Commit Graph

1340 Commits (948b2fca20b25febe2aafcbd98db394392bea72b)

Author SHA1 Message Date
David Roazen 31827022db Fix pipeline tests that were not respecting the pipeline test dry run setting
There are a few pipeline test classes that do not run Queue, but are
classified as pipeline tests because they submit farm jobs. Make these
unconventional pipeline tests respect the pipeline test dry run setting.
2013-06-28 15:27:17 -04:00
Mark DePristo fdfe4e41d5 Better GATK version and command line output
-- Previous version emitted command lines that look like:

##HaplotypeCaller="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] ..."

the new version provides additional information on when the GATK was run and the GATK version in a nicer format:

 ##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] read_buffer_size=null phone_home=AWS ...">

 -- Additionally, the command line options are emitted sequentially in the file, so you can see a running record of how a VCF was produced, such as this example from the integration test:

 ##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="lots of stuff">
 ##GATKCommandLine=<ID=SelectVariants,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:16:23 EDT 2013",Epoch=1371741383277,CommandLineOptions="lots of stuff">

 -- Removed the ProtectedEngineFeaturesIntegrationTest
 -- Actual unit tests for these features!
2013-06-20 11:19:13 -04:00
Mark DePristo 0672ac5032 Fix public / protected dependency 2013-06-19 19:42:09 -04:00
David Roazen 51ec5404d4 SAMDataSource: always consolidate cigar strings into canonical form
-Collapses zero-length and repeated cigar elements, neither of which
 can necessarily be handled correctly by downstream code (like LIBS).

-Consolidation is done before read filters, because not all read filters
 behave correctly with non-consoliated cigars.

-Examined other uses of consolidateCigar() throughout the GATK, and
 found them to not be redundant with the new engine-level consolidation
 (they're all on artificially-created cigars in the HaplotypeCaller
 and SmithWaterman classes)

-Improved comments in SAMDataSource.applyDecoratingIterators()

-Updated MD5s; differences were examined and found to be innocuous

-Two tests: -Unit test for ReadFormattingIterator
            -Integration test for correct handling of zero-length
             cigar elements by the GATK engine as a whole
2013-06-19 13:29:01 -04:00
Mark DePristo 7b22467148 Bugfix: defaultBaseQualities actually works now
-- It was being applied in the wrong order (after the first call to the underlying MalformedReadFilter) so if your first read was malformed you'd blow up there instead of being fixed properly.  Added integration tests to ensure this continues to work.
-- [delivers #49538319]
2013-06-17 14:37:27 -04:00
Mark DePristo b69d210255 Bugfix: allow gzip VCF output in multi-threaded GATK output
-- VariantContextWriterStorage was gzipping the intermediate files that would be merged in, but the mergeInto function couldn't read those outputs, and we'd throw a very strange error. Now tmp. VCFs aren't compressed, even if the final VCF is.  Added integrationtest to ensure this behavior works going forward.
-- [delivers #47399279]
2013-06-17 12:39:18 -04:00
David Roazen d167292688 Reduce number of leftover temp files in GATK runs
-WalkerTest now deletes *.idx files on exit

-ArtificialBAMBuilder now deletes *.bai files on exit

-VariantsToBinaryPed walker now deletes its temp files on exit
2013-06-14 15:56:03 -04:00
Ryan Poplin c4e508a71f Merge pull request #275 from broadinstitute/md_fragment_with_pcr
Improvements to HaplotypeCaller and NA12878 KB
2013-06-14 09:32:26 -07:00
Mark DePristo 74f311c973 Emit the GATK version number in the VCF header
-- Looks like ##GATKVersion=2.5-159-g3f91d93 in the VCF header line
-- delivers [#51595305]
2013-06-13 15:46:16 -04:00
Mark DePristo 6232db3157 Remove STANDARD option from GATKRunReport
-- AWS is now the default.  Removed old code the referred to the STANDARD type.  Deleted unused variables and functions.
2013-06-13 15:18:28 -04:00
Mark DePristo dd5674b3b8 Add genotyping accuracy assessment to AssessNA12878
-- Now table looks like:

