Commit Graph

702 Commits (8bac61f9fb96b156db2efea3695354667da44f24)

Author SHA1 Message Date
Mark DePristo f42bb86bdd e# This is a combination of 2 commits.
Only try to clip adaptors when both reads of the pair are on opposite strands

-- Read pairs that have unusual alignments, such as two reads both oriented like:

  <-----
     <-----

where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs.  This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
2013-05-03 11:19:14 -04:00
Mark DePristo 2bcbdd469f leftAlignCigarSequentially now supports haplotypes with insertions and deletions where the deletion allele was previously removed by the leftAlignSingleIndel during it's cleanup phase. 2013-05-03 09:32:05 -04:00
Guillermo del Angel 0c30a5ebc6 Rev'd up Picard to get PL fix: PLs were saturated to 32767 (Short.MAX_VALUE) when converting from GL to integers. Increase capping to Integer.MAX_VALUE (2^31-1) which should be enough for reasonable sites now. Integration tests change because some tests have some hyper-deep pileups where this case was hit 2013-05-02 16:31:43 -04:00
David Roazen f3c94a3c87 Update expected test output for Java 7
-Changes in Java 7 related to comparators / sorting produce a large number
 of innocuous differences in our test output. Updating expectations now
 that we've moved to using Java 7 internally.

-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
 intermittent failures.
2013-05-01 16:18:01 -04:00
Eric Banks 58424e56be Setting the reduce reads count tag was all wrong in a previous commit; fixing.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly.  Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.

The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly.  Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).

Also:
1. counts are now maintained as ints whenever possible.  Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
2013-04-30 13:45:42 -04:00
Guillermo del Angel 20d3137928 Fix for indel calling with UG in presence of reduced reads: When a read is long enough so that there's no reference context available, the reads gets clipped so that it falls again within the reference context range. However, the clipping is incorrect, as it makes the read end precisely at the end of the reference context coordinates. This might lead to a case where a read might span beyond the haplotype if one of the candidate haplotypes is shorter than the reference context (As in the case e.g. with deletions). In this case, the HMM will not work properly and the likelihood will be bad, since "insertions" at end of reads when haplotype is done will be penalized and likelihood will be much lower than it should.
-- Added check to see if read spans beyond reference window MINUS padding and event length. This guarantees that read will always be contained in haplotype.
-- Changed md5's that happen when long reads from old 454 data have their likelihoods changed because of the extra base clipping.
2013-04-29 19:33:02 -04:00
Mark DePristo 0387ea8df9 Bugfix for ReadClipper with ReducedReads
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts.  Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly.  Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
2013-04-29 11:12:09 -04:00
Mark DePristo 5dd73ba2d1 Merge pull request #198 from broadinstitute/mc_reduce_reads_ds_doc
Updates GATKDocs for ReduceReads downsampling
2013-04-27 05:49:47 -07:00
Mauricio Carneiro 76e997895e Updates GATKDocs for ReduceReads downsampling
[fixes #48258295]
2013-04-26 23:33:44 -04:00
Guillermo del Angel 4168aaf280 Add feature to specify Allele frequency priors by command line when calling variants.
Use case:
The default AF priors used (infinite sites model, neutral variation) is appropriate in the case where the reference allele is ancestral, and the called allele is a derived allele.
Most of the times this is true but in several population studies and in ancient DNA analyses this might introduce reference biases, and in some other cases it's hard to ascertain what the ancestral allele is (normally requiring to look up homologous chimp sequence).
Specifying no prior is one solution, but this may introduce a lot of artifactual het calls in shallower coverage regions.
With this option, users can specify what the prior for each AC should be according to their needs, subject to the restrictions documented in the code and in GATK docs.
-- Updated ancient DNA single sample calling script with filtering options and other cleanups.
-- Added integration test. Removed old -noPrior syntax.
2013-04-26 19:06:39 -04:00
Mark DePristo 759c531d1b Merge pull request #197 from broadinstitute/dr_disable_snpeff_version_check
Add support for snpEff "GATK compatibility mode" (-o gatk)
2013-04-26 13:55:14 -07:00
David Roazen 7d90bbab08 Add support for snpEff "GATK compatibility mode" (-o gatk)
-Do not throw an exception when parsing snpEff output files
 generated by not-officially-supported versions of snpEff,
 PROVIDED that snpEff was run with -o gatk

