Commit Graph

1473 Commits (3cc7d7e56daee63338b013e5471a8d052cab4e3c)

Author SHA1 Message Date
Scott Thibault 5d198d3400 Added write to likelihoods.txt for batch hmm 2013-07-15 10:16:39 -05:00
sathibault 0a8f75b953 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
2013-07-15 08:17:32 -05:00
Mauricio Carneiro 8c07614321 QualifyMissingIntervals: support different formats
Problem
-------
Qualify Missing Intervals only accepted GATK formatted interval files for it's coding sequence and bait parameters.

Solution
-------
There is no reason for such limitation, I erased all the code that did the parsing and used IntervalUtils to parse it (therefore, now it handles any type of interval file that the GATK can handle).

ps: Also added an average depth column to the output
2013-07-12 17:32:53 -04:00
Yossi Farjoun afcf7b96db - Added per-sample AlleleBiasedDownsampling capability to HaplotypeCaller
- Added integration test to show that providing a contamination value and providing same value via a file results in the same VCF

- overrode default contamination value in test
2013-07-12 16:22:02 -04:00
Eric Banks b16c7ce050 A whole slew of improvements to the Haplotype Caller and related code.
1. Some minor refactorings and claenup (e.g. removing unused imports) throughout.

2. Updates to the KB assessment functionality:
   a. Exclude duplicate reads when checking to see whether there's enough coverage to make a call.
   b. Lower the threshold on FS for FPs that would easily be filtered since it's only single sample calling.

3. Make the HC consistent in how it treats the pruning factor.  As part of this I removed and archived
   the DeBruijn assembler.

4. Improvements to the likelihoods for the HC
   a. We now include a "tristate" correction in the PairHMM (just like we do with UG).  Basically, we need
      to divide e by 3 because the observed base could have come from any of the non-observed alleles.
   b. We now correct overlapping read pairs.  Note that the fragments are not merged (which we know is
      dangerous).  Rather, the overlapping bases are just down-weighted so that their quals are not more
      than Q20 (or more specifically, half of the phred-scaled PCR error rate); mismatching bases are
      turned into Q0s for now.
   c. We no longer run contamination removal by default in the UG or HC.  The exome tends to have real
      sites with off kilter allele balances and we occasionally lose them to contamination removal.

5. Improved the dangling tail merging implementation.
2013-07-12 10:09:10 -04:00
sathibault 23fe3e449a Revert "Fixed batching bug."
This reverts commit 3e56c83d0eec7c374e5f187d1ef124d42ecc071e.
2013-07-11 11:30:37 -05:00
sathibault 7458b59bb3 Fixed batching bug. 2013-07-11 11:08:46 -05:00
Menachem Fromer a8ea57df9e Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-07-10 16:44:35 -04:00
Guillermo del Angel aba55dbb23 Moved some HC parameters related to active region extensions to command line arguments so that they're more easily modified. Some of these parameters need tinkering in order to call some large indels. See GSA-891 and subtasks for particular examples thereof. 2013-07-10 14:31:10 -04:00
Eric Banks 73fc7f6ab1 Reduce Reads output should never be expected to be sorted (hence the need to sort on disk) but for some reason it was with -nwayout mode. 2013-07-08 10:33:36 -04:00
Eric Banks 5f5c90e65c Fix bug introduced recently in the VariantAnnotator where only the last -comp was being annotated at a site.
Trivial fix, added integration test to cover it.
2013-07-05 00:04:52 -04:00
Mark DePristo 5f34054cc1 Remove filtering of MAPQ 0 reads from CalledHaplotypeBAMWriter 2013-07-02 15:46:49 -04:00
Mark DePristo ed0b1c5aba Fix bug in ReadThreadingAssembler in cycle failures causing NPE 2013-07-02 15:46:48 -04:00
Mark DePristo e3e8631ff5 Working version of HaplotypeCaller ReferenceConfidenceModel that accounts for indels as well as SNP confidences
-- Assembly graph building now returns an object that describes whether the graph was successfully built and has variation, was succesfully built but didn't have variation, or truly failed in construction.  Fixing an annoying bug where you'd prefectly assembly the sequence into the reference graph, but then return a null graph because of this, and you'd increase your kmer because it null was also used to indicate assembly failure
--
-- Output format looks like:
20      10026072        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026073        .       A       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,119
20      10026074        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,121
20      10026075        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,119
20      10026076        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026077        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026078        .       C       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:5,0:5:15:0,15,217
20      10026079        .       A       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:6,0:6:18:0,18,240
20      10026080        .       G       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:6,0:6:18:0,18,268
20      10026081        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:7,0:7:21:0,21,267

We use a symbolic allele to indicate that the site is hom-ref, and because we have an ALT allele we can provide AD and PL field values.  Currently these are calculated as ref vs. any non-ref value (mismatch or insertion) but doesn't yet account properly for alignment uncertainty.
-- Can we enabled for single samples with --emitRefConfidence (-ERC).
-- This is accomplished by realigning the each read to its most likley haplotype, and then evaluting the resulting pileups over the active region interval.  The realignment is done by the HaplotypeBAMWriter, which now has a generalized interface that lets us provide a ReadDestination object so we can capture the realigned reads
-- Provide access to the more raw LocusIteratorByState constructor so we can more easily make them programmatically without constructing lots of misc. GATK data structures.  Moved the NO_DOWNSAMPLING constant from LIBSDownsamplingInfo to LocusIteratorByState so clients can use it without making LIBSDownsamplingInfo a public class.
-- Includes GVCF writer
-- Add 1 mb of WEx data to private/testdata
-- Integration tests for reference model output for WGS and WEx data
-- Emit GQ block information into VCF header for GVCF mode
-- OutputMode from StandardCallerArgumentCollection moved to UnifiedArgumentCollection as its no longer relevant for HC
-- Control max indel size for the reference confidence model from the command line.  Increase default to 10
-- Don't use out_mode in HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest
-- Unittests for ReferenceConfidenceModel
-- Unittests for new MathUtils functions
2013-07-02 15:46:38 -04:00
Mark DePristo 41aba491c0 Critical bugfix for adapter clipping in HaplotypeCaller
-- The previous code would adapter clip before reverting soft clips, so because we only clip the adapter when it's actually aligned (i.e., not in the soft clips) we were actually not removing bases in the adapter unless at least 1 bp of the adapter was aligned to the reference.  Terrible.
-- Removed the broken logic of determining whether a read adaptor is too long.
-- Doesn't require isProperPairFlag to be set for a read to be adapter clipped
-- Update integration tests for new adapter clipping code
2013-07-02 15:46:36 -04:00
Scott Thibault 82dcdc01c0 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java
2013-06-28 10:13:05 -05:00
Scott Thibault e691fa3e19 FPGA null pointer bug fix 2013-06-28 08:52:09 -05:00
Ryan Poplin 825b603acb Merge pull request #298 from broadinstitute/md_likelihood_rank_sum
Md likelihood rank sum
2013-06-27 11:14:25 -07:00
Mark DePristo a514dd0643 Merge pull request #307 from broadinstitute/eb_rr_off_by_one_error
Proper fix for previous RR -cancer_mode fix.
2013-06-26 13:02:23 -07:00
Eric Banks 876e40466a Proper fix for previous RR -cancer_mode fix.
I "fixed" this once before but instead of testing with unit tests I used integration tests.
Bad decision.

The proper fix is in now, with a bonafide unit test included.
2013-06-26 14:48:09 -04:00
Eric Banks f242be12c0 Make this walker @Hidden 2013-06-26 11:45:21 -04:00
Mark DePristo ff76d0c877 Merge pull request #304 from broadinstitute/eb_rr_header_negative_fix_again
Fixing the 'header is negative' problem in Reduce Reads... again.
2013-06-24 11:55:52 -07:00
Eric Banks 165b936fcd Fixing the 'header is negative' problem in Reduce Reads... again.
Previous fixes and tests only covered trailing soft-clips.  Now that up front
hard-clipping is working properly though, we were failing on those in the tool.

Added a patch for this as well as a separate test independent of the soft-clips
to make sure that it's working properly.
2013-06-24 14:06:21 -04:00
Valentin Ruano-Rubio b97f9a487d Merged bug fix from Stable into Unstable 2013-06-24 14:00:01 -04:00
Mark DePristo 191e4ca251 Merge pull request #300 from broadinstitute/mc_move_qualify_intervals_to_protected
Few bug fixes to this tool now that it is in protected
2013-06-24 09:35:45 -07:00
Valentin Ruano-Rubio 3e5ff6095f Added the pertinent DocumentedGATKFeature annotation ot AnalyzeCovariates 2013-06-21 17:02:26 -04:00
Eric Banks d976aae2b1 Another fix for the Indel Realigner that arises because of secondary alignments.
This time we don't accidentally drop reads (phew), but this bug does cause us not to
update the alignment start of the mate.  Fixed and added unit test to cover it.
2013-06-21 16:59:22 -04:00
Mark DePristo 8caf39cb65 Experimental LikelihoodRankSum annotation
-- Added experimental LikelihoodRankSum, which required slightly more detailed access to the information managed by the base class, so added an overloaded getElementForRead also provides access to the MostLikelyAllele class
-- Added base class default implementation of getElementForPileupElement() which returns null, indicating that the pileup version isn't supported.
-- Added @Override to many of the RankSum classes for safety's sake

-- Updates to GeneralCallingPipeline: annotate sites with dbSNP IDs,
-- R script to assess the value of annotations for VQSR
2013-06-21 13:57:11 -04:00
Mark DePristo f726d8130a VariantRecalibrator bugfix for bad log10sumlog10 values
-- The VR, when the model is bad, may evaluate log10sumlog10 where some of the values in the vector are NaN. This case is now trapped in VR and handled as previously -- indicating that the model has failed and evaluation continues.
2013-06-21 12:28:53 -04:00
Mark DePristo dee51c4189 Error out when NCT and BAMOUT are used with the HaplotypeCaller
-- Currently we don't support writing a BAM file from the haplotype caller when nct is enabled.  Check in initialize if this is the case, and throw a UserException
2013-06-21 09:25:57 -04:00
Mark DePristo fdfe4e41d5 Better GATK version and command line output
-- Previous version emitted command lines that look like:

##HaplotypeCaller="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] ..."

the new version provides additional information on when the GATK was run and the GATK version in a nicer format:

 ##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] read_buffer_size=null phone_home=AWS ...">

 -- Additionally, the command line options are emitted sequentially in the file, so you can see a running record of how a VCF was produced, such as this example from the integration test:

 ##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="lots of stuff">
 ##GATKCommandLine=<ID=SelectVariants,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:16:23 EDT 2013",Epoch=1371741383277,CommandLineOptions="lots of stuff">

 -- Removed the ProtectedEngineFeaturesIntegrationTest
 -- Actual unit tests for these features!
2013-06-20 11:19:13 -04:00
sathibault 3db8908ae8 Remove debug print statement 2013-06-20 08:28:58 -05:00
Mark DePristo 0672ac5032 Fix public / protected dependency 2013-06-19 19:42:09 -04:00
Valentin Ruano-Rubio 1f8282633b Removed plots generation from the BaseRecalibration software
Improved AnalyzeCovariates (AC) integration test.
Renamed AC test files ending with .grp to .table

Implementation:

* Removed RECAL_PDF/CSV_FILE from RecalibrationArgumentCollection (RAC). Updated rest of the code accordingly.
* Fixed BQSRIntegrationTest to work with new changes
2013-06-19 14:47:56 -04:00
Valentin Ruano-Rubio 08f92bb6f9 Added AnalyzeCovariates tool to generate BQSR assessment quality plots.
Implemtation details:

* Added tool class *.AnalyzeCovariates
* Added convenient addAll method to Utils to be able to add elements of an array.
* Added parameter comparison methods to RecalibrationArgumentCollection class in order to verify that multiple imput recalibration report are compatible and comparable.
* Modified the BQSR.R script to handle up to 3 different recalibration tables (-BQSR, -before and -after) and removed some irrelevant arguments (or argument values) from the output.
* Added an integration test class.
2013-06-19 14:38:02 -04:00
Guillermo del Angel f176c854c6 Swapping in logless Pair HMM for default usage with UG:
-- Changed default HMM model.
-- Removed check.
-- Changed md5's: PL's in the high 100s change by a point or two due to new implementation.
-- Resulting performance improvement is about 30 to 50% less runtime when using -glm INDEL.
2013-06-18 10:06:27 -04:00
Ryan Poplin 8511c4385c Adding new pruning parameter to ReadThreadingAssembler
-- numPruningSamples allows one to specify that the minPruning factor must be met by this many samples for a path to be considered good (e.g. seen twice in three samples). By default this is just one sample.
-- adding unit test to test this new functionality
2013-06-17 16:46:40 -04:00
Guillermo del Angel f6025d25ae Feature requested by Reich lab and Paavo lab in Leipzig for ancient DNA processing:
-- When doing cross-species comparisons and studying population history and ancient DNA data, having SOME measure of confidence is needed at every single site that doesn't depend on the reference base, even in a naive per-site SNP mode. Old versions of GATK provided GQ and some wrong PL values at reference sites but these were wrong. This commit addresses this need by adding a new UG command line argument, -allSitePLs, that, if enabled will:
a) Emit all 3 ALT snp alleles in the ALT column.
b) Emit all corresponding 10 PL values.
It's up to the user to process these PL values downstream to make sense of these. Note that, in order to follow VCF spec, the QUAL field in a reference call when there are non-null ALT alleles present will be zero, so QUAL will be useless and filtering will need to be done based on other fields.
-- Tweaks and fixes to processing pipelines for Reich lab.
2013-06-17 13:21:09 -04:00
delangel 485ceb1e12 Merge pull request #283 from broadinstitute/md_beagleoutput
Simpler FILTER and info field encoding for BeagleOutputToVCF
2013-06-17 09:31:03 -07:00
Eric Banks e48f754478 Fixes to several of the annotations for reduced reads (and other issues).
1. Have the RMSMappingQuality annotation take into account the fact that reduced reads represent multiple reads.

2. The rank sume tests should not be using reduced reads (because they do not represent distinct observations).

3. Fixed a massive bug in the BaseQualityRankSumTest annotation!  It was not using the base qualities but rather
the read likelihoods?!

Added a unit test for Rank Sum Tests to prove that the distributions are correctly getting assigned appropriate p-values.
Also, and just as importantly, the test shows that using reduced reads in the rank sum tests skews the results and
makes insignificant distributions look significant (so it can falsely cause the filtering of good sites).