Name     VariantType  AssessmentType           Count
variant  SNPS         TRUE_POSITIVE              1220
variant  SNPS         FALSE_POSITIVE                0
variant  SNPS         FALSE_NEGATIVE                1
variant  SNPS         TRUE_NEGATIVE               150
variant  SNPS         CALLED_NOT_IN_DB_AT_ALL       0
variant  SNPS         HET_CONCORDANCE          100.00
variant  SNPS         HOMVAR_CONCORDANCE        99.63
variant  INDELS       TRUE_POSITIVE               273
variant  INDELS       FALSE_POSITIVE                0
variant  INDELS       FALSE_NEGATIVE               15
variant  INDELS       TRUE_NEGATIVE                79
variant  INDELS       CALLED_NOT_IN_DB_AT_ALL       2
variant  INDELS       HET_CONCORDANCE           98.67
variant  INDELS       HOMVAR_CONCORDANCE        89.58

-- Rewrite / refactored parts of subsetDiploidAlleles in GATKVariantContextUtils to have a BEST_MATCH assignment method that does it's best to simply match the genotype after subsetting to a set of alleles.  So if the original GT was A/B and you subset to A/B it remains A/B but if you subset to A/C you get A/A.  This means that het-alt B/C genotypes become A/B and A/C when subsetting to bi-allelics which is the convention in the KB.  Add lots of unit tests for this functions (from 0 previously)
-- BadSites in Assessment now emits TP sites with discordant genotypes with the type GENOTYPE_DISCORDANCE and tags the expected genotype in the info field as ExpectedGenotype, such as this record:

20      10769255        .       A       ATGTG   165.73  .       ExpectedGenotype=HOM_VAR;SupportingCallsets=ebanks,depristo,CEUTrio_best_practices;WHY=GENOTYPE_DISCORDANCE     GT:AD:DP:GQ:PL  0/1:1,9:10:6:360,0,6

Indicating that the call was a HET but the expected result was HOM_VAR
-- Forbid subsetting of diploid genotypes to just a single allele.
-- Added subsetToRef as a separate specific function.  Use that in the DiploidExactAFCalc in the case that you need to reduce yourself to ref only. Preserves DP in the genotype field when this is possible, so a few integration tests have changed for the UG
2013-06-13 15:05:32 -04:00
Mark DePristo b2dc7095ab Merge pull request #267 from broadinstitute/dr_reducereads_downsampling_fix
Exclude reduced reads from elimination during downsampling
2013-06-11 13:52:28 -07:00
David Roazen 95b5f99feb Exclude reduced reads from elimination during downsampling
Problem:
-Downsamplers were treating reduced reads the same as normal reads,
 with occasionally catastrophic results on variant calling when an
 entire reduced read happened to get eliminated.

Solution:
-Since reduced reads lack the information we need to do position-based
 downsampling on them, best available option for now is to simply
 exempt all reduced reads from elimination during downsampling.

Details:
-Add generic capability of exempting items from elimination to
 the Downsampler interface via new doNotDiscardItem() method.
 Default inherited version of this method exempts all reduced reads
 (or objects encapsulating reduced reads) from elimination.

-Switch from interfaces to abstract classes to facilitate this change,
 and do some minor refactoring of the Downsampler interface (push
 implementation of some methods into the abstract classes, improve
 names of the confusing clear() and reset() methods).

-Rewrite TAROrderedReadCache. This class was incorrectly relying
 on the ReservoirDownsampler to preserve the relative ordering of
 items in some circumstances, which was behavior not guaranteed by
 the API and only happened to work due to implementation details
 which no longer apply. Restructured this class around the assumption
 that the ReservoirDownsampler will not preserve relative ordering
 at all.

-Add disclaimer to description of -dcov argument explaining that
 coverage targets are approximate goals that will not always be
 precisely met.

-Unit tests for all individual downsamplers to verify that reduced
 reads are exempted from elimination
2013-06-11 16:16:26 -04:00
Eric Banks dadcfe296d Reworking of the dangling tails merging code.
We now run Smith-Waterman on the dangling tail against the corresponding reference tail.
If we can generate a reasonable, low entropy alignment then we trigger the merge to the
reference path; otherwise we abort.  Also, we put in a check for low-complexity of graphs
and don't let those pass through.

