-- Adding changes to CombineVariants to work with the Reference Model mode of the HaplotypeCaller.
-- Added -combineAnnotations mode to CombineVariants to merge the info field annotations by taking the median
-- Added new StrandBiasBySample genotype annotation for use in computing strand bias from single sample input vcfs
-- Bug fixes to calcGenotypeLikelihoodsOfRefVsAny, used in isActive() as well as the reference model
-- Added active region trimming capabilities to the reference model mode, not perfect yet, turn off with --dontTrimActiveRegions
-- We only realign reads in the reference model if there are non-reference haplotypes, a big time savings
-- We only realign reads in the reference model if the read is informative for a particular haplotype over another
-- GVCF blocks will now track and output the minimum PLs over the block
-- MD5 changes!
-- HC tests: from bug fixes in calcGenotypeLikelihoodsOfRefVsAny
-- GVCF tests: from HC changes above and adding in active region trimming
PairHMMSyntheticBenchmark and PairHMMEmpirical benchmark were written to test the banded pairHMM, and were archived along with it. I returned them to the test directory for use in benchmarking the ArrayLoglessPairHMM. I commented out references to the banded pairHMM (which was left in archive), rather than removing those references entirely.
Renamed PairHMMEmpiricalBenchmark to PairHMMBandedEmpiricalBenchmark and returned it to the archive. It has a few problems for use as a general benchmark, including initializing the HMM too frequently and doing too much setup work in the 'time' method. However, since the size selection and debug printing are useful for testing the banded implementation, I decided to keep it as-is and archive it alongside with the other banded pairHMM classes. I did fix one bug that was causing the selectWorkingData function to return prematurely. As a result, the benchmark was only evaluating 4-40 pairHMM calls instead of the desired "maxRecords".
I wrote a new PairHMMEmpiricalBenchmark that simply works through a list of data, with setup work and hmm-initialization moved to its own function. This involved writing a new data read-in function in PairHMMTestData. The original was not maintaining the input data in order, the end result of which would be an over-estimate of how much caching we are able to do. The new benchmark class more closely mirrors real-world operation over large data.
It might be cleaner to fix some of the issues with the BandedEmpiricalBenchmark and use one read-in function. However, this would involve more extensive changes to:
PairHMMBandedEmpiricalBenchmark
PairHMMTestData
BandedLoglessPairHMMUnitTest
I decided against this as the banded benchmark and unit test are archived.
Returned Logless Caching implementation to the default in all cases. Changing to the array version will await performance benchmarking
Refactored many pieces of functionality in ArrayLoglessPairHMM into their own methods.
A new PairHMM implementation for read/haplotype likelihood calculations. Output is the same as the LOGLESS_CACHING version.
Instead of allocating an entire (read x haplotype) matrix for each HMM state, this version stores sub-computations in 1D arrays. It also accesses intersections of the (read x haplotype) alignment in a different order, proceeding over "diagonals" if we think of the alignment as a matrix.
This implementation makes use of haplotype caching. Because arrays are overwritten, it has to explicitly store mid-process information. Knowing where to capture this info requires us to look ahead at the subsequent haplotype to be analyzed. This necessitated a signature change in the primary method for all pairHMM implementations.
We also had to adjust the classes that employ the pairHMM:
LikelihoodCalculationEngine (used by HaplotypeCaller)
PairHMMIndelErrorModel (used by indel genotyping classes)
Made the array version the default in the HaplotypeCaller and the UnifiedArgumentCollection.
The latter affects classes:
ErrorModel
GeneralPloidyIndelGenotypeLikelihoodsCalculationModel
IndelGenotypeLikelihoodsCalculationModel
... all of which use the pairHMM via PairHMMIndelErrorModel
There is now a command-line option to set the model to use in the HC.
Incorporated Ryan's current (unmerged) branch in for most of these changes.
Because small changes to the math can have drastic effects, I decided not to let users tweak
the calculations themselves. Instead they can select either NONE, CONSERVATIVE (the default),
or AGGRESSIVE.
Note that any base insertion/deletion qualities from BQSR are still used.
Also, note that the repeat unit x repeat length approach gave very poor results against the KB,
so it is not included as an option here.
1. Some minor refactorings and claenup (e.g. removing unused imports) throughout.
2. Updates to the KB assessment functionality:
a. Exclude duplicate reads when checking to see whether there's enough coverage to make a call.
b. Lower the threshold on FS for FPs that would easily be filtered since it's only single sample calling.