Also included in this commit is a massive refactor of the RankSumTest class as requested by the reviewer.
2013-06-16 01:18:20 -04:00
Mark DePristo 1677a0a458 Simpler FILTER and info field encoding for BeagleOutputToVCF
-- Previous version created FILTERs for each possible alt allele when that site was set to monomorphic by BEAGLE.  So if you had a A/C SNP in the original file and beagle thought it was AC=0, then you'd get a record with BGL_RM_WAS_A in the FILTER field.  This obviously would cause problems for indels, as so the tool was blowing up in this case.  Now beagle sets the filter field to BGL_SET_TO_MONOMORPHIC and sets the info field annotation OriginalAltAllele to A instead.  This works in general with any type of allele.
 -- Here's an example output line from the previous and current versions:
 old: 20    64150   rs7274499       C       .       3041.68 BGL_RM_WAS_A    AN=566;DB;DP=1069;Dels=0.00;HRun=0;HaplotypeScore=238.33;LOD=3.5783;MQ=83.74;MQ0=0;NumGenotypesChanged=1;OQ=1949.35;QD=10.95;SB=-6918.88
 new: 20    64062   .       G       .       100.39  BGL_SET_TO_MONOMORPHIC  AN=566;DP=1108;Dels=0.00;HRun=2;HaplotypeScore=221.59;LOD=-0.5051;MQ=85.69;MQ0=0;NumGenotypesChanged=1;OQ=189.66;OriginalAltAllele=A;QD=15.81;SB=-6087.15
-- update MD5s to reflect these changes
-- [delivers #50847721]
2013-06-14 15:56:13 -04:00
Mark DePristo dd5674b3b8 Add genotyping accuracy assessment to AssessNA12878
-- Now table looks like:

Name     VariantType  AssessmentType           Count
variant  SNPS         TRUE_POSITIVE              1220
variant  SNPS         FALSE_POSITIVE                0
variant  SNPS         FALSE_NEGATIVE                1
variant  SNPS         TRUE_NEGATIVE               150
variant  SNPS         CALLED_NOT_IN_DB_AT_ALL       0
variant  SNPS         HET_CONCORDANCE          100.00
variant  SNPS         HOMVAR_CONCORDANCE        99.63
variant  INDELS       TRUE_POSITIVE               273
variant  INDELS       FALSE_POSITIVE                0
variant  INDELS       FALSE_NEGATIVE               15
variant  INDELS       TRUE_NEGATIVE                79
variant  INDELS       CALLED_NOT_IN_DB_AT_ALL       2
variant  INDELS       HET_CONCORDANCE           98.67
variant  INDELS       HOMVAR_CONCORDANCE        89.58

-- Rewrite / refactored parts of subsetDiploidAlleles in GATKVariantContextUtils to have a BEST_MATCH assignment method that does it's best to simply match the genotype after subsetting to a set of alleles.  So if the original GT was A/B and you subset to A/B it remains A/B but if you subset to A/C you get A/A.  This means that het-alt B/C genotypes become A/B and A/C when subsetting to bi-allelics which is the convention in the KB.  Add lots of unit tests for this functions (from 0 previously)
-- BadSites in Assessment now emits TP sites with discordant genotypes with the type GENOTYPE_DISCORDANCE and tags the expected genotype in the info field as ExpectedGenotype, such as this record:

20      10769255        .       A       ATGTG   165.73  .       ExpectedGenotype=HOM_VAR;SupportingCallsets=ebanks,depristo,CEUTrio_best_practices;WHY=GENOTYPE_DISCORDANCE     GT:AD:DP:GQ:PL  0/1:1,9:10:6:360,0,6

Indicating that the call was a HET but the expected result was HOM_VAR
-- Forbid subsetting of diploid genotypes to just a single allele.
-- Added subsetToRef as a separate specific function.  Use that in the DiploidExactAFCalc in the case that you need to reduce yourself to ref only. Preserves DP in the genotype field when this is possible, so a few integration tests have changed for the UG
2013-06-13 15:05:32 -04:00
Mark DePristo 33720b83eb No longer merge overlapping fragments from HaplotypeCaller
-- Merging overlapping fragments turns out to be a bad idea.  In the case where you can safely merge the reads you only gain a small about of overlapping kmers, so the potential gains are relatively small.  That's in contrast to the very large danger of merging reads inappropriately, such as when the reads only overlap in a repetitive region, and you artificially construct reads that look like the reference but actually may carry a larger true insertion w.r.t. the reference.  Because this problem isn't limited to repetitive sequeuence, but in principle could occur in any sequence, it's just not safe to do this merging.  Best to leave haplotype construction to the assembly graph.
2013-06-13 15:05:32 -04:00
Mark DePristo c837d67b2f Merge pull request #273 from broadinstitute/rp_readIsPoorlyModelled
Relaxing the constraints on the readIsPoorlyModelled function.
2013-06-13 08:40:24 -07:00
Ryan Poplin f44efc27ae Relaxing the constraints on the readIsPoorlyModelled function.
-- Turns out we were aggressively throwing out borderline-good reads.
2013-06-13 11:06:23 -04:00
Ryan Poplin d5f0848bd5 HC bam writer now sets the read to MQ0 if it isn't informative
-- Makes visualization of read evidence easier in IGV.
2013-06-13 10:11:54 -04:00
sathibault 336050ab71 Merge branch 'master' into st_fpga_hmm
Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java
	protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java
2013-06-13 07:28:24 -05:00
Ryan Poplin d1f397c711 Fixing bug with dangling tails in which the tail connects all the way back to the reference source node.
-- List of vertices can't contain a source node.
2013-06-12 12:23:01 -04:00
Ryan Poplin e1fd3dff9a Merge pull request #268 from broadinstitute/eb_calling_accuracy_improvements_to_HC
Eb calling accuracy improvements to hc
2013-06-11 11:18:51 -07:00
Eric Banks 2c3c680eb7 Misc changes and cleanup from all previous commits in this push.
1. By default, do not include the UG CEU callset for assessment.
2. Updated md5s that are different now with all the HC changes.
2013-06-11 12:53:11 -04:00
Eric Banks dadcfe296d Reworking of the dangling tails merging code.
We now run Smith-Waterman on the dangling tail against the corresponding reference tail.
If we can generate a reasonable, low entropy alignment then we trigger the merge to the
reference path; otherwise we abort.  Also, we put in a check for low-complexity of graphs
and don't let those pass through.

Added tests for this implementation that checks exact SW results and correct edges added.
2013-06-11 12:53:04 -04:00
Guillermo del Angel 55d5f2194c Read Error Corrector for haplotype assembly
Principle is simple: when coverage is deep enough, any single-base read error will look like a rare k-mer but correct sequence will be supported by many reads to correct sequences will look like common k-mers. So, algorithm has 3 main steps:
1. K-mer graph buildup.
For each read in an active region, a map from k-mers to the number of times they have been seen is built.
2. Building correction map.
All "rare" k-mers that are sparse (by default, seen only once), get mapped to k-mers that are good (by default, seen at least 20 times but this is a CL argument), and that lie within a given Hamming distance (by default, =1). This map can be empty (i.e. k-mers can be uncorrectable).
3. Correction proposal
For each constituent k-mer of each read, if this k-mer is rare and maps to a good k-mer, get differing base positions in k-mer and add these to a list of corrections for each base in each read. Then, correct read at positions where correction proposal is unanimous and non-empty.

The algorithm defaults are chosen to be very stringent and conservative in the correction: we only try to correct singleton k-mers, we only look for good k-mers lying at Hamming distance = 1 from them, and we only correct a base in read if all correction proposals are congruent.

By default, algorithm is disabled but can be enabled in HaplotypeCaller via the -readErrorCorrect CL option. However, at this point it's about 3x-10x more expensive so it needs to be optimized if it's to be used.
2013-06-11 12:26:24 -04:00
Eric Banks c0030f3f2d We no longer subset down to the best N haplotypes for the GL calculation.
I explain in comments within the code that this was causing problems with the marginalization over events.
2013-06-11 11:51:26 -04:00
Eric Banks c0e3874db0 Change the HC's phredScaledGlobalReadMismappingRate from 60 to 45, because Ryan and Mark told me to. 2013-06-11 11:51:26 -04:00
Eric Banks 77868d034f Do not allow the use of Ns in reads for graph construction.
Ns are treated as wildcards in the PairHMM so creating haplotypes with Ns gives them artificial advantages over other ones.
This was the cause of at least one FN where there were Ns at a SNP position.
2013-06-11 11:51:26 -04:00
Eric Banks e4e7d39e2c Fix FN problem stemming from sequence graphs that contain cycles.
Problem:
The sequence graphs can get very complex and it's not enough just to test that any given read has non-unique kmers.
Reads with variants can have kmers that match unique regions of the reference, and this causes cycles in the final
sequence graph.  Ultimately the problem is that kmers of 10/25 may not be large enough for these complex regions.

Solution:
We continue to try kmers of 10/25 but detect whether cycles exist; if so, we do not use them.  If (and only if) we
can't get usable graphs from the 10/25 kmers, then we start iterating over larger kmers until we either can generate
a graph without cycles or attempt too many iterations.
2013-06-11 11:51:26 -04:00
Ryan Poplin 58e354176e Minor changes to docs in the graph pruning. 2013-06-11 10:33:22 -04:00
Mark DePristo 1c03ebc82d Implement ActiveRegionTraversal RefMetaDataTracker for map call; HaplotypeCaller now annotates ID from dbSNP
-- Reuse infrastructure for RODs for reads to implement general IntervalReferenceOrderedView so that both TraverseReads and TraverseActiveRegions can use the same underlying infrastructure
-- TraverseActiveRegions now provides a meaningful RefMetaDataTracker to ActiveRegionWalker.map
-- Cleanup misc. code as it came up
-- Resolves GSA-808: Write general utility code to do rsID allele matching, hook up to UG and HC
2013-06-10 16:20:31 -04:00
Mark DePristo 0d593cff70 Refactor rsID and overlap detection in VariantOverlapAnnotator utility class
-- Variants will be considered matching if they have the same reference allele and at least 1 common alternative allele.  This matching algorithm determines how rsID are added back into the VariantContext we want to annotate, and as well determining the overlap FLAG attribute field.
-- Updated VariantAnnotator and VariantsToVCF to use this class, removing its old stale implementation
-- Added unit tests for this VariantOverlapAnnotator class
-- Removed GATKVCFUtils.rsIDOfFirstRealVariant as this is now better to use VariantOverlapAnnotator
-- Now requires strict allele matching, without any option to just use site annotation.
2013-06-10 15:51:13 -04:00
Mauricio Carneiro 1d67d07cf1 better docs for Qualify Missing Intervals
now that it's available to the public, better give'em good docs!
2013-06-10 15:17:40 -04:00
Mauricio Carneiro c84f0deb1d Don't crash if cds file is not provided
CDS file should be optional.
2013-06-10 13:42:00 -04:00
Mauricio Carneiro a95fbd48e5 Moving QualifyMissingIntervals to protected
Making this walker available so we can share it with the CSER group for CLIA analysis.
2013-06-10 13:11:41 -04:00
Valentin Ruano-Rubio 96073c3058 This commit addresses JIRA issue GSA-948: Prevent users from doing the wrong thing with RNA-Seq data and the GATK.
The previous behavior is to process reads with N CIGAR operators as they are despite that many of the tools do not actually support such operator and results become unpredictible.

Now if the there is some read with the N operator, the engine returns a user exception. The error message indicates what is the problem (including the offending read and mapping position) and give a couple of alternatives that the user can take in order to move forward:

a) ask for those reads to be filtered out (with --filter_reads_with_N_cigar or -filterRNC)

b) keep them in as before (with -U ALLOW_N_CIGAR_READS or -U ALL)

Notice that (b) does not have any effect if (a) is enacted; i.e. filtering overrides ignoring.

Implementation:

* Added filterReadsWithMCigar argument to MalformedReadFilter with the corresponding changes in the code to get it to work.
* Added ALLOW_N_CIGAR_READS unsafe flag so that N cigar containing reads can be processed as they are if that is what the user wants.
* Added ReadFilterTest class commont parent for ReadFilter test cases.
* Refactor ReadGroupBlackListFilterUnitTest to extend ReadFilterTest and push up some functionality to that class.
* Modified MalformedReadFilterUnitTest to extend ReadFilterTest and to test the new filter functionality.
* Added AllowNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALLOW_N_CIGAR_READS flag is used.
* Added UnsafeNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALL flag is used.
* Updated a broken test case in UnifiedGenotyperIntegrationTest resulting from the new behavior.
* Updated EngineFeaturesIntegrationTest testdata to be compliant with new behavior
2013-06-10 10:44:42 -04:00
Michael McCowan 00c06e9e52 Performance improvements:
- Memoized MathUtil's cumulative binomial probability function.
 - Reduced the default size of the read name map in reduced reads and handle its resets more efficiently.
2013-06-09 11:26:52 -04:00
Mark DePristo 209dd64268 HaplotypeCaller now emits per-sample DP
-- Created a new annotation DepthPerSampleHC that is by default on in the HaplotypeCaller
-- The depth for the HC is the sum of the informative alleles at this site.  It's not perfect (as we cannot differentiate between reads that align over the event but aren't informative vs. those that aren't even close) but it's a pretty good proxy and it matches with the AD field (i.e., sum(AD) = DP).
-- Update MD5s
-- delivers [#48240601]
2013-06-06 09:47:32 -04:00
Mark DePristo 34bdf20132 Bugfix for bad AD values in UG/HC
-- In the case where we have multiple potential alternative alleles *and* we weren't calling all of them (so that n potential values < n called) we could end up trimming the alleles down which would result in the mismatch between the PerReadAlleleLikelihoodMap alleles and the VariantContext trimmed alleles.
-- Fixed by doing two things (1) moving the trimming code after the annotation call and (2) updating AD annotation to check that the alleles in the VariantContext and the PerReadAlleleLikelihoodMap are concordant, which will stop us from degenerating in the future.
-- delivers [#50897077]
2013-06-05 17:48:41 -04:00
Mark DePristo c9f5b53efa Bugfix for HC can fail to assemble the correct reference sequence in some cases
-- Ultimately this was caused by overly aggressive merging of CommonSuffixMerger.  In the case where you have this graph:

ACT [ref source] -> C
G -> ACT -> C

we would merge into

G -> ACT -> C

which would linearlize into

GACTC

Causing us to add bases to the reference source node that couldn't be recovered.  The solution was to ensure that CommonSuffixMerger only operates when all nodes to be merged aren't source nodes themselves.

-- Added a convenient argument to the haplotype caller (captureAssemblyFailureBAM) that will write out the exact reads to a BAM file that went into a failed assembly run (going to a file called AssemblyFailure.BAM).  This can be used to rerun the haplotype caller to produce the exact error, which can be hard in regions of deep coverage where the downsampler state determines the exact reads going into assembly and therefore makes running with a sub-interval not reproduce the error
-- Did some misc. cleanup of code while debugging
-- [delivers #50917729]
2013-06-03 16:16:39 -04:00
Ryan Poplin ab40f4af43 Break out the GGA kmers and the read kmers into separate functions for the DeBruijn assembler.
-- Added unit test for new function.
2013-06-03 14:00:35 -04:00
Ryan Poplin 21334e728d Merge pull request #252 from broadinstitute/md_bqsr_index_out_of_bounds
Make BQSR calculateIsIndel robust to indel CIGARs are start/end of read
2013-06-03 07:13:00 -07:00
sathibault de2a2a4cc7 Added command-line flag to disble FPGA
Completed integration with FPGA driver
2013-06-03 07:30:32 -05:00
Mark DePristo 6555361742 Fix error in merging code in HC
-- Ultimately this was caused by an underlying bug in the reverting of soft clipped bases in the read clipper.  The read clipper would fail to properly set the alignment start for reads that were 100% clipped before reverting, such as 10H2S5H => 10H2M5H.  This has been fixed and unit tested.
-- Update 1 ReduceReads MD5, which was due to cases where we were clipping away all of the MATCH part of the read, leaving a cigar like 50H11S and the revert soft clips was failing to properly revert the bases.
-- delivers #50655421
2013-05-31 16:29:29 -04:00
Mark DePristo 64b4d80729 Make BQSR calculateIsIndel robust to indel CIGARs are start/end of read
-- The previous implementation attempted to be robust to this, but not all cases were handled properly.  Added a helper function updateInde() that bounds up the update to be in the range of the indel array, and cleaned up logic of how the method works.  The previous behavior was inconsistent across read fwd/rev stand, so that the indel cigars at the end of read were put at the start of reads if the reads were in the forward strand but not if they were in the reverse strand.  Everything is now consistent, as can be seen in the symmetry of the unit tests:

        tests.add(new Object[]{"1D3M",   false, EventType.BASE_DELETION, new int[]{0,0,0}});
        tests.add(new Object[]{"1M1D2M", false, EventType.BASE_DELETION, new int[]{1,0,0}});
        tests.add(new Object[]{"2M1D1M", false, EventType.BASE_DELETION, new int[]{0,1,0}});
        tests.add(new Object[]{"3M1D",   false, EventType.BASE_DELETION, new int[]{0,0,1}});

        tests.add(new Object[]{"1D3M",   true, EventType.BASE_DELETION, new int[]{1,0,0}});
        tests.add(new Object[]{"1M1D2M", true, EventType.BASE_DELETION, new int[]{0,1,0}});
        tests.add(new Object[]{"2M1D1M", true, EventType.BASE_DELETION, new int[]{0,0,1}});
        tests.add(new Object[]{"3M1D",   true, EventType.BASE_DELETION, new int[]{0,0,0}});

        tests.add(new Object[]{"4M1I",   false, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
        tests.add(new Object[]{"3M1I1M", false, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
        tests.add(new Object[]{"2M1I2M", false, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});
        tests.add(new Object[]{"1M1I3M", false, EventType.BASE_INSERTION, new int[]{1,0,0,0,0}});
        tests.add(new Object[]{"1I4M",   false, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});

        tests.add(new Object[]{"4M1I",   true, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});
        tests.add(new Object[]{"3M1I1M", true, EventType.BASE_INSERTION, new int[]{0,0,0,0,1}});
        tests.add(new Object[]{"2M1I2M", true, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
        tests.add(new Object[]{"1M1I3M", true, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
        tests.add(new Object[]{"1I4M",   true, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});

-- delivers #50445353
2013-05-31 13:58:37 -04:00
Ryan Poplin b5b9d745a7 New implementation of the GGA mode in the HaplotypeCaller
-- We now inject the given alleles into the reference haplotype and add them to the graph.
-- Those paths are read off of the graph and then evaluated with the appropriate marginalization for GGA mode.
-- This unifies how Smith-Waterman is performed between discovery and GGA modes.
-- Misc minor cleanup in several places.
2013-05-31 10:35:36 -04:00
Ryan Poplin 61af37d0d2 Create a new normalDistributionLog10 function that is unit tested for use in the VQSR. 2013-05-30 16:00:08 -04:00
Eric Banks a5a68c09fa Fix for the "Removed too many insertions, header is now negative" bug in ReduceReads.
The problem ultimately was that ReadUtils.readStartsWithInsertion() ignores leading hard/softclips, but
ReduceReads does not.  So I refactored that method to include a boolean argument as to whether or not
clips should be ignored.  Also rebased so that return type is no longer a Pair.
Added unit test to cover this situation.
2013-05-29 16:41:01 -04:00
Mark DePristo 684c91c2e7 Merge pull request #245 from broadinstitute/dr_enforce_min_dcov
Require a minimum dcov value of 200 for Locus and ActiveRegion walkers when downsampling to coverage
2013-05-29 09:52:13 -07:00
David Roazen a7cb599945 Require a minimum dcov value of 200 for Locus and ActiveRegion walkers when downsampling to coverage
-Throw a UserException if a Locus or ActiveRegion walker is run with -dcov < 200,
 since low dcov values can result in problematic downsampling artifacts for locus-based
 traversals.