Added tests for this implementation that checks exact SW results and correct edges added.
2013-06-11 12:53:04 -04:00
Mark DePristo 1c03ebc82d Implement ActiveRegionTraversal RefMetaDataTracker for map call; HaplotypeCaller now annotates ID from dbSNP
-- Reuse infrastructure for RODs for reads to implement general IntervalReferenceOrderedView so that both TraverseReads and TraverseActiveRegions can use the same underlying infrastructure
-- TraverseActiveRegions now provides a meaningful RefMetaDataTracker to ActiveRegionWalker.map
-- Cleanup misc. code as it came up
-- Resolves GSA-808: Write general utility code to do rsID allele matching, hook up to UG and HC
2013-06-10 16:20:31 -04:00
Valentin Ruano-Rubio 96073c3058 This commit addresses JIRA issue GSA-948: Prevent users from doing the wrong thing with RNA-Seq data and the GATK.
The previous behavior is to process reads with N CIGAR operators as they are despite that many of the tools do not actually support such operator and results become unpredictible.

Now if the there is some read with the N operator, the engine returns a user exception. The error message indicates what is the problem (including the offending read and mapping position) and give a couple of alternatives that the user can take in order to move forward:

a) ask for those reads to be filtered out (with --filter_reads_with_N_cigar or -filterRNC)

b) keep them in as before (with -U ALLOW_N_CIGAR_READS or -U ALL)

Notice that (b) does not have any effect if (a) is enacted; i.e. filtering overrides ignoring.

Implementation:

* Added filterReadsWithMCigar argument to MalformedReadFilter with the corresponding changes in the code to get it to work.
* Added ALLOW_N_CIGAR_READS unsafe flag so that N cigar containing reads can be processed as they are if that is what the user wants.
* Added ReadFilterTest class commont parent for ReadFilter test cases.
* Refactor ReadGroupBlackListFilterUnitTest to extend ReadFilterTest and push up some functionality to that class.
* Modified MalformedReadFilterUnitTest to extend ReadFilterTest and to test the new filter functionality.
* Added AllowNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALLOW_N_CIGAR_READS flag is used.
* Added UnsafeNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALL flag is used.
* Updated a broken test case in UnifiedGenotyperIntegrationTest resulting from the new behavior.
* Updated EngineFeaturesIntegrationTest testdata to be compliant with new behavior
2013-06-10 10:44:42 -04:00
Michael McCowan 00c06e9e52 Performance improvements:
- Memoized MathUtil's cumulative binomial probability function.
 - Reduced the default size of the read name map in reduced reads and handle its resets more efficiently.
2013-06-09 11:26:52 -04:00
Mark DePristo e19c24f3ee Bugfix for HaplotypeCaller error: Only one of refStart or refStop must be < 0, not both
-- This occurred because we were reverting reads with soft clips that would produce reads with negative (or 0) alignment starts.  From such reads we could end up with adaptor starts that were negative and that would ultimately produce the "Only one of refStart or refStop must be < 0, not both" error in the FragmentUtils merging code (which would revert and adaptor clip reads).
-- We now hard clip away bases soft clipped reverted bases that fall before the 1-based contig start in revertSoftClippedBases.
-- Replace buggy cigarFromString with proper SAM-JDK call TextCigarCodec.getSingleton().decode(cigarString)
-- Added unit tests for reverting soft clipped bases that create a read before the contig
-- [delivers #50892431]
2013-06-04 10:33:46 -04:00
Mark DePristo 6555361742 Fix error in merging code in HC
-- Ultimately this was caused by an underlying bug in the reverting of soft clipped bases in the read clipper.  The read clipper would fail to properly set the alignment start for reads that were 100% clipped before reverting, such as 10H2S5H => 10H2M5H.  This has been fixed and unit tested.
-- Update 1 ReduceReads MD5, which was due to cases where we were clipping away all of the MATCH part of the read, leaving a cigar like 50H11S and the revert soft clips was failing to properly revert the bases.
-- delivers #50655421
2013-05-31 16:29:29 -04:00
Mark DePristo 4b206a3540 Check that -compress arguments are within range 0-9
-- Although the original bug report was about SplitSamFile it actually was an engine wide error.  The two places in the that provide compression to the BAM write now check the validity of the compress argument via a static method in ReadUtils
-- delivers #49531009
2013-05-31 15:29:02 -04:00
Mark DePristo b16de45ce4 Command-line read filters are now applied before Walker default filters
-- This allows us to use -rf ReassignMappingQuality to reassign mapping qualities to 60 *before* the BQSR filters them out with MappingQualityUnassignedFilter.
-- delivers #50222251
2013-05-30 16:54:18 -04:00
Ryan Poplin 61af37d0d2 Create a new normalDistributionLog10 function that is unit tested for use in the VQSR. 2013-05-30 16:00:08 -04:00
David Roazen a7cb599945 Require a minimum dcov value of 200 for Locus and ActiveRegion walkers when downsampling to coverage
-Throw a UserException if a Locus or ActiveRegion walker is run with -dcov < 200,
 since low dcov values can result in problematic downsampling artifacts for locus-based
 traversals.