-Requested by the snpEff author

-Relevant integration tests updated/expanded
2013-04-26 15:47:15 -04:00
Mark DePristo 071fd67d55 Merge pull request #193 from broadinstitute/eb_contamination_fixing_for_reduced_reads
Eb contamination fixing for reduced reads
2013-04-26 09:48:45 -07:00
Mark DePristo 92a6c7b561 Merge pull request #195 from broadinstitute/eb_exclude_sample_file_bug_in_select_variants
Fixed bug reported on the forum where using the --exclude_sample_file ar...
2013-04-26 09:47:38 -07:00
Eric Banks 360e2ba87e Fixed bug reported on the forum where using the --exclude_sample_file argument in SV was giving bad results.
Added integration test.
https://www.pivotaltracker.com/s/projects/793457/stories/47399245
2013-04-26 12:23:11 -04:00
Eric Banks 021adf4220 WTF - I thought we had disabled the randomized dithering of rank sum tests for integration tests?!
Well, it wasn't done so I went ahead and did so.  Lots of MD5 changes accordingly.
2013-04-26 11:24:05 -04:00
Eric Banks ba2c3b57ed Extended the allele-biased down-sampling functionality to handle reduced reads.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.

Added lots of unit tests for new functionality.
2013-04-26 11:23:17 -04:00
Mark DePristo d20be41fee Bugfix for FragmentUtils.mergeOverlappingPairedFragments
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences.  If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference.  Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
2013-04-25 11:11:15 -04:00
Eric Banks 379a9841ce Various bug fixes for recent Reduce Reads additions plus solution implemented for low MQ reads.
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions.  Then we get the
best of both worlds.  As a note, coverage refers to just the individual base counts and not the entire pileup.

2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.

3. Each consensus keeps track of its own number of softclipped bases.  There was no reason that that number
should be shared between them.

4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now.  Don't lose that
information.  Maybe we'll decide to change this in the future, but for now we are conservative.

5. Also implemented various small performance optimizations based on profiling.

Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
2013-04-24 18:18:50 -04:00
MauricioCarneiro 45fec382e7 Merge pull request #180 from broadinstitute/mc_diagnosetargets_missing_targets
DiagnoseTargets Global Refactor
2013-04-24 14:54:55 -07:00
Mauricio Carneiro 367f0c0ac1 Split class names into stratification and metrics
Calling everything statistics was very confusing. Diagnose Targets stratifies the data three ways: Interval, Sample and Locus. Each stratification then has it's own set of metrics (plugin system) to calculate -- LocusMetric, SampleMetric, IntervalMetric.

 Metrics are generalized by the Metric interface. (for generic access)
 Stratifications are generalized by the AbstractStratification abstract class. (to aggressively limit code duplication)
2013-04-24 14:15:49 -04:00
Ryan Poplin 80131ac996 Adding the 1000G_phase1.snps.high_confidence callset to the GATK resource bundle for use in the April 2013 updated best practices. 2013-04-24 11:41:32 -04:00
Guillermo del Angel 2ab270cf3f Corner case fix to General Ploidy SNP likelihood model.
-- In case there are no informative bases in a pileup but pileup isn't empty (like when all bases have Q < min base quality) the GLs were still computed (but were all zeros) and fed to the exact model. Now, mimic case of diploid Gl computation where GLs are only added if # good bases > 0
-- I believe general case where only non-informative GLs are fed into AF calc model is broken and yields bogus QUAL, will investigate separately.
2013-04-23 21:13:18 -04:00
Mauricio Carneiro 8f8f339e4b Abstract class for the statistics
Addressing the code duplication issue raised by Mark.
2013-04-23 18:02:27 -04:00
Mauricio Carneiro 38662f1d47 Limiting access to the DT classes
* Make most classes final, others package local
    * Move to diagnostics.diagnosetargets package
    * Aggregate statistics and walker classes on the same package for simplified visibility.
    * Make status list a LinkedList instead of a HashSet
2013-04-23 14:01:43 -04:00
Ryan Poplin cb4ec3437a After debate reverting SW parameter changes temporarily while we explore global SW plans. 2013-04-23 13:32:06 -04:00
Mauricio Carneiro fdd16dc6f9 DiagnoseTargets refactor
A plugin enabled implementation of DiagnoseTargets