-Read-based traversals continue to have no minimum for -dcov, since dcov for read traversals
 controls the number of reads per alignment start position, and even a dcov value of 1 might
 be safe/desirable in some circumstances.

-Also reorganize the global downsampling defaults so that they are specified as annotations
 to the Walker, LocusWalker, and ActiveRegionWalker classes rather than as constants in the
 DownsamplingMethod class.

-The default downsampling settings have not been changed: they are still -dcov 1000
 for Locus and ActiveRegion walkers, and -dt NONE for all other walkers.
2013-05-29 12:07:12 -04:00
Mauricio Carneiro f1affa9fbb Turn off downsampling for DiagnoseTargets
Diagnose targets should never be downsampled. (and I didn't know there was a default downsampling going on for locus walkers)
2013-05-28 14:58:50 -04:00
Ryan Poplin 85905dba92 Bugfix for GGA mode in UG silently ignoring indels
-- Started by Mark. Finished up by Ryan.
-- GGA mode still respected glm argument for SNP and INDEL models, so that you would silently fail to genotype indels at all if the -glm INDEL wasn't provided, but you'd still emit the sites, so you'd see records in the VCF but all alleles would be no calls.
-- https://www.pivotaltracker.com/story/show/48924339 for more information
-- [resolves #48924339]
2013-05-24 13:47:26 -04:00
Mauricio Carneiro da21924b44 Make the missing targets output never use stdout
Problem
--------
Diagnose Targets is outputting missing intervals to stdout if the argument -missing is not provided

Solution
--------
Make it NOT default to stdout

[Delivers #50386741]
2013-05-22 14:22:54 -04:00
Mark DePristo d167743852 Archived banded logless PairHMM
BandedHMM
---------
-- An implementation of a linear runtime, linear memory usage banded logless PairHMM.  Thought about 50% faster than current PairHMM, this implementation will be superceded by the GraphHMM when it becomes available.  The implementation is being archived for future reference

Useful infrastructure changes
-----------------------------
-- Split PairHMM into a N2MemoryPairHMM that allows smarter implementation to not allocate the double[][] matrices if they don't want, which was previously occurring in the base class PairHMM
-- Added functionality (controlled by private static boolean) to write out likelihood call information to a file from inside of LikelihoodCalculationEngine for using in unit or performance testing.  Added example of 100kb of data to private/testdata.  Can be easily read in with the PairHMMTestData class.
-- PairHMM now tracks the number of possible cell evaluations, and the LoglessCachingPairHMM updates the nCellsEvaluated so we can see how many cells are saved by the caching calculation.
2013-05-22 12:24:00 -04:00
Mark DePristo a1093ad230 Optimization for ActiveRegion.removeAll
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion.  This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element.   New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set.  Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
2013-05-21 16:18:57 -04:00
Eric Banks 1f3624d204 Base Recalibrator doesn't recalibrate all reads, so the final output line was confusing 2013-05-21 11:35:05 -04:00
Valentin Ruano Rubio 71bbb25c9e Merge pull request #231 from broadinstitute/md_combinevariants_bugfix
CombineVariants no longer adds PASS to unfiltered records
2013-05-20 14:28:20 -07:00
Mark DePristo 62fc88f92e CombineVariants no longer adds PASS to unfiltered records
-- [Delivers #49876703]
-- Add integration test and test file
-- Update SymbolicAlleles combine variant tests, which was turning unfiltered records into PASS!
2013-05-20 16:53:51 -04:00
Ryan Poplin 507853c583 Active region boundary parameters need to be bigger when running in GGA mode. CGL performance is quite a bit better as a result.
-- The troule stems from the fact that we may be trying to genotype indels even though it appears there are only SNPs in the reads.
2013-05-20 14:29:04 -04:00
Eric Banks 8a442d3c9f @Output needs to be required for LiftoverVariants to prevent a NPE and documentation needed updating. 2013-05-17 10:04:10 -04:00
sathibault 195f0c3e98 Disable CnyPairHMM 2013-05-17 08:30:23 -05:00
Yossi Farjoun 9234a0efcd Merge pull request #223 from broadinstitute/mc_dt_gaddy_outputs
Bug fixes and missing interval functionality for Diagnose Targets

While the code seems fine, the complex parts of it are untested. This is probably fine for now, but private code can have a tendency to creep into the codebase once accepted. I would have preferred that unit test OR a big comment stating that the code is untested (and thus broken by Mark's rule).

It is with these cavets that I accept the pull request.
2013-05-16 09:25:54 -07:00
Chris Hartl 6da0aed30f Update GCIT md5s to account for trivial changes to description strings 2013-05-14 19:45:30 -04:00
Yossi Farjoun 409a202492 Merge pull request #214 from broadinstitute/chartl_genotype_concordance_diploid_and_OGC
Add overall genotype concordance to the genotype concordance tool. In ad...
2013-05-14 14:19:54 -07:00
Menachem Fromer de54223aed Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-14 10:15:21 -04:00
Mauricio Carneiro adcbf947bf Update MD5s and the Diagnose Target scala script 2013-05-13 12:06:17 -04:00
Mauricio Carneiro 9eceae793a Tool to manipulate intervals outside the GATK
Performs basic set operations on intervals like union, intersect and difference between two or more intervals. Useful for techdev and QC purposes.
2013-05-13 11:56:24 -04:00
Mauricio Carneiro 3dbb86b052 Outputting missing intervals in DiagnoseTargets
Problem
------
Diagnose Targets identifies holes in the coverage of a targetted experiment, but it only reports them doesn't list the actual missing loci

Solution
------
This commit implements an optional intervals file output listing the exact loci that did not pass filters

Itemized changes
--------------
   * Cache callable statuses (to avoid recalculation)
   * Add functionality to output missing intervals
   * Implement new tool to qualify the missing intervals (QualifyMissingIntervals) by gc content, size, type of missing coverage and origin (coding sequence, intron, ...)
2013-05-13 11:51:56 -04:00
Mauricio Carneiro 1466396a31 Diagnose target is outputting intervals out of order
Problem
-------
When the interval had no reads, it was being sent to the VCF before the intervals that just got processed, therefore violating the sort order of the VCF.

Solution
--------
Use a linked hash map, and make the insertion and removal all happen in one place regardless of having reads or not. Since the input is ordered, the output has to be ordered as well.

Itemized changes
--------------
   * Clean up code duplication in LocusStratification and SampleStratification
   * Add number of uncovered sites and number of low covered sites to the VCF output.
   * Add new VCF format fields
   * Fix outputting multiple status when threshold is 0 (ratio must be GREATER THAN not equal to the threshold to get reported)

[fixes #48780333]
[fixes #48787311]
2013-05-13 11:50:22 -04:00
Mark DePristo b4f482a421 NanoScheduled ActiveRegionTraversal and HaplotypeCaller
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
  -- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
  -- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
2013-05-13 11:09:02 -04:00
Eric Banks 2f5ef6db44 New faster Smith-Waterman implementation that is edge greedy and assumes that ref and haplotype have same global start/end points.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
   * A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
     right thing for indels at the edges of the alignments.
     * Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
   * Lots of systematic testing added for this implementation.
   * NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
2013-05-13 09:36:39 -04:00
Mark DePristo 111e8cef0f Merge pull request #219 from broadinstitute/eb_rr_multisample_fix
Fix bug in Reduce Reads that arises in multi-sample mode.
2013-05-09 15:31:14 -07:00
Eric Banks 8b9c6aae3e Fix bug in Reduce Reads that arises in multi-sample mode.
* bitset could legitimately be in an unfinished state but we were trying to access it without finalizing.
  * added --cancer_mode argument per Mark's suggestion to force the user to explicitly enable multi-sample mode.
  * tests were easiest to implement as integration tests (this was a really complicated case).
2013-05-08 23:23:51 -04:00
Mark DePristo fa8a47ceef Replace DeBruijnAssembler with ReadThreadingAssembler
Problem
-------
The DeBruijn assembler was too slow.  The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp).  This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.

Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers.  The algorithm operates as follows:

identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
  find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
  for each base in the sequence from the starting vertex kmer:
    look at the existing outgoing nodes of current vertex V.  If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
    If no matching next vertex exists, find a unique vertex with kmer K.  If one exists, merge the sequence into this vertex, and continue
    If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue

This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size.  This allows us to assemble well with even very short kmers.

This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:

-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples.  This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor.  This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization.  This change is essential for us to get good variants from our paths when the kmer size is small.  It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation.  Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary.  This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler

Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations.  This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate.  Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
2013-05-08 21:41:42 -04:00
sathibault d79b5f0931 Adding Convey HC-1 HMM acceleration 2013-05-08 11:01:20 -05:00
Eric Banks d242f1bba3 Secondary alignments were not handled correctly in IndelRealigner
* This is emerging now because BWA-MEM produces lots of reads that are not primary alignments
 * The ConstrainedMateFixingManager class used by IndelRealigner was mis-adjusting SAM flags because it
     was getting confused by these secondary alignments
 * Added unit test to cover this case
2013-05-06 19:09:10 -04:00
Eric Banks b53336c2d0 Added hidden mode for BQSR to force all read groups to be the same one.
* Very useful for debugging sample-specific issues
 * This argument got lost in the transition from BQSR v1 to v2
 * Added unit test to cover this case
2013-05-06 19:09:10 -04:00
Menachem Fromer c7dcc2b53b Fix to deal with multi-generational families being allowed if only one level (one 'trio', effectively) appears in the VCF 2013-05-06 15:47:27 -04:00
Menachem Fromer 86287dce76 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-06 13:52:55 -04:00
Menachem Fromer 13240588cf Fix to only consider the samples that are both in the PED file and in the VCF file 2013-05-06 13:52:14 -04:00
Chris Hartl 6ff74deac7 Add overall genotype concordance to the genotype concordance tool. In addition, protect from non-diploid genotypes, which can cause very strange behavior.
Update MD5 sums. As expected, md5 changes are consistent with the genotype concordance field being added to each output.
2013-05-06 13:06:30 -04:00
chartl 98021db264 Merge pull request #208 from broadinstitute/yf_fix_molten_GenotypeConcordance
- Fixed a small bug in the printout of molten data in GenotypeConcordanc...
2013-05-06 08:42:06 -07:00
Menachem Fromer 78e958bf39 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-05-06 10:39:21 -04:00
Guillermo del Angel 874dc8f9c1 Re-fix md5's that changed due to conflicting pushes 2013-05-03 14:59:16 -04:00
Mark DePristo f42bb86bdd e# This is a combination of 2 commits.
Only try to clip adaptors when both reads of the pair are on opposite strands

-- Read pairs that have unusual alignments, such as two reads both oriented like:

  <-----
     <-----

where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs.  This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
2013-05-03 11:19:14 -04:00
Mark DePristo 2bcbdd469f leftAlignCigarSequentially now supports haplotypes with insertions and deletions where the deletion allele was previously removed by the leftAlignSingleIndel during it's cleanup phase. 2013-05-03 09:32:05 -04:00
Guillermo del Angel 0c30a5ebc6 Rev'd up Picard to get PL fix: PLs were saturated to 32767 (Short.MAX_VALUE) when converting from GL to integers. Increase capping to Integer.MAX_VALUE (2^31-1) which should be enough for reasonable sites now. Integration tests change because some tests have some hyper-deep pileups where this case was hit 2013-05-02 16:31:43 -04:00
Yossi Farjoun 4b8b411b92 - Fixed a small bug in the printout of molten data in GenotypeConcordance
Output didn't "mix-up" the genotypes, it outputed the same HET vs HET (e.g.) 3 times rather than the combinations of HET vs {HET, HOM, HOM_REF}, etc.
This was only a problem in the text, _not_ the actual numbers, which were outputted correctly.

- Updated MD5's after looking at diffs to verify that the change is what I expected.
2013-05-02 09:16:07 -04:00
David Roazen f3c94a3c87 Update expected test output for Java 7
-Changes in Java 7 related to comparators / sorting produce a large number
 of innocuous differences in our test output. Updating expectations now
 that we've moved to using Java 7 internally.

-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
 intermittent failures.
2013-05-01 16:18:01 -04:00
Eric Banks 58424e56be Setting the reduce reads count tag was all wrong in a previous commit; fixing.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly.  Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.

The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly.  Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).

Also:
1. counts are now maintained as ints whenever possible.  Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
2013-04-30 13:45:42 -04:00
Guillermo del Angel 20d3137928 Fix for indel calling with UG in presence of reduced reads: When a read is long enough so that there's no reference context available, the reads gets clipped so that it falls again within the reference context range. However, the clipping is incorrect, as it makes the read end precisely at the end of the reference context coordinates. This might lead to a case where a read might span beyond the haplotype if one of the candidate haplotypes is shorter than the reference context (As in the case e.g. with deletions). In this case, the HMM will not work properly and the likelihood will be bad, since "insertions" at end of reads when haplotype is done will be penalized and likelihood will be much lower than it should.
-- Added check to see if read spans beyond reference window MINUS padding and event length. This guarantees that read will always be contained in haplotype.
-- Changed md5's that happen when long reads from old 454 data have their likelihoods changed because of the extra base clipping.
2013-04-29 19:33:02 -04:00
Mark DePristo 0387ea8df9 Bugfix for ReadClipper with ReducedReads
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts.  Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly.  Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
2013-04-29 11:12:09 -04:00
Mark DePristo 5dd73ba2d1 Merge pull request #198 from broadinstitute/mc_reduce_reads_ds_doc
Updates GATKDocs for ReduceReads downsampling
2013-04-27 05:49:47 -07:00
Mauricio Carneiro 76e997895e Updates GATKDocs for ReduceReads downsampling
[fixes #48258295]
2013-04-26 23:33:44 -04:00
Guillermo del Angel 4168aaf280 Add feature to specify Allele frequency priors by command line when calling variants.
Use case:
The default AF priors used (infinite sites model, neutral variation) is appropriate in the case where the reference allele is ancestral, and the called allele is a derived allele.
Most of the times this is true but in several population studies and in ancient DNA analyses this might introduce reference biases, and in some other cases it's hard to ascertain what the ancestral allele is (normally requiring to look up homologous chimp sequence).
Specifying no prior is one solution, but this may introduce a lot of artifactual het calls in shallower coverage regions.
With this option, users can specify what the prior for each AC should be according to their needs, subject to the restrictions documented in the code and in GATK docs.
-- Updated ancient DNA single sample calling script with filtering options and other cleanups.
-- Added integration test. Removed old -noPrior syntax.
2013-04-26 19:06:39 -04:00
Mark DePristo 759c531d1b Merge pull request #197 from broadinstitute/dr_disable_snpeff_version_check
Add support for snpEff "GATK compatibility mode" (-o gatk)
2013-04-26 13:55:14 -07:00
David Roazen 7d90bbab08 Add support for snpEff "GATK compatibility mode" (-o gatk)
-Do not throw an exception when parsing snpEff output files
 generated by not-officially-supported versions of snpEff,
 PROVIDED that snpEff was run with -o gatk

-Requested by the snpEff author

-Relevant integration tests updated/expanded
2013-04-26 15:47:15 -04:00
Mark DePristo 071fd67d55 Merge pull request #193 from broadinstitute/eb_contamination_fixing_for_reduced_reads
Eb contamination fixing for reduced reads
2013-04-26 09:48:45 -07:00
Mark DePristo 92a6c7b561 Merge pull request #195 from broadinstitute/eb_exclude_sample_file_bug_in_select_variants
Fixed bug reported on the forum where using the --exclude_sample_file ar...
2013-04-26 09:47:38 -07:00
Eric Banks 360e2ba87e Fixed bug reported on the forum where using the --exclude_sample_file argument in SV was giving bad results.
Added integration test.
https://www.pivotaltracker.com/s/projects/793457/stories/47399245
2013-04-26 12:23:11 -04:00
Eric Banks 021adf4220 WTF - I thought we had disabled the randomized dithering of rank sum tests for integration tests?!
Well, it wasn't done so I went ahead and did so.  Lots of MD5 changes accordingly.
2013-04-26 11:24:05 -04:00
Eric Banks ba2c3b57ed Extended the allele-biased down-sampling functionality to handle reduced reads.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.

