-- It's useful to know which sites have been used in the training of the model. The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.
Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
-- The PairHMM no longer allows us to create haplotypes with 0 bases. The UG indel caller used to create such haplotypes. Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes#47523579]
-- Add pair cleaning feature. Reads in query-name sorted order are required and pairs need to appear consecutively, but if -cleanPairs option is set, a malformed pair where second read is missing is just skipped instead of erroring out.
-- Add integration tests
-- Move walker to public
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.
Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.
Summarized Changes
------------------
* Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
* Updated related MD5's
Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble. The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls. I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.
-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all
General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly. Depreciated old call to inline constants. This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default. Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
-- old algorithm was O(kmerSize * readLen) for each read. New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph. Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
-- The previous creation algorithm used the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to the graph
add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
update edge count by 1 if kmer1 -> kmer2 already existed in the graph
-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)). This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap
for each kmer pair 1 and 2 in the hash counter
add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
update edge count by count from map if kmer1 -> kmer2 already existed in the graph
-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
-Bamboo now uses the local mirrors for git checkouts, which should hopefully
resolve the intermittent long delays we've been seeing in Bamboo during git
operations
-Use a daemon process rather than a cron job to guarantee strict serial
execution of the git updates (since the time git update operations
require can vary). The spawn script for the daemon runs as a cron job
instead to make sure the daemon is always running and restart it if
necessary.
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:
X -> A -> B
Y -> A -> B
So that the incoming vertices of B all have the same sequence. This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph. Fixed and unit tested
-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging. So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph. Equals here means that all vertices have equivalents in both graphs, as do all edges. If the two graphs are equal we stop simplifying. It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
-- HC now throws a UserException if this model is provided. Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
Problem:
--------
Print Reads was running out of disk space when using the -BQSR option even for small bam files
Solution:
---------
Configure setupWriter to expect pre sorted reads
-- Add a maximum per sample and overall maximum number of reads held in memory by the ART at any one time. Does this in a new TAROrderedReadCache data structure that uses a reservior downsampler to limit the total number of reads to a constant amount. This constant is set to be by default 3000 reads * nSamples to a global maximum of 1M reads, all controlled via the ActiveRegionTraversalParameters annotation.
-- Added an integration test and associated excessively covered BAM excessiveCoverage.1.121484835.bam (private/testdata) that checks that the system is operating correctly.
-- #resolves GSA-921
-- This method provides client with the current number of elements, without having to retreive the underlying list<T>. Added unit tests for LevelingDownsampler and ReservoirDownsampler as these are the only two complex ones. All of the others are trivially obviously correct.
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5]. The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding. Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i. Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
-- Bugfix to puts all files in the subdirectory, regardless of whether the outputDir is provided with a ending / or not
-- UG now runs single threaded in GeneralCallingPipeline
-- GCP HC only needs 2 GB now
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models. Allowing cycles can be re-enabled with an HC command line switch.
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes. This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype. All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).