Commit Graph

375 Commits (90fc249c8d177eaa2b7212e571337ba2ab4f1dca)

Author SHA1 Message Date
Ryan Poplin cb4ec3437a After debate reverting SW parameter changes temporarily while we explore global SW plans. 2013-04-23 13:32:06 -04:00
Mark DePristo be66049a6f Bugfix for CommonSuffixSplitter
-- The problem is that the common suffix splitter could eliminate the reference source vertex when there's an incoming node that contains all of the reference source vertex bases and then some additional prefix bases.  In this case we'd eliminate the reference source vertex.  Fixed by checking for this condition and aborting the simplification
-- Update MD5s, including minor improvements
2013-04-21 19:37:01 -04:00
Mark DePristo f0e64850da Two sensitivity / specificity improvements to the haplotype caller
-- Reduce the min read length to 10 bp in the filterNonPassingReads in the HC.  Now that we filter out reads before genotyping, we have to be more tolerant of shorter, but informative, reads, in order to avoid a few FNs in shallow read data
-- Reduce the min usable base qual to 8 by default in the HC.  In regions with low coverage we sometimes throw out our only informative kmers because we required a contiguous run of bases with >= 16 QUAL.  This is a bit too aggressive of a requirement, so I lowered it to 8.
-- Together with the previous commit this results in a significant improvement in the sensitivity and specificity of the caller

 NA12878 MEM chr20:10-11
 Name    VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
 branch  SNPS                  1216               0               2            194                        0
 branch  INDELS                 312               2              13             71                        7
 master  SNPS                  1214               0               4            194                        1
 master  INDELS                 309               2              16             71                       10

-- Update MD5s in the integration tests to reflect these two new changes
2013-04-17 12:32:31 -04:00
Eric Banks 5bce0e086e Refactored binomial probability code in MathUtils.
* Moved redundant code out of UGEngine
  * Added overloaded methods that assume p=0.5 for speed efficiency
  * Added unit test for the binomialCumulativeProbability method
2013-04-16 18:19:07 -04:00
Eric Banks df189293ce Improve compression in Reduce Reads by incorporating probabilistic model and global het compression
The Problem:
  Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
  regions in an exome) causes RR (with default settings) to consider it a variant region.  This
  seriously hurts compression performance.

The Solution:
  1. We now use a probabilistic model for determining whether we can create a consensus (in other
  words, whether we can error correct a site) instead of the old ratio threshold.  We calculate
  the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
  that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
  2. We also allow het compression globally, not just at known sites.  So if we cannot create a
  consensus at a given site then we try to perform het compression; and if we cannot perform het
  compression that we just don't reduce the variant region.  This way very wonky regions stay
  uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
  locus get het compressed.

Details:
  1. -minvar is now deprecated in favor of -min_pvalue.
  2. Added integration test for bad pvalue input.
  3. -known argument still works to force het compression only at known sites; if it's not included
     then we allow het compression anywhere.  Added unit tests for this.
  4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
     Before finalizing het compression, we now check for insertions or other variant regions (usually due
     to multi-allelics) which can render a region incompressible (and we back out if we find one).  We
     were checking for excessive softclips before, but now we add these tests too.
  5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
     consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
     out instead of backing out all of them.
  6. We no longer create a mini read at the stop of the variant window for het compression.  Instead, we
     allow it to be part of the next global consensus.
  7. The coverage test is no longer run systematically on all integration tests because the quals test
     supercedes it.  The systematic quals test is now much stricter in order to catch bugs and edge cases
     (very useful!).
  8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
     for a consensus was affected by good and bad bases/reads).
  9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
     This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
  10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
     with insertions from a header.

Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
2013-04-16 18:19:06 -04:00
Ryan Poplin e0dfe5ca14 Restore the read filter function in the HaplotypeCaller. 2013-04-16 12:01:30 -04:00
Geraldine Van der Auwera e176fc3af1 Merge pull request #159 from broadinstitute/md_bqsr_ion
Trivial BQSR bug fixes and improvement
2013-04-16 08:54:47 -07:00
Ryan Poplin 936f4da1f6 Merge pull request #166 from broadinstitute/md_hc_persample_haplotypes
Select the haplotypes we move forward for genotyping per sample, not poo...
2013-04-16 08:46:56 -07:00
Mark DePristo 17982bcbf8 Update MD5s for VQSR header change 2013-04-16 11:45:45 -04:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Mark DePristo 564fe36d22 VariantRecalibrator's VQSR.vcf now contains NEG/POS labels
-- It's useful to know which sites have been used in the training of the model.  The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
2013-04-16 09:09:47 -04:00
Mark DePristo 3144eae51c UnifiedGenotyper bugfix: don't create haplotypes with 0 bases
-- The PairHMM no longer allows us to create haplotypes with 0 bases.  The UG indel caller used to create such haplotypes.  Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes #47523579]
2013-04-13 14:57:55 -04:00
Mauricio Carneiro f11c8d22d4 Updating java 7 md5's to java 6 md5's 2013-04-13 08:21:48 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 0e627bce93 Slight update to Path SW parameters.
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
2013-04-12 12:43:52 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00
Ryan Poplin a507381a33 Updating BQSR RecalibrationEngine to work correctly with empty BQSR tables.
-- Previously would crash when a scatter/gather interval contained no usable data.
-- Added unit test to cover this case.
2013-04-11 16:27:59 -04:00
Mark DePristo fb86887bf2 Fast algorithm for determining which kmers are good in a read
-- old algorithm was O(kmerSize * readLen) for each read.  New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph.  Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
2013-04-11 09:54:22 -04:00
Mark DePristo bf42be44fc Fast DeBruijnGraph creation using the kmer counter
-- The previous creation algorithm used the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to the graph
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
  update edge count by 1 if kmer1 -> kmer2 already existed in the graph