Summarized Changes:
-------------------
   * move argument collection into Thresholder object
   * make thresholder object private member of all statistics classes
   * rework the logic of the mate pairing thresholds
   * update unit and integration tests to reflect the new behavior
   * Implements Locus Statistic plugins
   * Extend Locus Statistic plugins to determine sample status
   * Export all common plugin functionality into utility class
   * Update tests accordingly

[fixes #48465557]
2013-04-22 23:53:10 -04:00
Mauricio Carneiro eb6308a0e4 General DiagnoseTargets documentation cleanup
* remove interval statistic low_median_coverage -- it is already captured by low coverage and coverage gaps.
   * add gatkdocs to all the parameters
   * clean up the logic on callable status a bit (still need to be re-worked into a plugin system)
   * update integration tests
2013-04-22 23:53:09 -04:00
Mauricio Carneiro b3c0abd9e8 Remove REF_N status from DiagnoseTargets
This is not really feasible with the current mandate of this walker. We would have to traverse by reference and that would make the runtime much higher, and we are not really interested in the status 99% of the time anyway. There are other walkers that can report this, and just this, status more cheaply.

[fixes #48442663]
2013-04-22 23:53:09 -04:00
Mauricio Carneiro 2b923f1568 fix for DiagnoseTargets multiple filter output
Problem
-------
Diagnose targets is outputting both LOW_MEDIAN_COVERAGE and NO_READS when no reads are covering the interval

Solution
--------
Only allow low median coverage check if there are reads

[fixes #48442675]
2013-04-22 23:53:09 -04:00
Mauricio Carneiro cf7afc1ad4 Fixed "skipped intervals" bug on DiagnoseTargets
Problem
-------
Diagnose targets was skipping intervals when they were not covered by any reads.

Solution
--------
Rework the interval iteration logic to output all intervals as they're skipped over by the traversal, as well as adding a loop on traversal done to finish outputting intervals past the coverage of teh BAM file.

Summarized Changes
------------------
   * Outputs all intervals it iterates over, even if uncovered
   * Outputs leftover intervals in the end of the traversal
   * Updated integration tests

[fixes #47813825]
2013-04-22 23:53:09 -04:00
Mark DePristo be66049a6f Bugfix for CommonSuffixSplitter
-- The problem is that the common suffix splitter could eliminate the reference source vertex when there's an incoming node that contains all of the reference source vertex bases and then some additional prefix bases.  In this case we'd eliminate the reference source vertex.  Fixed by checking for this condition and aborting the simplification
-- Update MD5s, including minor improvements
2013-04-21 19:37:01 -04:00
Mark DePristo f0e64850da Two sensitivity / specificity improvements to the haplotype caller
-- Reduce the min read length to 10 bp in the filterNonPassingReads in the HC.  Now that we filter out reads before genotyping, we have to be more tolerant of shorter, but informative, reads, in order to avoid a few FNs in shallow read data
-- Reduce the min usable base qual to 8 by default in the HC.  In regions with low coverage we sometimes throw out our only informative kmers because we required a contiguous run of bases with >= 16 QUAL.  This is a bit too aggressive of a requirement, so I lowered it to 8.
-- Together with the previous commit this results in a significant improvement in the sensitivity and specificity of the caller

