03 19:55:11 -07:00
Mark DePristo de941ddbbe Cleanup Exact model, better unit tests
-- Added combinatorial unit tests for both Diploid and General (in diploid-case) for 2 and 3 alleles in all combinations of sample types (i.e., AA, AB, BB and equiv. for tri-allelic).  More assert statements to ensure quality of the result.
-- Added docs (DOCUMENT YOUR CODE!) to AlleleFrequencyCalculationResult, with proper input error handling and contracts.  Made mutation functions all protected
-- No longer need to call reset on your AlleleFrequencyCalculationResult -- it'd done for you in the calculation function.  reset is a protected method now, so it's all cleaner and nicer this way
-- TODO still -- need to add edge-case tests for non-informative samples (0,0,0), for the impact of priors, and I need to add some way to test the result of the pNonRef
2012-10-03 19:55:11 -07:00
Mark DePristo 3e01a76590 Clean up AlleleFrequencyCalculation classes
-- Added a true base class that only does truly common tasks (like manage call logging)
   -- This base class provides the only public method (getLog10PNonRef) and calls into a protected compute function that's abstract
   -- Split ExactAF into superclass ExactAF with common data structures and two subclasses: DiploidExact and GeneralPloidyExact
   -- Added an abstract reduceScope function that manages the simplification of the input VariantContext in the case where there are too many alleles or other constraints require us to only attempt a smaller computation
   -- All unit tests pass
2012-10-03 19:55:11 -07:00
Mark DePristo 1c52db4cdd Add exactCallsLog output file to ExactModel and StandardCallerArgumentCollection
-- This allows us to log all of the information about the exact model call (alleles, priors, PLs, result, and runtime) to a file for later debugging / optimization
2012-10-03 19:55:11 -07:00
Christopher Hartl ca31ddf2a5 Allow VCFs without PLs to be converted to a bed file with genotypes other than no-call (by setting the minimum GQ to <=0). Performance enhancements to GRM suite. 2012-10-03 21:36:35 -04:00
Christopher Hartl 1be8a88909 Changes:
1) GATKArgumentCollection has a command to turn off randomization if setting the seed isn't enough. Right now it's only hooked into RankSumTest.
 2) RankSumTest now can be passed a boolean telling it whether to use a dithering or non-randomizing comparator. Unit tested.
 3) VariantsToBinaryPed can now output in both individual-major and SNP-major mode. Integration test.
 4) Updates to PlinkBed-handling python scripts and utilities.
 5) Tool for calculating (LD-corrected) GRMs put under version control. This is analysis for T2D, but I don't want to lose it should something happen to my computer.
2012-10-03 16:02:42 -04:00
David Roazen 118e974731 GATK Engine: special-case "monolithic" FilePointers, and allow them to represent multiple contigs
Sometimes the GATK engine creates a single monolithic FilePointer representing all regions
in all BAM files. In such cases, the monolithic FilePointer is the only FilePointer emitted
by the BAMScheduler, and it's safe to allow it to contain regions and intervals from multiple
contigs.