3. Make the HC consistent in how it treats the pruning factor. As part of this I removed and archived
the DeBruijn assembler.
4. Improvements to the likelihoods for the HC
a. We now include a "tristate" correction in the PairHMM (just like we do with UG). Basically, we need
to divide e by 3 because the observed base could have come from any of the non-observed alleles.
b. We now correct overlapping read pairs. Note that the fragments are not merged (which we know is
dangerous). Rather, the overlapping bases are just down-weighted so that their quals are not more
than Q20 (or more specifically, half of the phred-scaled PCR error rate); mismatching bases are
turned into Q0s for now.
c. We no longer run contamination removal by default in the UG or HC. The exome tends to have real
sites with off kilter allele balances and we occasionally lose them to contamination removal.
5. Improved the dangling tail merging implementation.
-- Assembly graph building now returns an object that describes whether the graph was successfully built and has variation, was succesfully built but didn't have variation, or truly failed in construction. Fixing an annoying bug where you'd prefectly assembly the sequence into the reference graph, but then return a null graph because of this, and you'd increase your kmer because it null was also used to indicate assembly failure
--
-- Output format looks like:
20 10026072 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,120
20 10026073 . A <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,119
20 10026074 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,121
20 10026075 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,119
20 10026076 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,120
20 10026077 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,120
20 10026078 . C <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:5,0:5:15:0,15,217
20 10026079 . A <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:6,0:6:18:0,18,240
20 10026080 . G <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:6,0:6:18:0,18,268
20 10026081 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:7,0:7:21:0,21,267
We use a symbolic allele to indicate that the site is hom-ref, and because we have an ALT allele we can provide AD and PL field values. Currently these are calculated as ref vs. any non-ref value (mismatch or insertion) but doesn't yet account properly for alignment uncertainty.
-- Can we enabled for single samples with --emitRefConfidence (-ERC).
-- This is accomplished by realigning the each read to its most likley haplotype, and then evaluting the resulting pileups over the active region interval. The realignment is done by the HaplotypeBAMWriter, which now has a generalized interface that lets us provide a ReadDestination object so we can capture the realigned reads
-- Provide access to the more raw LocusIteratorByState constructor so we can more easily make them programmatically without constructing lots of misc. GATK data structures. Moved the NO_DOWNSAMPLING constant from LIBSDownsamplingInfo to LocusIteratorByState so clients can use it without making LIBSDownsamplingInfo a public class.
-- Includes GVCF writer
-- Add 1 mb of WEx data to private/testdata
-- Integration tests for reference model output for WGS and WEx data
-- Emit GQ block information into VCF header for GVCF mode
-- OutputMode from StandardCallerArgumentCollection moved to UnifiedArgumentCollection as its no longer relevant for HC
-- Control max indel size for the reference confidence model from the command line. Increase default to 10
-- Don't use out_mode in HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest
-- Unittests for ReferenceConfidenceModel
-- Unittests for new MathUtils functions
Improved AnalyzeCovariates (AC) integration test.
Renamed AC test files ending with .grp to .table
Implementation:
* Removed RECAL_PDF/CSV_FILE from RecalibrationArgumentCollection (RAC). Updated rest of the code accordingly.
* Fixed BQSRIntegrationTest to work with new changes
Implemtation details:
* Added tool class *.AnalyzeCovariates
* Added convenient addAll method to Utils to be able to add elements of an array.
* Added parameter comparison methods to RecalibrationArgumentCollection class in order to verify that multiple imput recalibration report are compatible and comparable.
* Modified the BQSR.R script to handle up to 3 different recalibration tables (-BQSR, -before and -after) and removed some irrelevant arguments (or argument values) from the output.
* Added an integration test class.
BandedHMM
---------
-- An implementation of a linear runtime, linear memory usage banded logless PairHMM. Thought about 50% faster than current PairHMM, this implementation will be superceded by the GraphHMM when it becomes available. The implementation is being archived for future reference
Useful infrastructure changes
-----------------------------
-- Split PairHMM into a N2MemoryPairHMM that allows smarter implementation to not allocate the double[][] matrices if they don't want, which was previously occurring in the base class PairHMM
-- Added functionality (controlled by private static boolean) to write out likelihood call information to a file from inside of LikelihoodCalculationEngine for using in unit or performance testing. Added example of 100kb of data to private/testdata. Can be easily read in with the PairHMMTestData class.