 NA12878 MEM chr20:10-11
 Name    VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
 branch  SNPS                  1216               0               2            194                        0
 branch  INDELS                 312               2              13             71                        7
 master  SNPS                  1214               0               4            194                        1
 master  INDELS                 309               2              16             71                       10

-- Update MD5s in the integration tests to reflect these two new changes
2013-04-17 12:32:31 -04:00
Eric Banks 5bce0e086e Refactored binomial probability code in MathUtils.
* Moved redundant code out of UGEngine
  * Added overloaded methods that assume p=0.5 for speed efficiency
  * Added unit test for the binomialCumulativeProbability method
2013-04-16 18:19:07 -04:00
Eric Banks df189293ce Improve compression in Reduce Reads by incorporating probabilistic model and global het compression
The Problem:
  Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
  regions in an exome) causes RR (with default settings) to consider it a variant region.  This
  seriously hurts compression performance.

The Solution:
  1. We now use a probabilistic model for determining whether we can create a consensus (in other
  words, whether we can error correct a site) instead of the old ratio threshold.  We calculate
  the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
  that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
  2. We also allow het compression globally, not just at known sites.  So if we cannot create a
  consensus at a given site then we try to perform het compression; and if we cannot perform het
  compression that we just don't reduce the variant region.  This way very wonky regions stay
  uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
  locus get het compressed.

Details:
  1. -minvar is now deprecated in favor of -min_pvalue.
  2. Added integration test for bad pvalue input.
  3. -known argument still works to force het compression only at known sites; if it's not included
     then we allow het compression anywhere.  Added unit tests for this.
  4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
     Before finalizing het compression, we now check for insertions or other variant regions (usually due
     to multi-allelics) which can render a region incompressible (and we back out if we find one).  We
     were checking for excessive softclips before, but now we add these tests too.
  5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
     consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
     out instead of backing out all of them.
  6. We no longer create a mini read at the stop of the variant window for het compression.  Instead, we
     allow it to be part of the next global consensus.
  7. The coverage test is no longer run systematically on all integration tests because the quals test
     supercedes it.  The systematic quals test is now much stricter in order to catch bugs and edge cases
     (very useful!).
  8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
     for a consensus was affected by good and bad bases/reads).
  9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
     This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
  10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
     with insertions from a header.

Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
2013-04-16 18:19:06 -04:00
Ryan Poplin e0dfe5ca14 Restore the read filter function in the HaplotypeCaller. 2013-04-16 12:01:30 -04:00
Geraldine Van der Auwera e176fc3af1 Merge pull request #159 from broadinstitute/md_bqsr_ion
Trivial BQSR bug fixes and improvement
2013-04-16 08:54:47 -07:00
Ryan Poplin 936f4da1f6 Merge pull request #166 from broadinstitute/md_hc_persample_haplotypes
Select the haplotypes we move forward for genotyping per sample, not poo...
2013-04-16 08:46:56 -07:00
Mark DePristo 17982bcbf8 Update MD5s for VQSR header change 2013-04-16 11:45:45 -04:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Mark DePristo 5a74a3190c Improvements to the VariantRecalibrator R plots
-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
2013-04-16 09:09:51 -04:00
Mark DePristo 564fe36d22 VariantRecalibrator's VQSR.vcf now contains NEG/POS labels
-- It's useful to know which sites have been used in the training of the model.  The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
2013-04-16 09:09:47 -04:00
Mauricio Carneiro 9bfa5eb70f Quick optimization to the PairHMM
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.

Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
2013-04-14 23:25:33 -04:00
Mark DePristo 3144eae51c UnifiedGenotyper bugfix: don't create haplotypes with 0 bases
-- The PairHMM no longer allows us to create haplotypes with 0 bases.  The UG indel caller used to create such haplotypes.  Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes #47523579]
2013-04-13 14:57:55 -04:00
Mauricio Carneiro f11c8d22d4 Updating java 7 md5's to java 6 md5's 2013-04-13 08:21:48 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 0e627bce93 Slight update to Path SW parameters.
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
2013-04-12 12:43:52 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00