This fixes support for reading unindexed BAM files (since an unindexed BAM is one case
in which the engine creates a monolithic FilePointer).
2012-10-02 15:30:03 -04:00
David Roazen a96ed385df ReadShard.getReadsSpan(): handle case where shard contains only unmapped mates
Nasty, nasty bug -- if we were extremely unlucky with shard boundaries, we might
end up with a shard containing only unmapped mates of mapped reads. In this case,
ReadShard.getReadsSpan() would not behave correctly, since the shard as a whole would
be marked "mapped" (since it refers to mapped intervals) yet consist only of unmapped
mates of mapped reads located within those intervals.
2012-10-02 13:50:00 -04:00
Mauricio Carneiro 9a8f53e76c Probably the GATK's most seen typo in the world 2012-10-02 13:34:37 -04:00
David Roazen ac87ed47bb BQSR: allow logging recal table updates to a file
For testing/debugging purposes only
2012-10-01 14:18:34 -04:00
Christopher Hartl 2508b0f5a7 Merged bug fix from Stable into Unstable 2012-09-29 00:57:43 -04:00
Christopher Hartl 365f1d2429 hmk123's error on the forum came from the reference context occasionally lacking bases needed for validating the reference bases in the variant context. (no @Window for VariantsToBinaryPed). This bugfix adresses this and other minor items:
1) ValidateVariants removed in favor of direct validation VariantContexts. Integration test added to test broken contexts.
 2) Enabling indel and SV output. Still bi-allelic sites only. Integration tests added for these cases.
 3) Found a bug where GQ recalculation (if a genotype has PLs but no GQ) would only happen for flipped encoding. Fixed. Integration test added.
2012-09-29 00:55:31 -04:00
David Roazen e740977994 GATK Engine: do not merge FilePointers that span multiple contigs
This affects both the non-experimental and experimental engine paths, and so
may break tests, but this is a necessary change.
2012-09-27 18:02:25 -04:00
David Roazen e82946e5c9 ExperimentalReadShardBalancer: create one monolithic FilePointer per contig
Merge all FilePointers for each contig into a single, merged, optimized FilePointer
representing all regions to visit in all BAM files for a given contig.

This helps us in several ways:

-It allows us to create a single, persistent set of iterators for each contig,
 finally and definitively eliminating all Shard/FilePointer boundary issues for
 the new experimental ReadWalker downsampling

-We no longer need to track low-level file positions in the sharding system (which
 was no longer possible anyway given the new experimental downsampling system)

-We no longer revisit BAM file chunks that we've visited in the past -- all BAM
 file access is purely sequential

-We no longer need to constantly recreate our full chain of read iterators

There are also potential dangers:

-We hold more BAM index data in memory at once. Given that we merge and optimize
 the index data during the merge, and only hold one contig's worth of data at a
 time, this does not appear to be a major issue. TODO: confirm this!

-With a huge number of samples and intervals, the FilePointer merge operation
 might become expensive. With the latest implementation, this does not
 appear to be an issue even with a huge number of intervals (for one sample, at least),
 but if it turns out to be a problem for > 1 sample there are things we can do.

Still TODO: unit tests for the new FilePointer.union() method
2012-09-27 14:47:54 -04:00
Christopher Hartl 55cdf4f9b7 Commit changes in Variants To Binary Ped to the stable repository to be available prior to next release. 2012-09-27 00:13:32 -04:00
Eric Banks caa431c367 Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-09-24 21:46:36 -04:00
David Roazen 3f44b3e019 Update DataProcessingPipelineTest MD5s 2012-09-24 15:38:07 -04:00
David Roazen 0b488cce66 ExperimentalReadShardBalancer: close() exhausted iterators
Fixes a truly awful SAMReaders resource leak reported by Eric -- thanks Eric!
2012-09-24 14:52:59 -04:00
Mark DePristo 9fd30d6f1c When writing the initial commit for nt + nct I realized this class was really just a ThreadGroupOutputTracker
-- The code is cleaner and the logical more obvious now.
2012-09-24 14:15:36 -04:00
Mark DePristo 3e8d992828 Remove bad error test from MicroScheduler, as it's no longer applicable. 2012-09-24 14:15:36 -04:00
Mark DePristo a6b3497eac Fixes GSA-515 Nanoscheduler GSA-577 -nt and -nct together appear to not close resources properly
-- Fixes monster bug in the way that traversal engines interacted with the NanoScheduler via the output tracker.
-- ThreadLocalOutputTracker is now a ThreadBasedOutputTracker that associates via a map from a master thread -> the storage map.  Lookups occur by walking through threads in the same thread group, not just the thread itself (TBD -- should have a map from ThreadGroup instead)
-- Removed unnecessary debug statement in GenomeLocParser
-- nt and nct officially work together now
2012-09-24 14:15:35 -04:00
Mark DePristo 4749fc114f Temp. disable -nt > 1 and -nct > 1 while bugs are worked out 2012-09-24 14:15:35 -04:00
Mark DePristo 09bbd2c4c3 Include exception in VCFWriter when one is found when rethrowing as ReviewedStingException 2012-09-24 14:15:35 -04:00
Mark DePristo 10a6b57be6 Fix thread name: should be master executor not input 2012-09-24 14:15:35 -04:00
Eric Banks 9464dfdbf2 Don't penalize the reduced reads for spanning deletions (when surrounding base quals are Q2s) 2012-09-24 14:06:07 -04:00
Eric Banks 1509153b4b Adding my little walker to assess reduced bam coverage against the original bam because it's turning out to be very useful. 2012-09-23 00:47:40 -04:00
Eric Banks 74bb4e2739 Fixing the VariantContextUtilsUnitTest 2012-09-22 23:24:55 -04:00
Eric Banks 25e3ea879a Oops, missed this test before when updating md5s 2012-09-22 22:16:35 -04:00
David Roazen f6a22e5f50 ExperimentalReadShardBalancerUnitTest was being skipped; fixed
TestNG skips tests when an exception occurs in a data provider,
which is what was happening here.