-Read-based traversals continue to have no minimum for -dcov, since dcov for read traversals
 controls the number of reads per alignment start position, and even a dcov value of 1 might
 be safe/desirable in some circumstances.

-Also reorganize the global downsampling defaults so that they are specified as annotations
 to the Walker, LocusWalker, and ActiveRegionWalker classes rather than as constants in the
 DownsamplingMethod class.

-The default downsampling settings have not been changed: they are still -dcov 1000
 for Locus and ActiveRegion walkers, and -dt NONE for all other walkers.
2013-05-29 12:07:12 -04:00
delangel 925232b0fc Merge pull request #236 from broadinstitute/md_simple_hc_performance_improvements
3 simple performance improvements for HaplotypeCaller
2013-05-22 07:58:28 -07:00
Eric Banks 881b2b50ab Optimized counting of filtered records by filter.
Don't map class to counts in the ReadMetrics (necessitating 2 HashMap lookups for every increment).
Instead, wrap the ReadFilters with a counting version and then set those counts only when updating global metrics.
2013-05-21 21:54:49 -04:00
Mark DePristo a1093ad230 Optimization for ActiveRegion.removeAll
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion.  This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element.   New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set.  Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
2013-05-21 16:18:57 -04:00
Eric Banks 20c7a89030 Fixes to get accurate read counts for Read traversals
1. Don't clone the dataSource's metrics object (because then the engine won't continue to get updated counts)
 2. Use the dataSource's metrics object in the CountingFilteringIterator and not the first shard's object!
 3. Synchronize ReadMetrics.incrementMetrics to prevent race conditions.