-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)).  This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap

for each kmer pair 1 and 2 in the hash counter
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
  update edge count by count from map if kmer1 -> kmer2 already existed in the graph

-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
2013-04-10 17:10:59 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mark DePristo b115e5c582 Critical bugfix for CommonSuffixSplitter to avoid infinite loops
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:

X -> A -> B
Y -> A -> B

So that the incoming vertices of B all have the same sequence.  This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph.  Fixed and unit tested

-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging.  So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph.  Equals here means that all vertices have equivalents in both graphs, as do all edges.  If the two graphs are equal we stop simplifying.  It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
2013-04-09 16:19:26 -04:00
Mark DePristo 33ecec535d Turn off the LD merging code by default
-- It's just too hard to interpret the called variation when we merge variants via LD.
-- Can now be turned on with -mergeVariantsViaLD
-- Update MD5s
2013-04-09 10:08:06 -04:00
Mark DePristo caf15fb727 Update MD5s to reflect new HC algorithms and parameter values 2013-04-08 12:48:16 -04:00
Mark DePristo 9c7a35f73f HaplotypeCaller no longer creates haplotypes that involve cycles in the SeqGraph
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models.  Allowing cycles can be re-enabled with an HC command line switch.
2013-04-08 12:47:50 -04:00
Mark DePristo 5545c629f5 Rename Utils to GraphUtils to avoid conflicts with the sting.Utils class; fix broken unit test in SharedVertexSequenceSplitterUnitTest 2013-04-08 12:47:49 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 4d389a8234 Optimizations for HC infrastructure
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
2013-04-08 12:47:49 -04:00
Mark DePristo e916998784 Bugfix for head and tail merging code in SeqGraph
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so.  This would introduce large deletion events at the start / end of the assemblies.  Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
2013-04-08 12:47:48 -04:00
Mark DePristo 2aac9e2782 More efficient ZipLinearChains algorithm
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go.  Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains.  The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Eric Banks 6253ba164e Using --keepOriginalAC in SelectVariants was causing it to emit bad VCFs
* This occurred when one or more alleles were lost from the record after selection
  * Discussed here: http://gatkforums.broadinstitute.org/discussion/comment/4718#Comment_4718
  * Added some integration tests for --keepOriginalAC (there were none before)
2013-04-05 00:53:28 -04:00
Eric Banks 7897d52f32 Don't allow users to specify keys and IDs that contain angle brackets or equals signs (not allowed in VCF spec).
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
  * This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
  * Added integration test to confirm failure with User Error
  * Removed illegal header line in KB test VCF that was causing related tests to fail.
2013-04-05 00:52:32 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
Mark DePristo bb42c90f2b Use LinkedHashSets in incoming and outgoing vertex functions in BaseGraph
-- Using a LinkedHashSet changed the md5 for HCTestComplexVariants.
2013-04-02 17:58:20 -04:00
Mark DePristo c191d7de8c Critical bugfix for CommonSuffixSplitter
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm.  Created unit test that reproduced the issue, and then fixed the underlying issue.
2013-04-02 09:22:33 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Eric Banks 7dd58f671f Merge pull request #132 from broadinstitute/gda_filter_unmasked_sites
Added small feature to VariantFiltration to filter sites outside of a gi...
2013-03-31 06:27:26 -07:00
Guillermo del Angel 9686e91a51 Added small feature to VariantFiltration to filter sites outside of a given mask:
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
2013-03-31 08:48:16 -04:00
Eric Banks 8e2094d2af Updated AssessReducedQuals and applied it systematically to all ReduceReads integration tests.
* Moved to protected for packaging purposes.
  * Cleaned up and removed debugging output.
  * Fixed logic for epsilons so that we really only test significant differences between BAMs.
  * Other small fixes (e.g. don't include low quality reduced reads in overall qual).
  * Most RR integration tests now automatically run the quals test on output.
    * A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
2013-03-31 00:27:14 -04:00
Guillermo del Angel 6b8bed34d0 Big bad bug fix: feature added to LeftAlignAndTrimVariants to left align multiallelic records didn't work.
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
2013-03-30 19:31:28 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
Chris Hartl 74a17359a8 MathUtils.randomSubset() now uses Collections.shuffle() (indirectly, through the other methods
that are tested), resulting in slightly different numbers of calls to the RNG, and ultimately
different sets of selected variants.

This commits updates the md5 values for the validation site selector integration test to reflect
these new random subsets of variants that are selected.
2013-03-29 14:52:10 -04:00
Guillermo del Angel 8fbf9c947f Upgrades and changes to LeftAlignVariants, motivated by 1000G consensus indel production:
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
2013-03-29 10:02:06 -04:00
Chris Hartl 73d1c319bf Rarely-occurring logic bugfix for GenotypeConcordance, streamlining and testing of MathUtils
Currently, the multi-allelic test is covering the following case:

Eval   A   T,C
Comp   A   C

reciprocate this so that the reverse can be covered.

Eval   A   C
Comp   A   T,C

And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.

This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:

Eval:   A  G,T      0/0   2/0   2/2   1/1
Comp:   A  C,T      0/0   1/0   0/0   0/0

Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:

Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)

Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.

Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
 - dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
 - vectorSum
 - array shuffle, random subset
 - countOccurances (general forms, the char form is used in the codebase)
 - getNMaxElements
 - array permutation
 - sorted array permutation
 - compare floats
 - sum() (for integer arrays and lists).

Final keyword was extensively added to MathUtils.

The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).

The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.

In addition, more extensive tests were added for
 - logBinomialCoefficient (Newton's identity should always hold)
 - logFactorial
 - log10sumlog10 and its approximation

All unit tests pass
2013-03-28 23:25:28 -04:00