Added lots of unit tests for new functionality.
2013-04-26 11:23:17 -04:00
Mark DePristo d20be41fee Bugfix for FragmentUtils.mergeOverlappingPairedFragments
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences.  If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference.  Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
2013-04-25 11:11:15 -04:00
Eric Banks 379a9841ce Various bug fixes for recent Reduce Reads additions plus solution implemented for low MQ reads.
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions.  Then we get the
best of both worlds.  As a note, coverage refers to just the individual base counts and not the entire pileup.

2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.

3. Each consensus keeps track of its own number of softclipped bases.  There was no reason that that number
should be shared between them.

4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now.  Don't lose that
information.  Maybe we'll decide to change this in the future, but for now we are conservative.

5. Also implemented various small performance optimizations based on profiling.

Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
2013-04-24 18:18:50 -04:00
MauricioCarneiro 45fec382e7 Merge pull request #180 from broadinstitute/mc_diagnosetargets_missing_targets
DiagnoseTargets Global Refactor
2013-04-24 14:54:55 -07:00
Mauricio Carneiro 367f0c0ac1 Split class names into stratification and metrics
Calling everything statistics was very confusing. Diagnose Targets stratifies the data three ways: Interval, Sample and Locus. Each stratification then has it's own set of metrics (plugin system) to calculate -- LocusMetric, SampleMetric, IntervalMetric.

 Metrics are generalized by the Metric interface. (for generic access)
 Stratifications are generalized by the AbstractStratification abstract class. (to aggressively limit code duplication)
2013-04-24 14:15:49 -04:00
Ryan Poplin 80131ac996 Adding the 1000G_phase1.snps.high_confidence callset to the GATK resource bundle for use in the April 2013 updated best practices. 2013-04-24 11:41:32 -04:00
Guillermo del Angel 2ab270cf3f Corner case fix to General Ploidy SNP likelihood model.
-- In case there are no informative bases in a pileup but pileup isn't empty (like when all bases have Q < min base quality) the GLs were still computed (but were all zeros) and fed to the exact model. Now, mimic case of diploid Gl computation where GLs are only added if # good bases > 0
-- I believe general case where only non-informative GLs are fed into AF calc model is broken and yields bogus QUAL, will investigate separately.
2013-04-23 21:13:18 -04:00
Mauricio Carneiro 8f8f339e4b Abstract class for the statistics
Addressing the code duplication issue raised by Mark.
2013-04-23 18:02:27 -04:00
Mauricio Carneiro 38662f1d47 Limiting access to the DT classes
* Make most classes final, others package local
    * Move to diagnostics.diagnosetargets package
    * Aggregate statistics and walker classes on the same package for simplified visibility.
    * Make status list a LinkedList instead of a HashSet
2013-04-23 14:01:43 -04:00
Ryan Poplin cb4ec3437a After debate reverting SW parameter changes temporarily while we explore global SW plans. 2013-04-23 13:32:06 -04:00
Mauricio Carneiro fdd16dc6f9 DiagnoseTargets refactor
A plugin enabled implementation of DiagnoseTargets

Summarized Changes:
-------------------
   * move argument collection into Thresholder object
   * make thresholder object private member of all statistics classes
   * rework the logic of the mate pairing thresholds
   * update unit and integration tests to reflect the new behavior
   * Implements Locus Statistic plugins
   * Extend Locus Statistic plugins to determine sample status
   * Export all common plugin functionality into utility class
   * Update tests accordingly

[fixes #48465557]
2013-04-22 23:53:10 -04:00
Mauricio Carneiro eb6308a0e4 General DiagnoseTargets documentation cleanup
* remove interval statistic low_median_coverage -- it is already captured by low coverage and coverage gaps.
   * add gatkdocs to all the parameters
   * clean up the logic on callable status a bit (still need to be re-worked into a plugin system)
   * update integration tests
2013-04-22 23:53:09 -04:00
Mauricio Carneiro b3c0abd9e8 Remove REF_N status from DiagnoseTargets
This is not really feasible with the current mandate of this walker. We would have to traverse by reference and that would make the runtime much higher, and we are not really interested in the status 99% of the time anyway. There are other walkers that can report this, and just this, status more cheaply.

[fixes #48442663]
2013-04-22 23:53:09 -04:00
Mauricio Carneiro 2b923f1568 fix for DiagnoseTargets multiple filter output
Problem
-------
Diagnose targets is outputting both LOW_MEDIAN_COVERAGE and NO_READS when no reads are covering the interval

Solution
--------
Only allow low median coverage check if there are reads

[fixes #48442675]
2013-04-22 23:53:09 -04:00
Mauricio Carneiro cf7afc1ad4 Fixed "skipped intervals" bug on DiagnoseTargets
Problem
-------
Diagnose targets was skipping intervals when they were not covered by any reads.

Solution
--------
Rework the interval iteration logic to output all intervals as they're skipped over by the traversal, as well as adding a loop on traversal done to finish outputting intervals past the coverage of teh BAM file.

Summarized Changes
------------------
   * Outputs all intervals it iterates over, even if uncovered
   * Outputs leftover intervals in the end of the traversal
   * Updated integration tests

[fixes #47813825]
2013-04-22 23:53:09 -04:00
Mark DePristo be66049a6f Bugfix for CommonSuffixSplitter
-- The problem is that the common suffix splitter could eliminate the reference source vertex when there's an incoming node that contains all of the reference source vertex bases and then some additional prefix bases.  In this case we'd eliminate the reference source vertex.  Fixed by checking for this condition and aborting the simplification
-- Update MD5s, including minor improvements
2013-04-21 19:37:01 -04:00
Mark DePristo f0e64850da Two sensitivity / specificity improvements to the haplotype caller
-- Reduce the min read length to 10 bp in the filterNonPassingReads in the HC.  Now that we filter out reads before genotyping, we have to be more tolerant of shorter, but informative, reads, in order to avoid a few FNs in shallow read data
-- Reduce the min usable base qual to 8 by default in the HC.  In regions with low coverage we sometimes throw out our only informative kmers because we required a contiguous run of bases with >= 16 QUAL.  This is a bit too aggressive of a requirement, so I lowered it to 8.
-- Together with the previous commit this results in a significant improvement in the sensitivity and specificity of the caller

 NA12878 MEM chr20:10-11
 Name    VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
 branch  SNPS                  1216               0               2            194                        0
 branch  INDELS                 312               2              13             71                        7
 master  SNPS                  1214               0               4            194                        1
 master  INDELS                 309               2              16             71                       10

-- Update MD5s in the integration tests to reflect these two new changes
2013-04-17 12:32:31 -04:00
Eric Banks 5bce0e086e Refactored binomial probability code in MathUtils.
* Moved redundant code out of UGEngine
  * Added overloaded methods that assume p=0.5 for speed efficiency
  * Added unit test for the binomialCumulativeProbability method
2013-04-16 18:19:07 -04:00
Eric Banks df189293ce Improve compression in Reduce Reads by incorporating probabilistic model and global het compression
The Problem:
  Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
  regions in an exome) causes RR (with default settings) to consider it a variant region.  This
  seriously hurts compression performance.

The Solution:
  1. We now use a probabilistic model for determining whether we can create a consensus (in other
  words, whether we can error correct a site) instead of the old ratio threshold.  We calculate
  the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
  that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
  2. We also allow het compression globally, not just at known sites.  So if we cannot create a
  consensus at a given site then we try to perform het compression; and if we cannot perform het
  compression that we just don't reduce the variant region.  This way very wonky regions stay
  uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
  locus get het compressed.

Details:
  1. -minvar is now deprecated in favor of -min_pvalue.
  2. Added integration test for bad pvalue input.
  3. -known argument still works to force het compression only at known sites; if it's not included
     then we allow het compression anywhere.  Added unit tests for this.
  4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
     Before finalizing het compression, we now check for insertions or other variant regions (usually due
     to multi-allelics) which can render a region incompressible (and we back out if we find one).  We
     were checking for excessive softclips before, but now we add these tests too.
  5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
     consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
     out instead of backing out all of them.
  6. We no longer create a mini read at the stop of the variant window for het compression.  Instead, we
     allow it to be part of the next global consensus.
  7. The coverage test is no longer run systematically on all integration tests because the quals test
     supercedes it.  The systematic quals test is now much stricter in order to catch bugs and edge cases
     (very useful!).
  8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
     for a consensus was affected by good and bad bases/reads).
  9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
     This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
  10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
     with insertions from a header.

Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
2013-04-16 18:19:06 -04:00
Ryan Poplin e0dfe5ca14 Restore the read filter function in the HaplotypeCaller. 2013-04-16 12:01:30 -04:00
Geraldine Van der Auwera e176fc3af1 Merge pull request #159 from broadinstitute/md_bqsr_ion
Trivial BQSR bug fixes and improvement
2013-04-16 08:54:47 -07:00
Ryan Poplin 936f4da1f6 Merge pull request #166 from broadinstitute/md_hc_persample_haplotypes
Select the haplotypes we move forward for genotyping per sample, not poo...
2013-04-16 08:46:56 -07:00
Mark DePristo 17982bcbf8 Update MD5s for VQSR header change 2013-04-16 11:45:45 -04:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Mark DePristo 5a74a3190c Improvements to the VariantRecalibrator R plots
-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
2013-04-16 09:09:51 -04:00
Mark DePristo 564fe36d22 VariantRecalibrator's VQSR.vcf now contains NEG/POS labels
-- It's useful to know which sites have been used in the training of the model.  The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
2013-04-16 09:09:47 -04:00
Mauricio Carneiro 9bfa5eb70f Quick optimization to the PairHMM
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.

Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
2013-04-14 23:25:33 -04:00
Mark DePristo 3144eae51c UnifiedGenotyper bugfix: don't create haplotypes with 0 bases
-- The PairHMM no longer allows us to create haplotypes with 0 bases.  The UG indel caller used to create such haplotypes.  Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes #47523579]
2013-04-13 14:57:55 -04:00
Mauricio Carneiro f11c8d22d4 Updating java 7 md5's to java 6 md5's 2013-04-13 08:21:48 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 0e627bce93 Slight update to Path SW parameters.
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
2013-04-12 12:43:52 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Mark DePristo 74196ff7db Trivial BQSR bug fixes and improvement
-- Ensure that BQSR works properly for an Ion Torrent BAM.  (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
2013-04-11 17:08:35 -04:00
Ryan Poplin a507381a33 Updating BQSR RecalibrationEngine to work correctly with empty BQSR tables.
-- Previously would crash when a scatter/gather interval contained no usable data.
-- Added unit test to cover this case.
2013-04-11 16:27:59 -04:00
Mark DePristo fb86887bf2 Fast algorithm for determining which kmers are good in a read
-- old algorithm was O(kmerSize * readLen) for each read.  New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph.  Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
2013-04-11 09:54:22 -04:00
Mark DePristo bf42be44fc Fast DeBruijnGraph creation using the kmer counter
-- The previous creation algorithm used the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to the graph
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
  update edge count by 1 if kmer1 -> kmer2 already existed in the graph

-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)).  This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap

for each kmer pair 1 and 2 in the hash counter
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
  update edge count by count from map if kmer1 -> kmer2 already existed in the graph

-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
2013-04-10 17:10:59 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mark DePristo b115e5c582 Critical bugfix for CommonSuffixSplitter to avoid infinite loops
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:

X -> A -> B
Y -> A -> B

So that the incoming vertices of B all have the same sequence.  This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph.  Fixed and unit tested

-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging.  So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph.  Equals here means that all vertices have equivalents in both graphs, as do all edges.  If the two graphs are equal we stop simplifying.  It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
2013-04-09 16:19:26 -04:00
Mark DePristo 51954ae3e5 HaplotypeCaller doesn't support EXACT_GENERAL_PLOIDY model
-- HC now throws a UserException if this model is provided.  Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
2013-04-09 15:18:42 -04:00
Mark DePristo 33ecec535d Turn off the LD merging code by default
-- It's just too hard to interpret the called variation when we merge variants via LD.
-- Can now be turned on with -mergeVariantsViaLD
-- Update MD5s
2013-04-09 10:08:06 -04:00
Mark DePristo 21410690a2 Address reviewer comments 2013-04-08 12:48:20 -04:00
Mark DePristo caf15fb727 Update MD5s to reflect new HC algorithms and parameter values 2013-04-08 12:48:16 -04:00
Mark DePristo 6d22485a4c Critical bugfix to ReduceRead functionality of the GATKSAMRecord
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5].  The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding.  Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i.  Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
2013-04-08 12:47:50 -04:00
Mark DePristo 5a54a4155a Change key Haplotype default parameter values
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
2013-04-08 12:47:50 -04:00
Mark DePristo 3a19266843 Fix residual merge conflicts 2013-04-08 12:47:50 -04:00
Mark DePristo 9c7a35f73f HaplotypeCaller no longer creates haplotypes that involve cycles in the SeqGraph
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models.  Allowing cycles can be re-enabled with an HC command line switch.
2013-04-08 12:47:50 -04:00
Mark DePristo 5545c629f5 Rename Utils to GraphUtils to avoid conflicts with the sting.Utils class; fix broken unit test in SharedVertexSequenceSplitterUnitTest 2013-04-08 12:47:49 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo 9b5c55a84a LikelihoodCalculationEngine will now only use reads longer than the minReadLength, which is currently fixed at 20 bp 2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 4d389a8234 Optimizations for HC infrastructure
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
2013-04-08 12:47:49 -04:00
Mark DePristo e916998784 Bugfix for head and tail merging code in SeqGraph
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so.  This would introduce large deletion events at the start / end of the assemblies.  Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
2013-04-08 12:47:48 -04:00
Mark DePristo 2aac9e2782 More efficient ZipLinearChains algorithm
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go.  Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains.  The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 67cd407854 The GenotypingEngine now uses the samples from the mapping of Samples -> PerReadAllele likelihoods instead of passing around a redundant list of samples 2013-04-08 12:47:47 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Eric Banks 6253ba164e Using --keepOriginalAC in SelectVariants was causing it to emit bad VCFs
* This occurred when one or more alleles were lost from the record after selection
  * Discussed here: http://gatkforums.broadinstitute.org/discussion/comment/4718#Comment_4718
  * Added some integration tests for --keepOriginalAC (there were none before)
2013-04-05 00:53:28 -04:00
Eric Banks 7897d52f32 Don't allow users to specify keys and IDs that contain angle brackets or equals signs (not allowed in VCF spec).
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
  * This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
  * Added integration test to confirm failure with User Error
  * Removed illegal header line in KB test VCF that was causing related tests to fail.
2013-04-05 00:52:32 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
Mark DePristo bb42c90f2b Use LinkedHashSets in incoming and outgoing vertex functions in BaseGraph
-- Using a LinkedHashSet changed the md5 for HCTestComplexVariants.
2013-04-02 17:58:20 -04:00
David Roazen b4b58a3968 Fix unprintable character in a comment from the BaseEdge class
Compiler warnings about this were starting to get to me...
2013-04-02 14:24:23 -04:00
Mark DePristo c191d7de8c Critical bugfix for CommonSuffixSplitter
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm.  Created unit test that reproduced the issue, and then fixed the underlying issue.
2013-04-02 09:22:33 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Ryan Poplin f65206e758 Two changes to HC GGA mode to make it more like the UG.
-- Only try to genotype PASSing records in the alleles file
-- Don't attempt to genotype multiple records with the same start location. Instead take the first record and throw a warning message.
2013-04-01 10:20:23 -04:00
Mark DePristo 7c83efc1b9 Merge pull request #135 from broadinstitute/mc_pgtag_fix
Fixing @PG tag uniqueness issue
2013-03-31 11:36:40 -07:00
Eric Banks 7dd58f671f Merge pull request #132 from broadinstitute/gda_filter_unmasked_sites
Added small feature to VariantFiltration to filter sites outside of a gi...
2013-03-31 06:27:26 -07:00
Guillermo del Angel 9686e91a51 Added small feature to VariantFiltration to filter sites outside of a given mask:
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
2013-03-31 08:48:16 -04:00
Eric Banks 8e2094d2af Updated AssessReducedQuals and applied it systematically to all ReduceReads integration tests.
* Moved to protected for packaging purposes.
  * Cleaned up and removed debugging output.
  * Fixed logic for epsilons so that we really only test significant differences between BAMs.
  * Other small fixes (e.g. don't include low quality reduced reads in overall qual).
  * Most RR integration tests now automatically run the quals test on output.
    * A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
2013-03-31 00:27:14 -04:00
Mauricio Carneiro ec475a46b1 Fixing @PG tag uniqueness issue
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".