This was due to an AWFUL AWFUL use of a non-final static for
ReadShard.MAX_READS. This is fine if you assume only one instance
of SAMDataSource, but with multiple tests creating multiple SAMDataSources,
and each one overwriting ReadShard.MAX_READS, you have a recipe for
problems. As a result of this the test ran fine individually, but not as
part of the unit test suite.

Quick fix for now to get the tests running -- this "mutable static"
interface should really be refactored away though, when I have time.
2012-09-22 01:56:39 -04:00
David Roazen e077347cc2 Re-allow running the GATK with experimental downsampling
It's now possible to run with experimental downsampling enabled
using the --enable_experimental_downsampling engine argument.

This is scheduled to become the GATK-wide default next week after
diff engine output for failing tests has been examined.
2012-09-21 23:20:46 -04:00
David Roazen 34eed20aa6 PerSampleDownsamplingReadsIterator: fix for incorrect use of DOWNSAMPLER_POSITIONAL_UPDATE_INTERVAL
Notify all downsamplers in our pool of the current global genomic position every
DOWNSAMPLER_POSITIONAL_UPDATE_INTERVAL position changes, not every single
positional change after that threshold is first reached.
2012-09-21 22:43:39 -04:00
David Roazen 133085469f Experimental, downsampler-friendly read shard balancer
-Only used when experimental downsampling is enabled

-Persists read iterators across shards, creating a new set only when we've exhausted
the current BAM file region(s). This prevents the engine from revisiting regions discarded
by the downsamplers / filters, as could happen in the old implementation.

-SAMDataSource no longer tracks low-level file positions in experimental mode. Can strip
out all related code when the engine fork is collapsed.

-Defensive implementation that assumes BAM file regions coming out of the BAM Schedule
can overlap; should be able to improve performance if we can prove they cannot possibly
overlap.

-Tests a bit on the extreme side (~8 minute runtime) for now; will scale these back
once confidence in the code is gained
2012-09-21 22:17:58 -04:00
Guillermo del Angel ab8fa8f359 Bug fix: AlleleCount stratification in VariantEval didn't support higher ploidy and was producing bad tables 2012-09-21 20:48:12 -04:00
Mark DePristo 5d758bf97f Better run a shorter test -- should take 3 minutes total 2012-09-20 18:54:14 -04:00
Mark DePristo b5fa848255 Fix GSA-515 Nanoscheduler GSA-573 -nt and -nct interact badly w.r.t. output
-- See https://jira.broadinstitute.org/browse/GSA-573
-- Uses InheritedThreadLocal storage so that children threads created by the NanoScheduler see the parent stubs in the main thread.
-- Added explicit integration test that checks that -nt 1, 2 and -nct 1, 2 give the same results for GLM BOTH with the UG over 1 MB.
2012-09-20 18:45:16 -04:00