-- PairHMM now tracks the number of possible cell evaluations, and the LoglessCachingPairHMM updates the nCellsEvaluated so we can see how many cells are saved by the caching calculation.
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.
Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble. The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls. I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.
-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all
General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly. Depreciated old call to inline constants. This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default. Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
-- Ensure that BQSR works properly for an Ion Torrent BAM. (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator. For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed. Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well. Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp. In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M. The new code supports this. UnitTested and documented as well. LDMerger handles case where merging two alleles results in a no-op event. Merging CA/C + A/AA -> CAA/CAA -> no op. Handles this case by removing the two events. UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right). Here's the new algorithm:
* Compute probability that two variants are in phase with each other and that no
* compound hets exist in the population.
*
* Implemented as a likelihood ratio test of the hypothesis:
*
* x11 and x22 are the only haplotypes in the populations
*
* vs.
*
* all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
*
* Now, since we have to have both variants in the population, we exclude the x11 & x11 state. So the
* p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
*
* Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
*
* - P(x11 & x12 & x21) -- we have hom-ref and both hets
* - P(x22 & x12 & x21) -- we have hom-alt and both hets
* - P(x22 & x12) -- one haplotype is 22 and the other is het 12
* - P(x22 & x21) -- one haplotype is 22 and the other is het 21
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)
Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.
Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)
[fixes#47399227]
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
# Initial conditions were not being set properly
# Emission probabilities in the last row were not adding up to 1
The following commit fixes both by
# averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
# discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)
Summarized changes:
* Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
* Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
* Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
* Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
* Rename metric lengths to read and haplotype lengths for clarity
* Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
* Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
* Remove unnecessary parameters from updateCell()
* Fix the expected probabilities coming from the exact model in PairHMMUnitTest
* Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
* Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.
[fix 47164949]
--Mostly doc block tweaks
--Added @DocumentedGATKFeature to some walkers that were undocumented because they were ending up in "uncategorized". Very important for GSA: if a walker is in public or protected, it HAS to be properly tagged-in. If it's not ready for the public, it should be in private.
GATK-73 updated docs for bqsr args
GATK-9 differentiate CountRODs from CountRODsByRef
GATK-76 generate GATKDoc for CatVariants
GATK-4 made resource arg required
GATK-10 added -o, some docs to CountMales; some docs to CountLoci
GATK-11 fixed by MC's -o change; straightened out the docs.
GATK-77 fixed references to wiki
GATK-76 Added Ami's doc block
GATK-14 Added note that these annotations can only be used with VariantAnnotator
GATK-15 specified required=false for two arguments
GATK-23 Added documentation block
GATK-33 Added documentation
GATK-34 Added documentation
GATK-32 Corrected arg name and docstring in DiffObjects
GATK-32 Added note to DO doc about reference (required but unused)
GATK-29 Added doc block to CountIntervals
GATK-31 Added @Output PrintStream to enable -o
GATK-35 Touched up docs
GATK-36 Touched up docs, specified verbosity is optional
GATK-60 Corrected GContent annot module location in gatkdocs
GATK-68 touched up docs and arg docstrings
GATK-16 Added note of caution about calling RODRequiringAnnotations as a group
GATK-61 Added run requirements (num samples, min genotype quality)
Tweaked template and generic doc block formatting (h2 to h3 titles)
GATK-62 Added a caveat to HR annot
Made experimental annotation hidden
GATK-75 Added setup info regarding BWA
GATK-22 Clarified some argument requirements
GATK-48 Clarified -G doc comments
GATK-67 Added arg requirement
GATK-58 Added annotation and usage docs
GSATDG-96 Corrected doc
Updated MD5 for DiffObjectsIntegrationTests (only change is link in table title)
* ReadTransformers can say they must be first, must be last, or don't care.
* By default, none of the existing ones care about ordering except BQSR (must be first).
* This addresses a bug reported on the forum where BAQ is incorrectly applied before BQSR.
* The engine now orders the read transformers up front before applying iterators.
* The engine checks for enabled RTs that are not compatible (e.g. both must be first) and blows up (gracefully).
* Added unit tests.
* Removed from codebase NestedHashMap since it is unused and untested.
* Integration tests change because the BQSR CSV is now sorted automatically.
* Resolves GSA-732
-- Fixed a few conversion bugs with edge case quals (ones that were very high)
-- Fixed a critical bug in the conversion of quals that was causing near capped quals to fall below their actual value. Will undoubtedly need to fix md5s
-- More precise prob -> qual calculations for very high confidence events in phredScaleCorrectRate, trueProbToQual, and errorProbToQual. Very likely to improve accuracy of many calculations in the GATK
-- Added errorProbToQual and trueProbToQual calculations that accept an integer cap, and perform the (tricky) conversion from int to byte correctly.