How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.

Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter

Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31

Issue Tracker:
--------------
[fixes 47100885]
2013-03-30 20:31:33 -04:00
Mauricio Carneiro 68bf470524 making LoglessPairHMM final 2013-03-30 20:00:45 -04:00
Guillermo del Angel 6b8bed34d0 Big bad bug fix: feature added to LeftAlignAndTrimVariants to left align multiallelic records didn't work.
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
2013-03-30 19:31:28 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
Chris Hartl 74a17359a8 MathUtils.randomSubset() now uses Collections.shuffle() (indirectly, through the other methods
that are tested), resulting in slightly different numbers of calls to the RNG, and ultimately
different sets of selected variants.

This commits updates the md5 values for the validation site selector integration test to reflect
these new random subsets of variants that are selected.
2013-03-29 14:52:10 -04:00
Guillermo del Angel 8fbf9c947f Upgrades and changes to LeftAlignVariants, motivated by 1000G consensus indel production:
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
2013-03-29 10:02:06 -04:00
Chris Hartl 73d1c319bf Rarely-occurring logic bugfix for GenotypeConcordance, streamlining and testing of MathUtils
Currently, the multi-allelic test is covering the following case:

Eval   A   T,C
Comp   A   C

reciprocate this so that the reverse can be covered.

Eval   A   C
Comp   A   T,C

And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.

This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:

Eval:   A  G,T      0/0   2/0   2/2   1/1
Comp:   A  C,T      0/0   1/0   0/0   0/0

Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:

Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)

Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.

Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
 - dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
 - vectorSum
 - array shuffle, random subset
 - countOccurances (general forms, the char form is used in the codebase)
 - getNMaxElements
 - array permutation
 - sorted array permutation
 - compare floats
 - sum() (for integer arrays and lists).

Final keyword was extensively added to MathUtils.

The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).

The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.

In addition, more extensive tests were added for
 - logBinomialCoefficient (Newton's identity should always hold)
 - logFactorial
 - log10sumlog10 and its approximation

All unit tests pass
2013-03-28 23:25:28 -04:00
MauricioCarneiro a2b69790a6 Merge pull request #128 from broadinstitute/eb_rr_polyploid_compression_GSA-639 2013-03-28 06:39:43 -07:00
Mark DePristo fde7d36926 Updating md5s due to changes in assembly graph creation algorithms and default parameter 2013-03-27 15:31:24 -04:00
Mark DePristo 197d149495 Increase the maxNumHaplotypesInPopulation to 25
-- A somewhat arbitrary increase, and will need some evaluation but necessary to get good results on the AFR integrationtest.
2013-03-27 15:31:24 -04:00
Mark DePristo 66910b036c Added new and improved suffix and node merging algorithms
-- These new algorithms are more powerful than the restricted diamond merging algoriths, in that they can merge nodes with multiple incoming and outgoing edges.  Together the splitter + merger algorithms will correctly merge many more cases than the original headless and tailless diamond merger.
-- Refactored haplotype caller infrastructure into graphs package, code cleanup
-- Cleanup new merging / splitting algorithms, with proper docs and unit tests
-- Fix bug in zipping of linear chains.  Because the multiplicity can be 0, protect ourselves with a max function call
-- Fix BaseEdge.max unit test
-- Add docs and some more unit tests
-- Move error correct from DeBruijnGraph to DeBruijnAssembler
-- Replaced uses of System.out.println with logger.info
-- Don't make multiplicity == 0 nodes look like they should be pruned
-- Fix toString of Path
2013-03-27 15:31:18 -04:00
Mark DePristo 39f2e811e5 Increase max cigar elements from SW before failing path creation to 20 from 6
-- This allows more diversity in paths, which is sometimes necessary when we cannot simply graphs that have large bubbles
2013-03-26 14:27:18 -04:00
Mark DePristo b1b615b668 BaseGraph shouldn't implement getEdge -- no idea why I added this 2013-03-26 14:27:18 -04:00
Mark DePristo a97576384d Fix bug in the HC not respecting the requested pruning 2013-03-26 14:27:18 -04:00
Mark DePristo 78c672676b Bugfix for pruning and removing non-reference edges in graph
-- Previous algorithms were applying pruneGraph inappropriately on the raw sequence graph (where each vertex is a single base).  This results in overpruning of the graph, as prunegraph really relied on the zipping of linear chains (and the sharing of weight this provides) to avoid over-pruning the graph.  Probably we should think hard about this.  This commit fixes this logic, so we zip the graph between pruning
-- In this process ID's a fundamental problem with how we were trimming away vertices that occur on a path from the reference source to sink.  In fact, we were leaving in any vertex that happened to be accessible from source, any vertices in cycles, and any vertex that wasn't the absolute end of a chain going to a sink.  The new algorithm fixes all of this, using a BaseGraphIterator that's a general approach to walking the base graph.  Other routines that use the same traversal idiom refactored to use this iterator.  Added unit tests for all of these capabilities.
-- Created new BaseGraphIterator, which abstracts common access patterns to graph, and use this where appropriate
2013-03-26 14:27:18 -04:00
Mark DePristo ad04fdb233 PerReadAlleleLikelihoodMap getMostLikelyAllele returns an MostLikelyAllele objects now
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users.  The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not.  That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves.  There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second.  For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads.   All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event.  In this case our annotations will all fall apart, returning their default values.  Added a JIRA to address this (should be discussed in group meeting)
2013-03-26 14:27:13 -04:00
Mark DePristo 2472828e1c HC bug fixes: no longer create reference graphs with cycles
-- Though not intended, it was possible to create reference graphs with cycles in the case where you started the graph with a homopolymer of length > the kmer.  The previous test would fail to catch this case.  Now its not possible
-- Lots of code cleanup and refactoring in this push.  Split the monolithic createGraphFromSequences into simple calls to addReferenceKmersToGraph and addReadKmersToGraph which themselves share lower level functions like addKmerPairFromSeqToGraph.
-- Fix performance problem with reduced reads and the HC, where we were calling add kmer pair for each count in the reduced read, instead of just calling it once with a multiplicity of count.
-- Refactor addKmersToGraph() to use things like addOrUpdateEdge, now the code is very clear
2013-03-26 10:12:24 -04:00
Mark DePristo 1917d55dc2 Bugfix for DeBruijnAssembler: don't fail when read length > haplotype length
-- The previous version would generate graphs that had no reference bases at all in the situation where the reference haplotype was < the longer read length, which would cause the kmer size to exceed the reference haplotype length.  Now return immediately with a null graph when this occurs as opposed to continuing and eventually causing an error
2013-03-26 10:12:17 -04:00
Mark DePristo 464e65ea96 Disable error correcting kmers by default in the HC
-- The error correction algorithm can break the reference graph in some cases by error correcting us into a bad state for the reference sequence.  Because we know that the error correction algorithm isn't ideal, and worse, doesn't actually seem to improve the calling itself on chr20, I've simply disabled error correction by default and allowed it to be turned on with a hidden argument.
-- In the process I've changed a bit the assembly interface, moving some common arguments us into the LocalAssemblyEngine, which are turned on/off via setter methods.
-- Went through the updated arguments in the HC to be @Hidden and @Advanced as appropriate
-- Don't write out an errorcorrected graph when debugging and error correction isn't enabled
2013-03-26 10:05:17 -04:00
Eric Banks 593d3469d4 Refactored the het (polyploid) consensus creation in ReduceReads.
* It is now cleaner and easier to test; added tests for newly implemented methods.
 * Many fixes to the logic to make it work
   * The most important change was that after triggering het compression we actually need to back it out if it
      creates reads that incorporated too many softclips at any one position (because they get unclipped).
   * There was also an off-by-one error in the general code that only manifested itself with het compression.
 * Removed support for creating a het consensus around deletions (which was broken anyways).
   * Mauricio gave his blessing for this.
 * Het compression now works only against known sites (with -known argument).
    * The user can pass in one or more VCFs with known SNPs (other variants are ignored).
    * If no known SNPs are provided het compression will automatically be disabled.
 * Added SAM tag to stranded (i.e. het compressed) reduced reads to distinguish their
   strandedness from normal reduced reads.
    * GATKSAMRecord now checks for this tag when determining whether or not the read is stranded.
    * This allows us to update the FisherStrand annotation to count het compressed reduced reads
       towards the FS calculation.
    * [It would have been nice to mark the normal reads as unstranded but then we wouldn't be
       backwards compatible.]
    * Updated integration tests accordingly with new het compressed bams (both for RR and UG).
 * In the process of fixing the FS annotation I noticed that SpanningDeletions wasn't handling
   RR properly, so I fixed it too.
    * Also, the test in the UG engine for determining whether there are too many overlapping
       deletions is updated to handle RR.
 * I added a special hook in the RR integration tests to additionally run the systematic
   coverage checking tool I wrote earlier.
    * AssessReducedCoverage is now run against all RR integration tests to ensure coverage is
       not lost from original to reduced bam.
    * This helped uncover a huge bug in the MultiSampleCompressor where it would drop reads
       from all but 1 sample (now fixed).
    * AssessReducedCoverage moved from private to protected for packaging reasons.
 * #resolve GSA-639

At this point, this commit encompasses most of what is needed for het compression to go live.
There are still a few TODO items that I want to get in before the 2.5 release, but I will save
those for a separate branch because as it is I feel bad for the person who needs to review all
these changes (sorry, Mauricio).
2013-03-25 09:34:54 -04:00
Mark DePristo 965043472a Vastly more powerful, cleaner graph simplification approach
-- Generalizes previous node merging and splitting approaches.  Can split common prefixes and suffices among nodes, build a subgraph representing this new structure, and incorporate it into the original graph.  Introduces the concept of edges with 0 multiplicity (for purely structural reasons) as well as vertices with no sequence (again, for structural reasons).  Fully UnitTested.  These new algorithms can now really simplify diamond configurations as well as ones sources and sinks that arrive / depart linearly at a common single root node.
-- This new suite of algorithms is fully integrated into the HC, replacing previous approaches
-- SeqGraph transformations are applied iteratively (zipping, splitting, merging) until no operations can be performed on the graph.  This further simplifies the graphs, as splitting nodes may enable other merging / zip operations to go.
2013-03-23 17:40:55 -04:00
Ryan Poplin c15453542e Merge pull request #124 from broadinstitute/md_hc_lowmapq_read_filter
HC now by default only uses reads with MAPQ >= 20 for assembly and calli...
2013-03-21 12:00:28 -07:00
Mark DePristo 7ae15dadbe HC now by default only uses reads with MAPQ >= 20 for assembly and calling
-- Previously we tried to include lots of these low mapping quality reads in the assembly and calling, but we effectively were just filtering them out anyway while generating an enormous amount of computational expense to handle them, as well as much larger memory requirements.  The new version simply uses a read filter to remove them upfront.  This causes no major problems -- at least, none that don't have other underlying causes -- compared to 10-11mb of the KB
-- Update MD5s to reflect changes due to no longer including mmq < 20 by default
2013-03-21 13:10:50 -04:00
Ryan Poplin b9c331c2fa Bug fix in HC gga mode.
-- Don't try to test alleles which haven't had haplotypes assigned to them
2013-03-21 11:02:41 -04:00
Mark DePristo aa7f172b18 Cap the computational cost of the kmer based error correction in the DeBruijnGraph
-- Simply don't do more than MAX_CORRECTION_OPS_TO_ALLOW = 5000 * 1000 operations to correct a graph.  If the number of ops would exceed this threshold, the original graph is used.
-- Overall the algorithm is just extremely computational expensive, and actually doesn't implement the correct correction.  So we live with this limitations while we continue to explore better algorithms
-- Updating MD5s to reflect changes in assembly algorithms
2013-03-21 09:21:35 -04:00
Mark DePristo d94b3f85bc Increase NUM_BEST_PATHS_PER_KMER_GRAPH in DeBruijnAssembler to 25
-- The value of 11 was too small to properly return a real low-frequency variant in our the 1000G AFR integration test.
2013-03-20 22:54:38 -04:00
Mark DePristo 6d7d21ca47 Bugfix for incorrect branch diamond merging algorithm
-- Previous version was just incorrectly accumulating information about nodes that were completely eliminated by the common suffix, so we were dropping some reference connections between vertices.  Fixed.  In the process simplified the entire algorithm and codebase
-- Resolves https://jira.broadinstitute.org/browse/GSA-884
2013-03-20 22:54:37 -04:00
Mark DePristo 3a8f001c27 Misc. fixes upon pull request review
-- DeBruijnAssemblerUnitTest and AlignmentUtilsUnitTest were both in DEBUG = true mode (bad!)
-- Remove the maxHaplotypesToConsider feature of HC as it's not useful
2013-03-20 22:54:37 -04:00
Mark DePristo d3b756bdc7 BaseVertex optimization: don't clone byte[] unnecessarily
-- Don't clone sequence upon construction or in getSequence(), as these are frequently called, memory allocating routines and cloning will be prohibitively expensive
2013-03-20 22:54:37 -04:00
Mark DePristo 5226b24a11 HaplotypeCaller instructure cleanup and unit testing
-- UnitTest for isRootOfDiamond along with key bugfix detected while testing
-- Fix up the equals methods in BaseEdge.  Now called hasSameSourceAndTarget and seqEquals.  A much more meaningful naming
-- Generalize graphEquals to use seqEquals, so it works equally well with Debruijn and SeqGraphs
-- Add BaseVertex method called seqEquals that returns true if two BaseVertex objects have the same sequence
-- Reorganize SeqGraph mergeNodes into a single master function that does zipping, branch merging, and zipping again, rather than having this done in the DeBruijnAssembler itself
-- Massive expansion of the SeqGraph unit tests.  We now really test out the zipping and branch merging code.
-- Near final cleanup of the current codebase
-- DeBruijnVertex cleanup and optimizations.  Since kmer graphs don't allow sequences longer than the kmer size, the suffix is always a byte, not a byte[].  Optimize the code to make use of this constraint
2013-03-20 22:54:37 -04:00
Mark DePristo 2e36f15861 Update md5s to reflect new downsampling and assembly algorithm output
-- Only minor differences, with improvement in allele discovery where the sites differ.  The test of an insertion at the start of the MT no longer calls a 1 bp indel at position 0 in the genome
2013-03-20 22:54:37 -04:00
Mark DePristo 1fa5050faf Cleanup, unit test, and optimize KBestPaths and Path
-- Split Path from inner class of KBestPaths
-- Use google MinMaxPriorityQueue to track best k paths, a more efficient implementation
-- Path now properly typed throughout the code
-- Path maintains a on-demand hashset of BaseEdges so that path.containsEdge is fast
2013-03-20 22:54:36 -04:00
Mark DePristo 98c4cd060d HaplotypeCaller now uses SeqGraph instead of kmer graph to build haplotypes.
-- DeBruijnAssembler functions are no longer static.  This isn't the right way to unit test your code
-- An a HaplotypeCaller command line option to use low-quality bases in the assembly
-- Refactored DeBruijnGraph and associated libraries into base class
-- Refactored out BaseEdge, BaseGraph, and BaseVertex from DeBruijn equivalents.  These DeBruijn versions now inherit from these base classes.  Added some reasonable unit tests for the base and Debruijn edges and vertex classes.
-- SeqVertex: allows multiple vertices in the sequence graph to have the same sequence and yet be distinct
-- Further refactoring of DeBruijnAssembler in preparation for the full SeqGraph <-> DeBruijnGraph split
-- Moved generic methods in DeBruijnAssembler into BaseGraph
-- Created a simple SeqGraph that contains SeqVertex objects
-- Simple chain zipper for SeqGraph that reproduces the results for the mergeNode function on DeBruijnGraphs
-- A working version of the diamond remodeling algorithm in SeqGraph that converts graphs that look like A -> Xa, A -> Ya, Xa -> Z, Ya -> Z into A -> X -> a, A -Y -> a, a -> Z
-- Allow SeqGraph zip merging of vertices where the in vertex has multiple incoming edges or the out vertex has multiple outgoing edges
-- Fix all unit tests so they work with the new SeqGraph system.  All tests passed without modification.
-- Debugging makes it easier to tell which kmer graph contributes to a haplotype
-- Better docs and unit tests for BaseVertex, SeqVertex, BaseEdge, and KMerErrorCorrector
-- Remove unnecessary printing of cleaning info in BaseGraph
-- Turn off kmer graph creation in DeBruijnAssembler.java
-- Only print SeqGraphs when debugGraphTransformations is set to true
-- Rename DeBruijnGraphUnitTest to SeqGraphUnitTest.  Now builds DeBruijnGraph, converts to SeqGraph, uses SeqGraph.mergenodes and tests for equality.
-- Update KBestPathsUnitTest to use SeqGraphs not DebruijnGraphs
-- DebruijnVertex now longer takes kmer argument -- it's implicit that the kmer length is the sequence.length now
2013-03-20 22:54:36 -04:00
Mark DePristo 0f4328f6fe Basic kmer error correction algorithm xfor the HaplotypeCaller
-- Error correction algorithm for the assembler.  Only error correct reads to others that are exactly 1 mismatch away
-- The assembler logic is now: build initial graph, error correct*, merge nodes*, prune dead nodes, merge again, make haplotypes.  The * elements are new
-- Refactored the printing routines a bit so it's easy to write a single graph to disk for testing.
-- Easier way to control the testing of the graph assembly algorithms
-- Move graph printing function to DeBruijnAssemblyGraph from DeBruijnAssembler
-- Simple protected parsing function for making DeBruijnAssemblyGraph
-- Change the default prune factor for the graph to 1, from 2
-- debugging graph transformations are controllable from command line
2013-03-20 22:54:36 -04:00
Mark DePristo 53a904bcbd Bugfix for HaplotypeCaller: GSA-822 for trimming softclipped reads
-- Previous version would not trim down soft clip bases that extend beyond the active region, causing the assembly graph to go haywire.  The new code explicitly reverts soft clips to M bases with the ever useful ReadClipper, and then trims.  Note this isn't a 100% fix for the issue, as it's possible that the newly unclipped bases might in reality extend beyond the active region, should their true alignment include a deletion in the reference.  Needs to be fixed.  JIRA added

