Commit Graph

364 Commits (5a74a3190c1a3637b5a9b21e55330affd8f73d4a)

Author SHA1 Message Date
Mark DePristo 564fe36d22 VariantRecalibrator's VQSR.vcf now contains NEG/POS labels
-- It's useful to know which sites have been used in the training of the model.  The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
2013-04-16 09:09:47 -04:00
Mark DePristo 3144eae51c UnifiedGenotyper bugfix: don't create haplotypes with 0 bases
-- The PairHMM no longer allows us to create haplotypes with 0 bases.  The UG indel caller used to create such haplotypes.  Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes #47523579]
2013-04-13 14:57:55 -04:00
Mauricio Carneiro f11c8d22d4 Updating java 7 md5's to java 6 md5's 2013-04-13 08:21:48 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 0e627bce93 Slight update to Path SW parameters.
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
2013-04-12 12:43:52 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Ryan Poplin a507381a33 Updating BQSR RecalibrationEngine to work correctly with empty BQSR tables.
-- Previously would crash when a scatter/gather interval contained no usable data.
-- Added unit test to cover this case.
2013-04-11 16:27:59 -04:00
Mark DePristo fb86887bf2 Fast algorithm for determining which kmers are good in a read
-- old algorithm was O(kmerSize * readLen) for each read.  New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph.  Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
2013-04-11 09:54:22 -04:00
Mark DePristo bf42be44fc Fast DeBruijnGraph creation using the kmer counter
-- The previous creation algorithm used the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to the graph
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
  update edge count by 1 if kmer1 -> kmer2 already existed in the graph

-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)).  This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap

for each kmer pair 1 and 2 in the hash counter
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
  update edge count by count from map if kmer1 -> kmer2 already existed in the graph

-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
2013-04-10 17:10:59 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mark DePristo b115e5c582 Critical bugfix for CommonSuffixSplitter to avoid infinite loops
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:

X -> A -> B
Y -> A -> B

So that the incoming vertices of B all have the same sequence.  This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph.  Fixed and unit tested

-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging.  So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph.  Equals here means that all vertices have equivalents in both graphs, as do all edges.  If the two graphs are equal we stop simplifying.  It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
2013-04-09 16:19:26 -04:00
Mark DePristo 33ecec535d Turn off the LD merging code by default
-- It's just too hard to interpret the called variation when we merge variants via LD.
-- Can now be turned on with -mergeVariantsViaLD
-- Update MD5s
2013-04-09 10:08:06 -04:00
Mark DePristo caf15fb727 Update MD5s to reflect new HC algorithms and parameter values 2013-04-08 12:48:16 -04:00
Mark DePristo 9c7a35f73f HaplotypeCaller no longer creates haplotypes that involve cycles in the SeqGraph
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models.  Allowing cycles can be re-enabled with an HC command line switch.
2013-04-08 12:47:50 -04:00
Mark DePristo 5545c629f5 Rename Utils to GraphUtils to avoid conflicts with the sting.Utils class; fix broken unit test in SharedVertexSequenceSplitterUnitTest 2013-04-08 12:47:49 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 4d389a8234 Optimizations for HC infrastructure
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
2013-04-08 12:47:49 -04:00
Mark DePristo e916998784 Bugfix for head and tail merging code in SeqGraph
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so.  This would introduce large deletion events at the start / end of the assemblies.  Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
2013-04-08 12:47:48 -04:00
Mark DePristo 2aac9e2782 More efficient ZipLinearChains algorithm
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go.  Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains.  The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Eric Banks 6253ba164e Using --keepOriginalAC in SelectVariants was causing it to emit bad VCFs
* This occurred when one or more alleles were lost from the record after selection
  * Discussed here: http://gatkforums.broadinstitute.org/discussion/comment/4718#Comment_4718
  * Added some integration tests for --keepOriginalAC (there were none before)
2013-04-05 00:53:28 -04:00
Eric Banks 7897d52f32 Don't allow users to specify keys and IDs that contain angle brackets or equals signs (not allowed in VCF spec).
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
  * This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
  * Added integration test to confirm failure with User Error
  * Removed illegal header line in KB test VCF that was causing related tests to fail.
2013-04-05 00:52:32 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
Mark DePristo bb42c90f2b Use LinkedHashSets in incoming and outgoing vertex functions in BaseGraph
-- Using a LinkedHashSet changed the md5 for HCTestComplexVariants.
2013-04-02 17:58:20 -04:00
Mark DePristo c191d7de8c Critical bugfix for CommonSuffixSplitter
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm.  Created unit test that reproduced the issue, and then fixed the underlying issue.
2013-04-02 09:22:33 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Eric Banks 7dd58f671f Merge pull request #132 from broadinstitute/gda_filter_unmasked_sites
Added small feature to VariantFiltration to filter sites outside of a gi...
2013-03-31 06:27:26 -07:00
Guillermo del Angel 9686e91a51 Added small feature to VariantFiltration to filter sites outside of a given mask:
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
2013-03-31 08:48:16 -04:00
Eric Banks 8e2094d2af Updated AssessReducedQuals and applied it systematically to all ReduceReads integration tests.
* Moved to protected for packaging purposes.
  * Cleaned up and removed debugging output.
  * Fixed logic for epsilons so that we really only test significant differences between BAMs.
  * Other small fixes (e.g. don't include low quality reduced reads in overall qual).
  * Most RR integration tests now automatically run the quals test on output.
    * A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
2013-03-31 00:27:14 -04:00
Guillermo del Angel 6b8bed34d0 Big bad bug fix: feature added to LeftAlignAndTrimVariants to left align multiallelic records didn't work.
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
2013-03-30 19:31:28 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
Chris Hartl 74a17359a8 MathUtils.randomSubset() now uses Collections.shuffle() (indirectly, through the other methods
that are tested), resulting in slightly different numbers of calls to the RNG, and ultimately
different sets of selected variants.