-- Full docs and unit tests for phredScaleCorrectRate and phredScaleErrorRate.
-- Renamed probToQual to trueProbToQual
-- Added goodProbability and log10OneMinusX to MathUtils
-- Went through the GATK and cleaned up many uses of QualityUtils
-- Cleanup constants in QualityUtils
-- Added full docs for all of the constants
-- Rename MAX_QUAL_SCORE to MAX_SAM_QUAL_SCORE for clarity
-- Moved MAX_GATK_USABLE_Q_SCORE to RecalDatum, as it's s BQSR specific feature
-- Convert uses of QualityUtils.errorProbToQual(1-x) to QualityUtils.trueProbToQual(x)
-- Cleanup duplicate quality score routines in MathUtils. Moved and renamed MathUtils.log10ProbabilityToPhredScale => QualityUtils.phredScaleLog10ErrorRate. Removed 3 routines from MathUtils, and remapped their usages into the better routines in QualityUtils
-- Uses 1/N for N potential start sites as the probability of starting at any one of the potential start sites
-- Add flag that says to use the original edge condition, respected by all subclasses. This brings the new code back to the original state, but with all of the cleanup I've done
-- Only test configurations where the read length <= haplotype length. I think this is actually the contract, but we'll talk about this tomorrow
-- Fix egregious bug with the myLog10SumLog10 function doing the exact opposite of the requested arguments, so that doExact really meant don't do exact
-- PairHMM now exposes computeReadLikelihoodGivenHaplotypeLog10 but subclasses must overload subComputeReadLikelihoodGivenHaplotypeLog10. This protected function does the work, and the public function will do argument and result QC
-- Have to be more tolerant of reference (approximate) HMM. All unit tests from the original HMM implementations pass now
-- Added locs of docs
-- Generalize unit tests with multiple equivalent matches of read to haplotype
-- Added runtime argument checking for initial and computeReadLikelihoodGivenHaplotypeLog10
-- Functions to dumpMatrices for debugging
-- Fix nasty bug (without original unit tests) in LoglessPairHMM
-- Max read and haplotype lengths only worked in previous code if they were exactly equal to the provided read and haplotype sizes. Fixed bug. Added unit test to ensure this doesn't break again.
-- Added dupString(string, n) method to Utils
-- Added TODOs for next commit. Need to compute number of potential start sites not in initialize but in the calc routine since this number depends not on the max sizes but the actual read sizes
-- Unit tests for the hapStartIndex functionality of PairHMM
-- Moved computeFirstDifferingPosition to PairHMM, and added unit tests
-- Added extensive unit tests for the hapStartIndex functionality of computeReadLikelihoodGivenHaplotypeLog10
-- Still TODOs left in the code that I'll fix up
-- Logless now compute constants, if they haven't been yet initialized, even if you forgot to say so
-- General: the likelihood penalty for potential start sites is now properly computed against the actual read and reference bases, not the maximum. This involved moving some initialize() code into the computeLikelihoods function. That's ok because all of the potential log10 functions are actually going to cached versions, so the slowdown is minimal
-- Added some unit tests to ensure that common errors (providing haplotypes too long, reads too long, not initializing the HMM) are captured as errors
-- Would have been squashed but could not because of subsequent deletion of Caching and Exact/Original PairHMMs
-- Actual working unit tests for PairHMMUnitTest
-- Fixed incorrect logic in how I compared hmm results to the theoretical and exact results
-- PairHMM has protected variables used throughout the subclasses
- Throws user exception if it is.
- Can be turned off with --allow_bqsr_on_reduced_bams_despite_repeated_warnings argument.
- Added test to check this is working.
- Added docs to BQSRReadTransformer explaining why this check is not performed on PrintReads end.
- Added small bug fix to GenomeAnalysisEngine that I uncovered in this process.
- Added comment about not changing the program record name, as per reviewer comments.
- Removed unused variable.
- It's now written into the recal report so that it can be used in the PrintReads step.
- Note that we also now write the --deletions_default_quality value which accidentally wasn't being written before!
- Added tests to make sure that the value of the --maximum_cycle_value is being used properly by PR with -BQSR.
(This is my last non-branch commit; all future pushes will follow new GATK practices)