-- See https://jira.broadinstitute.org/browse/GSA-822
-- #resolve #fix GSA-822
2013-03-20 22:54:36 -04:00
Mark DePristo ffea6dd95f HaplotypeCaller now has the ability to only consider the best N haplotypes for genotyping
-- Added a -dontGenotype mode for testing assembly efficiency
-- However, it looks like this has a very negative impact on the quality of the results, so the code should be deleted
2013-03-20 22:54:36 -04:00
Mark DePristo a783f19ab1 Fix for potential HaplotypeCaller bug in annotation ordering
-- Annotations were being called on VariantContext that might needed to be trimmed.  Simply inverted the order of operations so trimming occurs before the annotations are added.
-- Minor cleanup of call to PairHMM in LikelihoodCalculationEngine
2013-03-20 22:54:35 -04:00
Eric Banks 1fae750ebe Merge pull request #120 from broadinstitute/aw_reduce_reads_clear_name_cache
Clear ReduceReads name cache after each set of reads produced by ReduceR...
2013-03-20 19:47:42 -07:00
Guillermo del Angel ea01dbf130 Fix to issue encountered when running HaplotypeCaller in GGA mode with data from other 1000G callers.
In particular, someone produced a tandem repeat site with 57 alt alleles (sic) which made the caller blow up.
Inelegant fix is to detect if # of alleles is > our max cached capacity, and if so, emit an informative warning and skip site.
-- Added unit test to UG engine to cover this case.
-- Commit to posterity private scala script currently used for 1000G indel consensus (still very much subject to changes).
GSA-878 #resolve
2013-03-20 14:30:37 -04:00
Geraldine Van der Auwera 95a9ed853d Made some documentation updates & fixes
--Mostly doc block tweaks
	--Added @DocumentedGATKFeature to some walkers that were undocumented because they were ending up in "uncategorized". Very important for GSA: if a walker is in public or protected, it HAS to be properly tagged-in. If it's not ready for the public, it should be in private.
2013-03-20 06:15:20 -04:00
Alec Wysoker bccc9d79e5 Clear ReduceReads name cache after each set of reads produced by ReduceReadsStash.
Name cache was filling up with names of all reads in entire file, which for large file eventually
consumes all of memory.  Only keep read name cache for the reads that are together in one variant
region, so that a pair of reads within the same variant region will still be joined via read name.
Otherwise the ability to connect a read to its mate is lost.

Update MD5s in integration test to reflect altered output.
Add new integration test that confirms that pair within variant region is joined by read name.
2013-03-19 14:12:33 -04:00
Ryan Poplin 0cf5d30dac Bug fix in assembly for edge case in which the extendPartialHaplotype function was filling in deletions in the middle of haplotypes. 2013-03-15 14:20:25 -04:00
Ryan Poplin b8991f5e98 Fix for edge case bug of trying to create insertions/deletions on the edge of contigs.
-- Added integration test using MT that previously failed
2013-03-15 12:32:13 -04:00
Mark DePristo 2d35065238 QualityByDepth remaps QD values > 40 to a gaussian around 30
-- This is a temporarily fix / hack to deal with the very high QD values that are generated by the haplotype caller when nearby events occur within reads.  In that case, the QUAL field can be many fold higher than normal, and results in an inflated QD value.  This hack projects such high QD values back into the good range (as these are good variants in general) so they aren't filtered away by VQSR.
-- The long-term solution to this problem is to move the HaplotypeCaller to the full bubble calling algorithm
-- Update md5s
2013-03-14 16:09:41 -04:00
droazen 0fd9f0e77c Merge pull request #104 from broadinstitute/eb_fix_output_annotation_GSA-837
Fixed the logic of the @Output annotation and its interaction with 'required'
2013-03-14 12:52:00 -07:00
Ryan Poplin 38914384d1 Changing CALLED_IN_DB_UNKNOWN_STATUS to count as TRUE_POSITIVEs in the simplified stats for AssessNA12878. 2013-03-14 14:44:18 -04:00
Geraldine Van der Auwera 61349ecefa Cleaned up annotations
- Moved AverageAltAlleleLength, MappingQualityZeroFraction and TechnologyComposition to Private
  - VariantType, TransmissionDisequilibriumTest, MVLikelihoodRatio and GCContent are no longer Experimental
  - AlleleBalanceBySample, HardyWeinberg and HomopolymerRun are Experimental and available to users with a big bold caveat message
  - Refactored getMeanAltAlleleLength() out of AverageAltAlleleLength into GATKVariantContextUtils in order to make QualByDepth independent of where AverageAltAlleleLength lives
  - Unrelated change, bundled in for convenience: made HC argument includeUnmappedreads @Hidden
  - Removed unnecessary check in AverageAltAlleleLength
2013-03-14 14:26:48 -04:00
Eric Banks 7cab709a88 Fixed the logic of the @Output annotation and its interaction with 'required'.
ALL GATK DEVELOPERS PLEASE READ NOTES BELOW:

I have updated the @Output annotation to behave differently and to include a 'defaultToStdout' tag.
  * The 'defaultToStdout' tags lets walkers specify whether to default to stdout if -o is not provided.
  * The logic for @Output is now:
    * if required==true then -o MUST be provided or a User Error is generated.
    * if required==false and defaultToStdout==true then the output is assigned to stdout if no -o is provided.
      * this is the default behavior (i.e. @Output with no modifiers).
    * if required==false and defaultToStdout==false then the output object is null.
      * use this combination for truly optional outputs (e.g. the -badSites option in AssessNA12878).

  * I have updated walkers so that previous behavior has been maintained (as best I could).
    * In general, all @Outputs with default long/short names have required=false.
    * Walkers with nWayOut options must have required==false and defaultToStdout==false (I added checks for this)
  * I added unit tests for @Output changes with David's help (thanks!).
  * #resolve GSA-837
2013-03-14 11:58:51 -04:00
Mark DePristo b5b63eaac7 New GATKSAMRecord concept of a strandless read, update to FS
-- Strandless GATK reads are ones where they don't really have a meaningful strand value, such as Reduced Reads or fragment merged reads.  Added GATKSAMRecord support for such reads, along with unit tests
-- The merge overlapping fragments code in FragmentUtils now produces strandless merged fragments
-- FisherStrand annotation generalized to treat strandless as providing 1/2 the representative count for both strands.  This means that that merged fragments are properly handled from the HC, so we don't hallucinate fake strand-bias just because we managed to merge a lot of reads together.
-- The previous getReducedCount() wouldn't work if a read was made into a reduced read after getReducedCount() had been called.  Added new GATKSAMRecord method setReducedCounts() that does the right thing.  Updated SlidingWindow and SyntheticRead to explicitly call this function, and so the readTag parameter is now gone.
-- Update MD5s for change to FS calculation.  Differences are just minor updates to the FS
2013-03-13 11:16:36 -04:00
MauricioCarneiro 4403e3572a Merge pull request #94 from broadinstitute/gg_gatkdoc_docfixes_GSATDG-111 2013-03-12 13:02:35 -07:00
MauricioCarneiro 3a16ba04d4 Merge pull request #97 from broadinstitute/eb_refactor_sliding_window
Refactoring of SlidingWindow class in RR to reduce complexity and fix important bug
2013-03-12 12:27:26 -07:00
Geraldine Van der Auwera f972963918 Fixed issues raised by Appistry QA (mostly small fixes, corrections & clarifications to GATKDocs)
GATK-73 updated docs for bqsr args
GATK-9 differentiate CountRODs from CountRODsByRef
GATK-76 generate GATKDoc for CatVariants
GATK-4 made resource arg required
GATK-10 added -o, some docs to CountMales; some docs to CountLoci
GATK-11 fixed by MC's -o change; straightened out the docs.
GATK-77 fixed references to wiki
GATK-76 Added Ami's doc block
GATK-14 Added note that these annotations can only be used with VariantAnnotator
GATK-15 specified required=false for two arguments
GATK-23 Added documentation block
GATK-33 Added documentation
GATK-34 Added documentation
GATK-32 Corrected arg name and docstring in DiffObjects
GATK-32 Added note to DO doc about reference (required but unused)
GATK-29 Added doc block to CountIntervals
GATK-31 Added @Output PrintStream to enable -o
GATK-35 Touched up docs
GATK-36 Touched up docs, specified verbosity is optional
GATK-60 Corrected GContent annot module location in gatkdocs
GATK-68 touched up docs and arg docstrings
GATK-16 Added note of caution about calling RODRequiringAnnotations as a group
GATK-61 Added run requirements (num samples, min genotype quality)
Tweaked template and generic doc block formatting (h2 to h3 titles)
GATK-62 Added a caveat to HR annot
Made experimental annotation hidden
GATK-75 Added setup info regarding BWA
GATK-22 Clarified some argument requirements
GATK-48 Clarified -G doc comments
GATK-67 Added arg requirement
GATK-58 Added annotation and usage docs
GSATDG-96 Corrected doc
Updated MD5 for DiffObjectsIntegrationTests (only change is link in table title)
2013-03-12 10:57:14 -04:00
Eric Banks 05e69b6294 Refactoring of SlidingWindow class in RR to reduce complexity and fix important bug.
* Allow RR to write its BAM to stdout by setting required=true for @Output.
  * Fixed bug in sliding window where a break in coverage after a long stretch without
     a variant region was causing a doubling of all the reads before the break.
  * Refactored SlidingWindow.updateHeaderCounts() into 3 separate tested methods.
  * Refactored polyploid consensus code out of SlidingWindow.compressVariantRegion().
2013-03-12 09:06:55 -04:00
Ryan Poplin c96fbcb995 Use the indel heterozygosity prior when calling indels with the HC 2013-03-11 14:12:43 -04:00
Guillermo del Angel 695723ba43 Two features useful for ancient DNA processing.
Ancient DNA sequencing data is in many ways different from modern data, and methods to analyze it need to be adapted accordingly.
Feature 1: Read adaptor trimming. Ancient DNA libraries typically have very short inserts (in the order of 50 bp), so typical Illumina libraries sequenced in, say, 100bp HiSeq will have a large adaptor component being read after the insert.
If this adaptor is not removed, data will not be aligneable. There are third party tools that remove adaptor and potentially merge read pairs, but are cumbersome to use and require precise knowledge of the library construction and adaptor sequence.
-- New walker ReadAdaptorTrimmer walks through paired end data, computes pair overlap and trims auto-detected adaptor sequence.
-- Unit tests added for trimming operation.
-- Utility walker (may be retired later) DetailedReadLengthDistribution computes insert size or read length distribution stratified by read group and mapping status and outputs a GATKReport with data.
-- Renamed MaxReadLengthFilter to ReadLengthFilter and added ability to specify minimum read length as a filter (may be useful if, as a consequence of adaptor trimming, we're left with a lot of very short reads which will map poorly and will just clutter output BAMs).

Feature 2: Unbiased site QUAL estimation: many times ancestral allele status is not known and VCF fields like QUAL, QD, GQ, etc. are affected by the pop. gen. prior at a site. This might introduce subtle biases in studies where a species is aligned against the reference of another species, so an option for UG and HC not to apply such prior is introduced.
-- Added -noPrior argument to StandardCallerArgumentCollection.
-- Added option not to fill priors is such argument is set.
-- Added an integration test.
2013-03-09 18:18:13 -05:00
Yossi Farjoun baad965a57 - Changed loadContaminationFile file parser to delimit by tab only. This allows spaces in sampleIDs, which apparently are allowed.
- This was needed since samples with spaces in their names are regularly found in the picard pipeline.
- Modified the tests to account for this (removed spaces from the good tests, and changed the failing tests accordingly)
- Cleaned up the unit tests using a @DataProvider (I'm in love...).
- Moved AlleleBiasedDownsamplingUtilsUnitTest to public to match location of class it is testing (due to the way bamboo operates)
2013-03-07 13:04:24 -05:00
Eric Banks 3759d9dd67 Added the functionality to impose a relative ordering on ReadTransformers in the GATK engine.
* ReadTransformers can say they must be first, must be last, or don't care.
  * By default, none of the existing ones care about ordering except BQSR (must be first).
    * This addresses a bug reported on the forum where BAQ is incorrectly applied before BQSR.
  * The engine now orders the read transformers up front before applying iterators.
  * The engine checks for enabled RTs that are not compatible (e.g. both must be first) and blows up (gracefully).
  * Added unit tests.
2013-03-06 12:38:59 -05:00
Menachem Fromer 928f646afd Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-03-06 10:01:29 -05:00
Eric Banks 78721ee09b Added new walker to split MNPs into their allelic primitives (SNPs).
* Can be extended to complex alleles at some point.
  * Currently only works for bi-allelics (documented).
  * Added unit and integration tests.
2013-03-05 23:16:42 -05:00
Eric Banks bbbaf9ad20 Revert push from stable (I forgot that pushing from stable overwrites current unstable changes) 2013-03-05 09:06:02 -05:00
Eric Banks a037423225 Merged bug fix from Stable into Unstable 2013-03-05 09:03:48 -05:00
Eric Banks 7e1bfd6a7c Included an accidental change from unstable into the previous push 2013-03-05 09:03:31 -05:00
Eric Banks bd4e4f4ee3 Merged bug fix from Stable into Unstable 2013-03-04 23:24:44 -05:00
Eric Banks b715218bfe Fix for mismatching indel quals erro: need to adjust for softclips just like we do for bases and normal quals. 2013-03-04 23:23:18 -05:00
Ryan Poplin ce7554e9d6 Merged bug fix from Stable into Unstable 2013-03-04 12:36:04 -05:00
Ryan Poplin 0697594778 Active regions that don't contain any usable reads should just be skipped over instead of throwing an IllegalStateException. 2013-03-04 12:35:40 -05:00
Mark DePristo 42d3919ca4 Expanded functionality for writing BAMs from HaplotypeCaller
-- The new code includes a new mode to write out a BAM containing reads realigned to the called haplotypes from the HC, which can be easily visualized in IGV.
-- Previous functionality maintained, with bug fixes
-- Haplotype BAM writing code now lives in utils
-- Created a base class that includes most of the functionality of writing reads realigned to haplotypes onto haplotypes.
-- Created two subclasses, one that writes all haplotypes (previous functionality) and a CalledHaplotypeBAMWriter that will only write reads aligned to the actually called haplotypes
-- Extended PerReadAlleleLikelihoodMap.getMostLikelyAllele to optionally restrict set of alleles to consider best
-- Massive increase in unit tests in AlignmentUtils, along with several new powerful functions for manipulating cigars
-- Fix bug in SWPairwiseAlignment that produces cigar elements with 0 size, and are now fixed with consolidateCigar in AlignmentUtils
-- HaplotypeCaller now tracks the called haplotypes in the GenotypingEngine, and returns this information to the HC for use in visualization.
-- Added extensive docs to HaplotypeCaller on how to use this capability
-- BUGFIX -- don't modify the read bases in GATKSAMRecord in LikelihoodCalculationEngine in the HC
-- Cleaned up SWPairwiseAlignment.  Refactored out the big main and supplementary static methods.  Added a unit test with a bug TODO to fix what seems to be an edge case bug in SW
-- Integration test to make sure we can actually write a BAM for each mode.  This test only ensures that the code runs and doesn't exception out.  It doesn't actually enforce any MD5s
-- HaplotypeBAMWriter also left aligns indels in the reads, as SW can return a random placement of a read against the haplotype.  Calls leftAlign to make the alignments more clear, with unit test of real read to cover this case
-- Writes out haplotypes for both all haplotype and called haplotype mode
-- Haplotype writers now get the active region call, regardless of whether an actual call was made.  Only emitting called haplotypes is moved down to CalledHaplotypeBAMWriter
2013-03-03 12:07:29 -05:00
David Roazen c5c99c8339 Split long-running integration test classes into multiple classes
This is to facilitate the current experiment with class-level test
suite parallelism. It's our hope that with these changes, we can get
the runtime of the integration test suite down to 20 minutes or so.