This commits updates the md5 values for the validation site selector integration test to reflect
these new random subsets of variants that are selected.
2013-03-29 14:52:10 -04:00
Guillermo del Angel 8fbf9c947f Upgrades and changes to LeftAlignVariants, motivated by 1000G consensus indel production:
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
2013-03-29 10:02:06 -04:00
Chris Hartl 73d1c319bf Rarely-occurring logic bugfix for GenotypeConcordance, streamlining and testing of MathUtils
Currently, the multi-allelic test is covering the following case:

Eval   A   T,C
Comp   A   C

reciprocate this so that the reverse can be covered.

Eval   A   C
Comp   A   T,C

And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.

This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:

Eval:   A  G,T      0/0   2/0   2/2   1/1
Comp:   A  C,T      0/0   1/0   0/0   0/0

Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:

Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)

Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.

Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
 - dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
 - vectorSum
 - array shuffle, random subset
 - countOccurances (general forms, the char form is used in the codebase)
 - getNMaxElements
 - array permutation
 - sorted array permutation
 - compare floats
 - sum() (for integer arrays and lists).

Final keyword was extensively added to MathUtils.

The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).

The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.

In addition, more extensive tests were added for
 - logBinomialCoefficient (Newton's identity should always hold)
 - logFactorial
 - log10sumlog10 and its approximation

All unit tests pass
2013-03-28 23:25:28 -04:00
MauricioCarneiro a2b69790a6 Merge pull request #128 from broadinstitute/eb_rr_polyploid_compression_GSA-639 2013-03-28 06:39:43 -07:00
Mark DePristo fde7d36926 Updating md5s due to changes in assembly graph creation algorithms and default parameter 2013-03-27 15:31:24 -04:00
Mark DePristo 66910b036c Added new and improved suffix and node merging algorithms
-- These new algorithms are more powerful than the restricted diamond merging algoriths, in that they can merge nodes with multiple incoming and outgoing edges.  Together the splitter + merger algorithms will correctly merge many more cases than the original headless and tailless diamond merger.
-- Refactored haplotype caller infrastructure into graphs package, code cleanup
-- Cleanup new merging / splitting algorithms, with proper docs and unit tests
-- Fix bug in zipping of linear chains.  Because the multiplicity can be 0, protect ourselves with a max function call
-- Fix BaseEdge.max unit test
-- Add docs and some more unit tests
-- Move error correct from DeBruijnGraph to DeBruijnAssembler
-- Replaced uses of System.out.println with logger.info
-- Don't make multiplicity == 0 nodes look like they should be pruned
-- Fix toString of Path
2013-03-27 15:31:18 -04:00
Mark DePristo 78c672676b Bugfix for pruning and removing non-reference edges in graph
-- Previous algorithms were applying pruneGraph inappropriately on the raw sequence graph (where each vertex is a single base).  This results in overpruning of the graph, as prunegraph really relied on the zipping of linear chains (and the sharing of weight this provides) to avoid over-pruning the graph.  Probably we should think hard about this.  This commit fixes this logic, so we zip the graph between pruning
-- In this process ID's a fundamental problem with how we were trimming away vertices that occur on a path from the reference source to sink.  In fact, we were leaving in any vertex that happened to be accessible from source, any vertices in cycles, and any vertex that wasn't the absolute end of a chain going to a sink.  The new algorithm fixes all of this, using a BaseGraphIterator that's a general approach to walking the base graph.  Other routines that use the same traversal idiom refactored to use this iterator.  Added unit tests for all of these capabilities.
-- Created new BaseGraphIterator, which abstracts common access patterns to graph, and use this where appropriate
2013-03-26 14:27:18 -04:00
Mark DePristo ad04fdb233 PerReadAlleleLikelihoodMap getMostLikelyAllele returns an MostLikelyAllele objects now
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users.  The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not.  That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves.  There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second.  For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads.   All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event.  In this case our annotations will all fall apart, returning their default values.  Added a JIRA to address this (should be discussed in group meeting)
2013-03-26 14:27:13 -04:00
Mark DePristo 2472828e1c HC bug fixes: no longer create reference graphs with cycles
-- Though not intended, it was possible to create reference graphs with cycles in the case where you started the graph with a homopolymer of length > the kmer.  The previous test would fail to catch this case.  Now its not possible
-- Lots of code cleanup and refactoring in this push.  Split the monolithic createGraphFromSequences into simple calls to addReferenceKmersToGraph and addReadKmersToGraph which themselves share lower level functions like addKmerPairFromSeqToGraph.
-- Fix performance problem with reduced reads and the HC, where we were calling add kmer pair for each count in the reduced read, instead of just calling it once with a multiplicity of count.
-- Refactor addKmersToGraph() to use things like addOrUpdateEdge, now the code is very clear
2013-03-26 10:12:24 -04:00
Eric Banks 593d3469d4 Refactored the het (polyploid) consensus creation in ReduceReads.
* It is now cleaner and easier to test; added tests for newly implemented methods.
 * Many fixes to the logic to make it work
   * The most important change was that after triggering het compression we actually need to back it out if it
      creates reads that incorporated too many softclips at any one position (because they get unclipped).
   * There was also an off-by-one error in the general code that only manifested itself with het compression.
 * Removed support for creating a het consensus around deletions (which was broken anyways).
   * Mauricio gave his blessing for this.
 * Het compression now works only against known sites (with -known argument).
    * The user can pass in one or more VCFs with known SNPs (other variants are ignored).
    * If no known SNPs are provided het compression will automatically be disabled.
 * Added SAM tag to stranded (i.e. het compressed) reduced reads to distinguish their
   strandedness from normal reduced reads.
    * GATKSAMRecord now checks for this tag when determining whether or not the read is stranded.
    * This allows us to update the FisherStrand annotation to count het compressed reduced reads
       towards the FS calculation.
    * [It would have been nice to mark the normal reads as unstranded but then we wouldn't be
       backwards compatible.]
    * Updated integration tests accordingly with new het compressed bams (both for RR and UG).
 * In the process of fixing the FS annotation I noticed that SpanningDeletions wasn't handling
   RR properly, so I fixed it too.
    * Also, the test in the UG engine for determining whether there are too many overlapping
       deletions is updated to handle RR.
 * I added a special hook in the RR integration tests to additionally run the systematic
   coverage checking tool I wrote earlier.
    * AssessReducedCoverage is now run against all RR integration tests to ensure coverage is
       not lost from original to reduced bam.
    * This helped uncover a huge bug in the MultiSampleCompressor where it would drop reads
       from all but 1 sample (now fixed).
    * AssessReducedCoverage moved from private to protected for packaging reasons.
 * #resolve GSA-639