Also:
 * Make sure users realize that the read counts are approximate in the print outs.
 * Removed a lot of unused cruft from the metrics object while I was in there.
 * Added test to make sure that the ReadMetrics read count does not overflow ints.
 * Added unit tests for traversal metrics (reads, loci, and active region traversals); these test counts of reads and records.
2013-05-21 15:24:07 -04:00
Eric Banks 58f4b81222 Count Reads should use a Long instead of an Integer for counts to prevent overflows. Added unit test. 2013-05-21 15:23:51 -04:00
Mark DePristo 62fc88f92e CombineVariants no longer adds PASS to unfiltered records
-- [Delivers #49876703]
-- Add integration test and test file
-- Update SymbolicAlleles combine variant tests, which was turning unfiltered records into PASS!
2013-05-20 16:53:51 -04:00
Yossi Farjoun 3e2a0b15ed - Added a @Hidden option ( -outputInsertLength ) to PileupWalker that causes it to emit insert sizes together with the pileup (to assist Mark Daly's investigation of the contamination dependance on insert length)
- Converted my old GATKBAMIndexText (within PileupWalkerIntegrationTest) to use a dataProvider
- Added two integration tests to test -outputInsertLength option
2013-05-16 12:47:16 -04:00
Mark DePristo 371f3752c1 Subshard timeouts in the GATK
-- The previous implementation of the maxRuntime would require us to wait until all of the work was completed within a shard, which can be a substantial amount of work in the case of a locus walker with 16kb shards.
-- This implementation ensures that we exit from the traversal very soon after the max runtime is exceeded, without completely all of our work within the shard.  This is done by updating all of the traversal engines to return false for hasNext() in the nano scheduled input provider.  So as soon as the timeout is exceeeded, we stop generating additional data to process, and we only have to wait until the currently executing data processing unit (locus, read, active region) completes.
-- In order to implement this timeout efficiently at this fine scale, the progress meter now lives in the genome analysis engine, and the exceedsTimeout() call in the engine looks at a periodically updated runtime variable in the meter.  This variable contains the elapsed runtime of the engine, but is updated by the progress meter daemon thread so that the engine doesn't call System.nanotime() in each cycle of the engine, which would be very expense.  Instead we basically wait for the daemon to update this variable, and so our precision of timing out is limited by the update frequency of the daemon, which is on the order of every few hundred milliseconds, totally fine for a timeout.
-- Added integration tests to ensure that subshard timeouts are working properly
2013-05-15 07:00:39 -04:00
Mark DePristo 7d78a77f17 Trivial update to ceutrio.ped file to make it really the CEU trio sample names 2013-05-14 17:08:13 -04:00
Mark DePristo 39e4396de0 New ActiveRegionShardBalancer allows efficient NanoScheduling
-- Previously we used the LocusShardBalancer for the haplotype caller, which meant that TraverseActiveRegions saw its shards grouped in chunks of 16kb bits on the genome.  These locus shards are useful when you want to use the HierarchicalMicroScheduler, as they provide fine-grained accessed to the underlying BAM, but they have two major drawbacks (1) we have to fairly frequently reset our state in TAR to handle moving between shard boundaries and (2) with the nano scheduled TAR we end up blocking at the end of each shard while our threads all finish processing.
-- This commit changes the system over to using an ActiveRegionShardBalancers, that combines all of the shard data for a single contig into a single combined shard.  This ensures that TAR, and by extensions the HaplotypeCaller, gets all of the data on a single contig together so the the NanoSchedule runs efficiently instead of blocking over and over at shard boundaries.  This simple change allows us to scale efficiently to around 8 threads in the nano scheduler:
  -- See https://www.dropbox.com/s/k7f280pd2zt0lyh/hc_nano_linear_scale.pdf
  -- See https://www.dropbox.com/s/fflpnan802m2906/hc_nano_log_scale.pdf
-- Misc. changes throughout the codebase so we Use the ActiveRegionShardBalancer where appropriate.
-- Added unit tests for ActiveRegionShardBalancer to confirm it does the merging as expected.
-- Fix bad toString in FilePointer
2013-05-13 11:09:02 -04:00
Mark DePristo b4f482a421 NanoScheduled ActiveRegionTraversal and HaplotypeCaller
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
  -- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
  -- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
2013-05-13 11:09:02 -04:00
Eric Banks 2f5ef6db44 New faster Smith-Waterman implementation that is edge greedy and assumes that ref and haplotype have same global start/end points.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
   * A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
     right thing for indels at the edges of the alignments.
     * Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
   * Lots of systematic testing added for this implementation.
   * NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
2013-05-13 09:36:39 -04:00
David Roazen 639030bd6d Enable convenient display of diff engine output in Bamboo, plus misc. minor test-related improvements
-Diff engine output is now included in the actual exception message thrown as a
 result of an MD5 mismatch, which allows it to be conveniently viewed on the
 main page of a build in Bamboo.

Minor Additional Improvements:

-WalkerTestSpec now auto-detects test class name via new JVMUtils.getCallingClass()
 method, and the test class name is now included as a regular part of integration
 test output for each test.

-Fix race condition in MD5DB.ensureMd5DbDirectory()

-integrationtests dir is now cleaned by "ant clean"

GSA-915 #resolve
2013-05-10 19:00:33 -04:00
Mark DePristo fa8a47ceef Replace DeBruijnAssembler with ReadThreadingAssembler
Problem
-------
The DeBruijn assembler was too slow.  The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp).  This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.

Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers.  The algorithm operates as follows:

identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
  find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
  for each base in the sequence from the starting vertex kmer:
    look at the existing outgoing nodes of current vertex V.  If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
    If no matching next vertex exists, find a unique vertex with kmer K.  If one exists, merge the sequence into this vertex, and continue
    If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue

This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size.  This allows us to assemble well with even very short kmers.