-UnifiedGenotyper tests: these divided nicely into logical categories
 that also happened to distribute the runtime fairly evenly

-UnifiedGenotyperPloidy: these had to be divided arbitrarily into two
 classes in order to halve the runtime

-HaplotypeCaller: turns out that the tests for complex and symbolic
 variants make up half the runtime here, so merely moving these into
 a separate class was sufficient

-BiasedDownsampling: most of these tests use excessively large intervals
 that likely can't be reduced without defeating the goals of the tests. I'm
 disabling these tests for now until they can either be redesigned to use smaller
 intervals around the variants of interest, or refactored into unit tests
 (creating a JIRA for Yossi for this task)
2013-03-01 13:55:23 -05:00
depristo cac3f80c64 Merge pull request #73 from broadinstitute/eb_remove_nested_hashmap_GSA-732
Replace uses of NestedHashMap with NestedIntegerArray.
2013-02-28 05:19:56 -08:00
Eric Banks d2904cb636 Update docs for RTC. 2013-02-27 14:56:44 -05:00
Eric Banks 69b8173535 Replace uses of NestedHashMap with NestedIntegerArray.
* Removed from codebase NestedHashMap since it is unused and untested.
 * Integration tests change because the BQSR CSV is now sorted automatically.
 * Resolves GSA-732
2013-02-27 14:03:39 -05:00
Alec Wysoker c8368ae2a5 Eliminate 7-element arrays in BaseCounts and BaseAndQualsCount and replace with in-line primitive attributes. This is ugly but reduces heap overhead, and changes are localized. When used in conjunction with Mauricio's FastUtil changes it saves and additional 9% or so of execution time. 2013-02-27 12:49:56 -05:00
David Roazen 752f4335a5 Merged bug fix from Stable into Unstable 2013-02-27 05:20:41 -05:00
David Roazen 2a7af43164 Fix improper dependencies in QScripts used by pipeline tests, and attempt to fix the flawed MisencodedBaseQualityUnitTest
-Some QScripts used by public pipeline tests unnecessarily used the (now protected) UnifiedGenotyper.
 Changed them to use PrintReads instead.

-Moved ExampleUnifiedGenotyperPipelineTest to protected

-Attempt to fix the flawed and sporadically failing MisencodedBaseQualityUnitTest:

   After looking at this class a bit, I think the problem was the use of global arrays for the quals
   shared across all reads in all tests (BAMRecord class definitely does not make a separate copy for
   each read!). One test (testFixBadQuals) modifies the bad quals array, and if this happens to run
   before the testBadQualsThrowsError test the bad quals array will have been "fixed" and no exception
   will be thrown.
2013-02-27 04:45:53 -05:00
David Roazen 6466463d5a Merged bug fix from Stable into Unstable 2013-02-26 21:54:54 -05:00
David Roazen 12a3d7ecad Fix licenses on files modified in 2.4-1 2013-02-26 21:53:17 -05:00
David Roazen a53b4a7521 Merged bug fix from Stable into Unstable 2013-02-26 21:41:13 -05:00
David Roazen 65d31ba4ad Fix runtime public -> protected dependencies in the test suite
-replace unnecessary uses of the UnifiedGenotyper by public integration tests
 with PrintReads

-move NanoSchedulerIntegrationTest to protected, since it's completely dependent
 on the UnifiedGenotyper
2013-02-26 21:19:12 -05:00
depristo 93205154b5 Merge pull request #63 from broadinstitute/eb_fix_pairhmm_unittest_GSA-776
Eb fix pairhmm unittest gsa 776
2013-02-26 11:56:58 -08:00
Eric Banks 734353e9df Merge pull request #60 from broadinstitute/mc_fastutil_GSATDG-83
Brought all of ReduceReads to fastutils
2013-02-26 11:56:41 -08:00
David Roazen 8b29030467 Change default downsampling coverage target for the HaplotypeCaller to 250
-was previously set to 30, which seems far too aggressive given that with
 ActiveRegionWalkers, as with LocusWalkers, this limits the depth of any
 pileup returned by LIBS

-250 is a more conservative default used by the UG

-can adjust down/up later based on further experiments (GSA-699 will
 remain open)

-verified with Ryan that all integration test differences are either
 innocent or represent an improvement

GSA-699
2013-02-26 09:33:25 -05:00
Eric Banks 396b7e0933 Fixed the intermittent PairHMM unit test failure.
The issue here is that the OptimizedLikelihoodTestProvider uses the same basic underlying class as the
BasicLikelihoodTestProvider and we were using the BasicTestProvider functionality to pull out tests of
that class; so if the optimized tests were run first we were unintentionally running those same tests
again with the basic ones (but expecting different results).
2013-02-25 15:05:13 -05:00
Eric Banks 7519484a38 Refactored PairHMM.initialize to first take haplotype max length and then the read max length so that it is consistent with other PairHMM methods. 2013-02-25 15:04:23 -05:00
Ryan Poplin 89e2943dd1 The maximum kmer length is derived from the reads.
-- This is done to take advantage of longer reads which can produce less ambiguous haplotypes
-- Integration tests change for HC and BiasedDownsampling
2013-02-25 14:40:25 -05:00
Mauricio Carneiro 0ff3343282 Addressing Eric's comments
-- added @param docs to the new variables
-- made all variables final
-- switched to string builder instead of String for performance.

GSATDG-83
2013-02-25 13:33:47 -05:00
Mauricio Carneiro 9e5a31b595 Brought all of ReduceReads to fastutils
-- Added unit tests to ReduceReads name compression
-- Updated reduce reads walker for unit testing

GSATDG-83
2013-02-23 22:53:23 -05:00
Ryan Poplin 6a639c8ffc Replace Smith-Waterman alignment with the bubble traversal.
-- Instead of doing a full SW alignment against the reference we read off bubbles from the assembly graph.
-- Smith-Waterman is run only on the base composition of the bubbles which drastically reduces runtime.
-- Refactoring graph functions into a new DeBruijnAssemblyGraph class.
-- Bug fix in path.getBases().
-- Adding validation code to the assembly engine.
-- Renaming SimpleDeBruijnAssembler to match the naming of the new Assembly graph class.
-- Adding bug fixes, docs and unit tests for DeBruijnAssemblyGraph and KBestPaths classes.
-- Added ability to ignore bubbles that are too divergent from the reference
-- Max kmer can't be bigger than the extension size.
-- Reverse the order that we create the assembly graphs so that the bigger kmers are used first.
-- New algorithm for determining unassembled insertions based on the bubble traversal instead of the full SW alignment.
-- Don't need the full read span reference loc for anything any more now that we clip down to the extended loc for both assembly and likelihood evaluation.
-- Updating HaplotypeCaller and BiasedDownsampling integration tests.
-- Rebased everything into one commit as requested by Eric
-- improvements to the bubble traversal are coming as a separate push
2013-02-22 15:42:16 -05:00
Mauricio Carneiro e3f01673e1 Implementation of the find and diagnose Queue script
-- Added 'uncovered intervals' output for FindCoveredIntervals
-- updated scala script to make use of it.
2013-02-22 10:19:01 -05:00
Ryan Poplin 62e14f5b58 Bug fix in LikelihoodCalculationEngine: Mapping quality was being cast to a byte and overflowing for reads with large mapping quality scores. 2013-02-21 14:34:17 -05:00
Eric Banks 6996a953a8 Haplotype/Allele based optimizations for the HaplotypeCaller that knock off nearly 20% of the total runtime (multi-sample).
These 2 changes improve runtime performance almost as much as Ryan's previous attempt (with ID-based comparisons):
* Don't unnecessarily overload Allele.getBases() in the Haplotype class.
  * Haplotype.getBases() was calling clone() on the byte array.
* Added a constructor to Allele (and Haplotype) that takes in an Allele as input.
  * It makes a copy of he given allele without having to go through the validation of the bases (since the Allele has already been validated).
  * Rev'ed the variant jar accordingly.

For the reviewer: all tests passed before rebasing, so this should be good to go as far as correctness.
2013-02-21 10:14:11 -05:00
Eric Banks 551d33686c Merge pull request #47 from broadinstitute/aw_reduceread_perf_1_GSA-761
Reduce memory footprint of SyntheticRead by replacing several Lists with...
2013-02-20 04:49:07 -08:00
Eric Banks 9dfdb9528b Merge pull request #49 from broadinstitute/gda_hidden_ug_args
Hide arguments related to reference sample operation in UG - for interna...
2013-02-19 16:18:32 -08:00
Eric Banks 0055a6f1cd Merge pull request #45 from broadinstitute/mc_fix_indelrealigner_GSA-774
Fix to the Indel Realigner bug described in GSA-774
2013-02-19 16:16:48 -08:00
Guillermo del Angel 5a0a9bc488 Hide arguments related to reference sample operation in UG - for internal use only until paper is published and docs are polished. 2013-02-19 19:06:42 -05:00
Mauricio Carneiro 371ea2f24c Fixed IndelRealigner reference length bug (GSA-774)
-- modified ReadBin GenomeLoc to keep track of softStart() and softEnd() of the reads coming in, to make sure the reference will always be sufficient even if we want to use the soft-clipped bases
-- changed the verification from readLength to aligned bases to allow reads with soft-clipped bases
-- switched TreeSet -> PriorityQueue in the ConstrainedMateFixer as some different reads can be considered equal by picard's SAMRecordCoordinateComparator (the Set was replacing them)
-- pulled out ReadBin class so it can be testable
-- added unit tests for ReadBin with soft-clips
-- added tests for getMismatchCount (AlignmentUtils) to make sure it works with soft-clipped reads