At this point, this commit encompasses most of what is needed for het compression to go live.
There are still a few TODO items that I want to get in before the 2.5 release, but I will save
those for a separate branch because as it is I feel bad for the person who needs to review all
these changes (sorry, Mauricio).
2013-03-25 09:34:54 -04:00
Mark DePristo 965043472a Vastly more powerful, cleaner graph simplification approach
-- Generalizes previous node merging and splitting approaches.  Can split common prefixes and suffices among nodes, build a subgraph representing this new structure, and incorporate it into the original graph.  Introduces the concept of edges with 0 multiplicity (for purely structural reasons) as well as vertices with no sequence (again, for structural reasons).  Fully UnitTested.  These new algorithms can now really simplify diamond configurations as well as ones sources and sinks that arrive / depart linearly at a common single root node.
-- This new suite of algorithms is fully integrated into the HC, replacing previous approaches
-- SeqGraph transformations are applied iteratively (zipping, splitting, merging) until no operations can be performed on the graph.  This further simplifies the graphs, as splitting nodes may enable other merging / zip operations to go.
2013-03-23 17:40:55 -04:00
Mark DePristo 7ae15dadbe HC now by default only uses reads with MAPQ >= 20 for assembly and calling
-- Previously we tried to include lots of these low mapping quality reads in the assembly and calling, but we effectively were just filtering them out anyway while generating an enormous amount of computational expense to handle them, as well as much larger memory requirements.  The new version simply uses a read filter to remove them upfront.  This causes no major problems -- at least, none that don't have other underlying causes -- compared to 10-11mb of the KB
-- Update MD5s to reflect changes due to no longer including mmq < 20 by default
2013-03-21 13:10:50 -04:00
Mark DePristo aa7f172b18 Cap the computational cost of the kmer based error correction in the DeBruijnGraph
-- Simply don't do more than MAX_CORRECTION_OPS_TO_ALLOW = 5000 * 1000 operations to correct a graph.  If the number of ops would exceed this threshold, the original graph is used.
-- Overall the algorithm is just extremely computational expensive, and actually doesn't implement the correct correction.  So we live with this limitations while we continue to explore better algorithms
-- Updating MD5s to reflect changes in assembly algorithms
2013-03-21 09:21:35 -04:00
Mark DePristo 6d7d21ca47 Bugfix for incorrect branch diamond merging algorithm
-- Previous version was just incorrectly accumulating information about nodes that were completely eliminated by the common suffix, so we were dropping some reference connections between vertices.  Fixed.  In the process simplified the entire algorithm and codebase
-- Resolves https://jira.broadinstitute.org/browse/GSA-884
2013-03-20 22:54:37 -04:00