This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:

-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples.  This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor.  This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization.  This change is essential for us to get good variants from our paths when the kmer size is small.  It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation.  Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary.  This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler

Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations.  This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate.  Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
2013-05-08 21:41:42 -04:00
Mark DePristo f42bb86bdd e# This is a combination of 2 commits.
Only try to clip adaptors when both reads of the pair are on opposite strands

-- Read pairs that have unusual alignments, such as two reads both oriented like:

  <-----
     <-----

where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs.  This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
2013-05-03 11:19:14 -04:00
Mark DePristo f5a301fb63 Bugfix for AlignmentUtils.trimCigarByBases
-- Previous version would trim down 2M2D2M into 2M if you asked for the first 2 bases, but this can result in incorrect alignment of the bases to the reference as the bases no longer span the full reference interval expected.  Fixed and added unit tests
2013-05-03 09:32:05 -04:00
David Roazen f3c94a3c87 Update expected test output for Java 7
-Changes in Java 7 related to comparators / sorting produce a large number
 of innocuous differences in our test output. Updating expectations now
 that we've moved to using Java 7 internally.

-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
 intermittent failures.
2013-05-01 16:18:01 -04:00
Eric Banks 58424e56be Setting the reduce reads count tag was all wrong in a previous commit; fixing.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly.  Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.

The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly.  Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).

Also:
1. counts are now maintained as ints whenever possible.  Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
2013-04-30 13:45:42 -04:00
Mark DePristo 0387ea8df9 Bugfix for ReadClipper with ReducedReads
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts.  Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly.  Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
2013-04-29 11:12:09 -04:00
Eric Banks ba2c3b57ed Extended the allele-biased down-sampling functionality to handle reduced reads.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.

Added lots of unit tests for new functionality.
2013-04-26 11:23:17 -04:00
Mark DePristo 528c3d083a Merge pull request #191 from broadinstitute/dr_fix_rod_system_locking
Detect stuck lock-acquisition calls, and disable file locking for tests
2013-04-25 09:32:54 -07:00
Mark DePristo d20be41fee Bugfix for FragmentUtils.mergeOverlappingPairedFragments
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences.  If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference.  Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
2013-04-25 11:11:15 -04:00
David Roazen 4d56142163 Detect stuck lock-acquisition calls, and disable file locking for tests
-Acquire file locks in a background thread with a timeout of 30 seconds,
 and throw a UserException if a lock acquisition call times out

    * should solve the locking issue for most people provided they
      RETRY failed farm jobs

    * since we use NON-BLOCKING lock acquisition calls, any call that
      takes longer than a second or two indicates a problem with the
      underlying OS file lock support

    * use daemon threads so that stuck lock acquisition tasks don't
      prevent the JVM from exiting

-Disable both auto-index creation and file locking for integration tests
 via a hidden GATK argument --disable_auto_index_creation_and_locking_when_reading_rods

    * argument not safe for general use, since it allows reading from
      an index file without first acquiring a lock

    * this is fine for the test suite, since all index files already
      exist for test files (or if they don't, they should!)

-Added missing indices for files in private/testdata

-Had to delete most of RMDTrackBuilderUnitTest, since it mostly tested auto-index
 creation, which we can't test with locking disabled, but I replaced the deleted
 tests with some tests of my own.

-Unit test for FSLockWithShared to test the timeout feature
2013-04-24 22:49:02 -04:00
Eric Banks 5bce0e086e Refactored binomial probability code in MathUtils.
* Moved redundant code out of UGEngine
  * Added overloaded methods that assume p=0.5 for speed efficiency
  * Added unit test for the binomialCumulativeProbability method
2013-04-16 18:19:07 -04:00
Guillermo del Angel a971e7ab6d Several improvements to ReadAdaptorTrimmer so that it can be incorporated into ancient DNA processing pipelines (for which it was developed):
-- Add pair cleaning feature. Reads in query-name sorted order are required and pairs need to appear consecutively, but if -cleanPairs option is set, a malformed pair where second read is missing is just skipped instead of erroring out.
-- Add integration tests
-- Move walker to public
2013-04-13 13:41:36 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00