GSA-774 #resolve
2013-02-19 16:00:36 -05:00
Alec Wysoker ab75e053da Reduce memory footprint of SyntheticRead by replacing several Lists with a single List of a small private static
class that contains the attributes that were scattered across the several Lists.
2013-02-19 15:33:33 -05:00
Ryan Poplin c025e84c8b Fix for calculating read pos rank sum test with reads that are informative but don't actually overlap the variant due to some hard clipping.
-- Updated a few integration tests for HC, UG, and UG general ploidy
2013-02-19 14:09:24 -05:00
Mark DePristo be45edeff2 ActivityProfile and ActiveRegions respects engine interval boundaries
-- Active regions are created as normal, but they are split and trimmed to the engine intervals when added to the traversal, if there are intervals present.
-- UnitTests for ActiveRegion.splitAndTrimToIntervals
-- GenomeLocSortedSet.getOverlapping uses binary search to efficiently in ~ log N time find overlapping intervals
-- UnitTesting overlap function in GenomeLocSortedSet
-- Discovered fundamental implementation bug in that adding genome locs out of order (elements on 20 then on 19) produces an invalid GenomeLocSortedSet.  Created a JIRA to address this: https://jira.broadinstitute.org/browse/GSA-775
-- Constructor that takes a collection of genome locs now sorts its input and merges overlapping intervals
-- Added docs for the constructors in GLSS
-- Update HaplotypeCaller MD5s, which change because ActiveRegions are now restricted to the engine intervals, which changes slightly the regions in the tests and so the reads in the regions, and thus the md5s
-- GenomeAnalysisEngineUnitTest needs to provide non-null genome loc parser
2013-02-18 10:40:25 -05:00
Ryan Poplin b7e9c342c7 Reducing the size of the reference padding in the HaplotypeCaller. 2013-02-17 11:09:00 -05:00
Mark DePristo 73a363b166 Update MD5s due to new QualityUtils calculations
-- Increase the allowed runtime of one UG integration test
-- The GGA indels mode runs two UG commands, and was barely under the 10 minute limit before.  Some updates can push this right over the edge.  Increased limit
-- CalibrateGenotypeLikelihoods runs on a small data set now, so it's faster
-- Updating MD5s due to more correct quality utils.  DuplicatesWalkers quality estimates have changed.  One UG test has different FS and rank sum tests because the conversion to phred scores are slightly (second decimal place) different
2013-02-16 07:31:38 -08:00
Mark DePristo 3231031c1a Bugfix for FisherStrand
-- FisherStrand pValues can sum to slightly greater than 1.0, so they need to be capped to convert to a Phred-scaled quality score
2013-02-16 07:31:38 -08:00
Mark DePristo 9a29d6d4be Fix an catastrophic bug (WoW!) in the reference calculation of the UG
-- The UG was using MathUtils binomial probability backward, so that the estimated confidence was always NaN, and was as a side effect other utils converted this to a meaningless 0.0.  This is all because there wasn't a unit test.
-- I've fixed the calculation, so it's now log10 based, uses robust MathUtils and QualityUtils functions to compute probabilities, and added a unit test.
2013-02-16 07:31:38 -08:00
Mark DePristo 9e28d1e347 Cleanup and unit tests for QualityUtils
-- Fixed a few conversion bugs with edge case quals (ones that were very high)
-- Fixed a critical bug in the conversion of quals that was causing near capped quals to fall below their actual value.  Will undoubtedly need to fix md5s
-- More precise prob -> qual calculations for very high confidence events in phredScaleCorrectRate, trueProbToQual, and errorProbToQual.  Very likely to improve accuracy of many calculations in the GATK
-- Added errorProbToQual and trueProbToQual calculations that accept an integer cap, and perform the (tricky) conversion from int to byte correctly.
-- Full docs and unit tests for phredScaleCorrectRate and phredScaleErrorRate.
-- Renamed probToQual to trueProbToQual
-- Added goodProbability and log10OneMinusX to MathUtils
-- Went through the GATK and cleaned up many uses of QualityUtils
-- Cleanup constants in QualityUtils
-- Added full docs for all of the constants
-- Rename MAX_QUAL_SCORE to MAX_SAM_QUAL_SCORE for clarity
-- Moved MAX_GATK_USABLE_Q_SCORE to RecalDatum, as it's s BQSR specific feature
-- Convert uses of QualityUtils.errorProbToQual(1-x) to QualityUtils.trueProbToQual(x)
-- Cleanup duplicate quality score routines in MathUtils.  Moved and renamed MathUtils.log10ProbabilityToPhredScale => QualityUtils.phredScaleLog10ErrorRate. Removed 3 routines from MathUtils, and remapped their usages into the better routines in QualityUtils
2013-02-16 07:31:37 -08:00
MauricioCarneiro d80b99143f Merge pull request #37 from broadinstitute/rp_left_alignment_hc_contract_GSA-771 2013-02-15 08:32:45 -08:00
MauricioCarneiro 1dd284a5bb Merge pull request #39 from broadinstitute/tj_printreads_tag_for_bqsr_GSA-720
PrintReads writes a header when used with -BQSR
2013-02-15 07:18:28 -08:00
MauricioCarneiro b58a0eca6b Merge pull request #33 from broadinstitute/gg_more_gatkdocs_tweaks_GSATDG-62
Refactored GATKDocs categories some more ( GSATDG-62 )
2013-02-14 22:35:07 -08:00
Tad Jordan 6cb80591e3 PrintReads writes a header when used with -BQSR 2013-02-14 22:19:14 -05:00
Guillermo del Angel b18f216033 Updated md5's from BiasedDownsamplerIntegrationTest that changed due to changes in HaplotypeCaller - changing HashMaps to LinkedHashMaps changed ordering of reads presented to BiasedDownSampler which changed reads chosen, thereby marginally changing PL's and some site info. 2013-02-14 20:18:49 -05:00
Ryan Poplin 871c8b3866 No need to consider haplotypes which Smith-Waterman aligns off the end of the large padded reference. 2013-02-14 11:18:10 -05:00
Geraldine Van der Auwera 6208742f7c Refactored GATKDocs categories some more ( GSATDG-62 )
-- Renamed ValidatePileup to CheckPileup since validation is reserved word
-- Renamed AlignmentValidation to CheckAlignment (same as above)
-- Refactored category definitions to use constants defined in HelpConstants
-- Fixed a couple of minor typos and an example error
-- Reorganized the GATKDocs index template to use supercategories
-- Refactored integration tests for renamed walkers (my earlier refactoring had screwed them up or not carried over)
2013-02-13 16:49:18 -05:00
depristo 357d196dad Merge pull request #32 from broadinstitute/yf_per-sample-downsampling_GSA_765
Fixed md5s for the per-sample downsampling IntegrationTests that were disabled.
2013-02-13 10:08:11 -08:00
Yossi Farjoun 6d12e5a54f Fixed md5s for the per-sample downsampling IntegrationTests that were disabled.
- got md5s from a interim version that does not have the per-sample downsampling hookedup
- added an integration test that forces the result from flat-downsampling to equal that which results from an equivalent flat contamination file
2013-02-13 12:49:39 -05:00
Guillermo del Angel 4308b27f8c Fixed non-determinism in HaplotypeCaller and some UG calls -
-- HaplotypeCaller and PerReadAlleleLikelihoodMap should use LinkedHashMaps instead of plain HashMaps. That way the ordering when traversing alleles is maintained. If the JVM traverses HashMaps with random ordering, different reads (with same likelihood) may be removed by contamination checker, and different alleles may be picked if they have same likelihoods for all reads.
-- Put in some GATKDocs and contracts in HaplotypeCaller files (far from done, code is a beast)
-- Update md5's due to different order of iteration in LinkedHashMaps instead of HashMaps inside HaplotypeCaller  (due to change in PerReadAlleleLikelihoodMap that also slightly modifies reads chosen by per-read downsampling).
-- Reenabled testHaplotypeCallerMultiSampleGGAMultiAllelic test
-- Added some defensive argument checks into HaplotypeCaller public functions (not intended to be done yet).
2013-02-12 15:43:29 -05:00
Geraldine Van der Auwera dff5ef562b Reorganized walker categories in GATKDocs (@DocumentedGATKFeature details)
-- Sorted out contents of BAM Processing vs. Diagnostics & QC Tools
-- Moved two validation-related walkers from Diagnostics & QC to Validation Utilities
-- Reworded some category names and descriptions to be more explicit and user-friendly
2013-02-12 13:36:15 -05:00
Ryan Poplin 3f2f837b6a Optimization to ReadPosRankSumTest: Don't do the work of parsing through the cigar string for non-informative reads. 2013-02-11 11:36:09 -05:00
Mark DePristo b4417dff5b Updating MD5s due to changes in HMM
-- New HMM has two impacts on MD5s.  First, all indel calls with UG and all calls by HC no longer have the HaplotypeScore computed.  This is for the good, especially given the computational cost of this annotationa and unclear value for HC.  Second, the BaseQualityRankSum values are changing by tiny amounts because of the changes in the HMM likelihoods.
-- Disabled three tests from Yossi that cause strange MD5 differences with calls for HC, created a JIRA for him to enable and fix
-- Disabled the non-deterministic GGA test.  Assigned JIRA to Guillermo
-- With this push I expect all integration tests to pass
2013-02-09 19:19:28 -05:00
Mark DePristo 35139cf990 HaplotypeScore only annotates SNPs
-- The new HMM new edge conditions the likelihoods are offset by log10(n possible starts) so the results don't really mean "fits the haplotype well" any longer.  This results in grossly inflated HaplotypeScores for indels and with the HaplotypeCaller.  So I'm simply not going to emit this annotation value any longer for indels and for the HC
2013-02-09 19:19:28 -05:00
Mark DePristo e40d83f00e Final version of PairHMMs with correct edge conditions
-- Uses 1/N for N potential start sites as the probability of starting at any one of the potential start sites
-- Add flag that says to use the original edge condition, respected by all subclasses.  This brings the new code back to the original state, but with all of the cleanup I've done
-- Only test configurations where the read length <= haplotype length.  I think this is actually the contract, but we'll talk about this tomorrow
-- Fix egregious bug with the myLog10SumLog10 function doing the exact opposite of the requested arguments, so that doExact really meant don't do exact
-- PairHMM now exposes computeReadLikelihoodGivenHaplotypeLog10 but subclasses must overload subComputeReadLikelihoodGivenHaplotypeLog10.  This protected function does the work, and the public function will do argument and result QC
-- Have to be more tolerant of reference (approximate) HMM.  All unit tests from the original HMM implementations pass now
-- Added locs of docs
-- Generalize unit tests with multiple equivalent matches of read to haplotype
-- Added runtime argument checking for initial and computeReadLikelihoodGivenHaplotypeLog10
-- Functions to dumpMatrices for debugging
-- Fix nasty bug (without original unit tests) in LoglessPairHMM
-- Max read and haplotype lengths only worked in previous code if they were exactly equal to the provided read and haplotype sizes.  Fixed bug.  Added unit test to ensure this doesn't break again.
-- Added dupString(string, n) method to Utils
-- Added TODOs for next commit.  Need to compute number of potential start sites not in initialize but in the calc routine since this number depends not on the max sizes but the actual read sizes
-- Unit tests for the hapStartIndex functionality of PairHMM
-- Moved computeFirstDifferingPosition to PairHMM, and added unit tests
-- Added extensive unit tests for the hapStartIndex functionality of computeReadLikelihoodGivenHaplotypeLog10
-- Still TODOs left in the code that I'll fix up
-- Logless now compute constants, if they haven't been yet initialized, even if you forgot to say so
-- General: the likelihood penalty for potential start sites is now properly computed against the actual read and reference bases, not the maximum.  This involved moving some initialize() code into the computeLikelihoods function.  That's ok because all of the potential log10 functions are actually going to cached versions, so the slowdown is minimal
-- Added some unit tests to ensure that common errors (providing haplotypes too long, reads too long, not initializing the HMM) are captured as errors
2013-02-09 19:19:22 -05:00
Mark DePristo 09595cdeb9 Remove ExactPairHMM and OriginalPairHMM, everyone just uses Log10PairHMM with appropriate arguments 2013-02-09 13:06:54 -05:00
Mark DePristo 2d802e17a4 Delete the CachingPairHMM 2013-02-09 13:06:54 -05:00
Mark DePristo 7dcafe8b81 Preliminary version of LoglessCachingPairHMM that avoids positive likelihoods
-- Would have been squashed but could not because of subsequent deletion of Caching and Exact/Original PairHMMs
-- Actual working unit tests for PairHMMUnitTest
-- Fixed incorrect logic in how I compared hmm results to the theoretical and exact results
-- PairHMM has protected variables used throughout the subclasses
2013-02-09 13:06:54 -05:00
Mark DePristo 7fb620dce7 Generalize and fixup ContigComparator
-- Now uses a SAMSequenceDictionary to do the comparison of contigs (which is the right way to do it)
-- Added unit tests
2013-02-09 09:52:13 -05:00
Mauricio Carneiro d004bfbe6f walker to calculate per base coverage distribution
-- Base distribution optionally includes deletions
-- Implemented an optional filtered coverage distribution option
-- Integration tests added for every feature of the traversal

This walker is specially fast for the task due to the ability to calculate uncovered bases without having to visit the loci. This capability should be made generic in the future for the advantage of DiagnoseTargets and DepthOfCoverage.
GSATDG-45 #resolve
2013-02-07 16:33:05 -05:00
Mauricio Carneiro 5f49c95cc1 Added distance across contigs calculation to GenomeLocs
-- distance across contigs is calculated given a sequence dictionary (from SAMFileHeader)
-- unit test added
GSATDG-45
2013-02-07 16:31:41 -05:00
depristo cd4aec177a Merge pull request #20 from broadinstitute/aw_reduceread_perf_1_GSA-761
Aw reduceread perf 1 gsa 761
2013-02-07 12:11:05 -08:00
Eric Banks 9826192854 Added contracts, docs, and tests for several methods in AlignmentUtils. There are over 74K tests being run now for this class!
* AlignmentUtils.getMismatchCount()
* AlignmentUtils.calcAlignmentByteArrayOffset()
* AlignmentUtils.readToAlignmentByteArray().
* AlignmentUtils.leftAlignIndel()
2013-02-07 13:04:24 -05:00
Alec Wysoker e88bc753aa Replace with map.containsKey followed by map.get with map.get followed by null check. 2013-02-07 11:58:41 -05:00
Alec Wysoker 72e496d6f3 Eliminate unnecessary zeroing out of primitive arrays immediately after new. 2013-02-07 11:57:43 -05:00
Eric Banks 481982202d Fixing the failing RR integration tests.
* After consulting Tim/David/Mauricio we determined that the md5 changes were due to different encodings of binary arrays in samjdk
   * However, it made no functional difference to the results (confirmed by Eric) so we agreed to update md5s
 * Also, the header of one of the test bams was malformed but old picard jar didn't perform checks so it only started failing now
   * Fixed the bam
2013-02-06 12:40:56 -05:00
Mark DePristo 59df329776 Fast path for biallelic variants in IndependentAllelesDiploidExactAFCalc
-- If the VariantContext is a bi-allelic variant already, don't split up the VC (it doesn't do anything) and then combine it back together.  This saves us a lot of work on average
-- Be more protective of calls to AFCalc with a VariantContext that might only have ref allele, throwing an exception
2013-02-06 10:34:09 -05:00
eitanbanks 584899329c Merge pull request #13 from broadinstitute/dr_variant_migration_GSA-692
Replace org.broadinstitute.variant with jar built from the Picard repo
2013-02-06 07:22:30 -08:00
Eric Banks 562f2406d7 Added check that BaseRecalibrator is not being run on a reduced bam.
- Throws user exception if it is.
 - Can be turned off with --allow_bqsr_on_reduced_bams_despite_repeated_warnings argument.
 - Added test to check this is working.
 - Added docs to BQSRReadTransformer explaining why this check is not performed on PrintReads end.
 - Added small bug fix to GenomeAnalysisEngine that I uncovered in this process.
 - Added comment about not changing the program record name, as per reviewer comments.
 - Removed unused variable.
2013-02-06 10:14:27 -05:00
Eric Banks 4e5ff3d6f1 Bug fix for NPE in HC with --dbsnp argument.
- I had added the framework in the VA engine but should not have hooked it up to the HC yet since the RefMetaDataTracker is always null.
 - Added contracts and docs to the relevant methods in the VA engine so that this doesn't happen in the future.
2013-02-05 21:59:19 -05:00
Eric Banks e7c35a907f Fixes to BQSR for the --maximum_cycle_value argument.
- It's now written into the recal report so that it can be used in the PrintReads step.
  - Note that we also now write the --deletions_default_quality value which accidentally wasn't being written before!
  - Added tests to make sure that the value of the --maximum_cycle_value is being used properly by PR with -BQSR.
(This is my last non-branch commit; all future pushes will follow new GATK practices)
2013-02-05 17:38:03 -05:00
David Roazen e7e76ed76e Replace org.broadinstitute.variant with jar built from the Picard repo
The migration of org.broadinstitute.variant into the Picard repo is
complete. This commit deletes the org.broadinstitute.variant sources
from our repo and replaces it with a jar built from a checkout of the
latest Picard-public svn revision.
2013-02-05 17:24:25 -05:00
Ryan Poplin cb2dd470b6 Moving the random number generator over to using GenomeAnalysisEngine.getRandomGenerator in the logless versus exact pair hmm unit test. We don't believe this will fix the problem with the non-deterministic test failures but it will give us more information the next time it fails. 2013-02-05 12:56:20 -05:00
MauricioCarneiro 050c4794a5 Merge pull request #11 from yfarjoun/per_sample2
-Added Per-Sample Contamination Removal to UnifiedGenotyper: Added an @A...
2013-02-05 08:04:29 -08:00
Eric Banks 23c6aee236 Added in some basic unit tests for polyploid consensus creation in RR.
- Uncovered small bug in the fix that I added yesterday, which is now fixed properly.
- Uncovered massive general bug: polyploid consensus is totally busted for deletions (because of call to read.getReadBases()[readPos]).
  - Need to consult Mauricio on what to do here (are we supporting het compression for deletions?  (Insertions are definitely not supported)
2013-02-05 10:35:45 -05:00
Yossi Farjoun de03f17be4 -Added Per-Sample Contamination Removal to UnifiedGenotyper: Added an @Advanced option to the StandardCallerArgumentCollection, a file which should
contain two columns, Sample (String) and Fraction (Double) that form the Sample-Fraction map for the per-sample AlleleBiasedDownsampling.
-Integration tests to UnifiedGenotyper (Using artificially contaminated BAMs created from a mixure of two broadly concented samples) were added
-includes throwing an exception in HC if called using per-sample contamination file (not implemented); tested in a new integration test.
-(Note: HaplotypeCaller already has "Flat" contamination--using the same fraction for all samples--what it doesn't have is
   _per-sample_ AlleleBiasedDownsampling, which is what has been added here to the UnifiedGenotyper.
-New class: DefaultHashMap (a Defaulting HashMap...) and new function: loadContaminationFile (which reads a Sample-Fraction file and returns a map).
-Unit tests to the new class and function are provided.
-Added tests to see that malformed contamination files are found and that spaces and tabs are now read properly.
-Merged the integration tests that pertain to biased downsampling, whether HaplotypeCaller or unifiedGenotyper, into a new IntegrationTest class.
2013-02-04 18:24:36 -05:00
Eric Banks 70f3997a38 More RR tests and fixes.
* Fixed implementation of polyploid (het) compression in RR.
  * The test for a usable site was all wrong.  Worked out details with Mauricio to get it right.
  * Added comprehensive unit tests in HeaderElement class to make sure this is done right.
  * Still need to add tests for the actual polyploid compression.
  * No longer allow non-diploid het compression; I don't want to test/handle it, do you?
* Added nearly full coverage of tests for the BaseCounts class.
2013-02-04 15:55:15 -05:00
Ryan Poplin 79ef41e7b1 Added some docs, unit test, and contracts to SimpleDeBruijnAssembler.
-- Testing that cycles in the reference graph fail graph construction appropriately.
-- Minor bug fix in assembly with reduced reads.

Added some docs and contracts to SimpleDeBruijnAssembler

Added a unit test to SimpleDeBruijnAssembler
2013-02-04 15:17:22 -05:00
Geraldine Van der Auwera 43e3a040b6 Updated UnifiedGenotyper GATKDoc (note on ploidy model) 2013-02-04 14:18:56 -05:00
Chris Hartl 41a030f4b7 Apparently I'm a failure at rebasing...there should have been only one commit message to write. But whatever, here it is again:
Part 1 of Variant Annotator Unit tests: PerReadAlleleLikelihoodMap

 - Added contract enforcement for public methods
 - Refactored the conversion from read -> (allele -> likelihood) to allele -> list[read] into its own method
 - added method documentation for non getters/setters
 - finals, finals everywhere
 - Add in a unit test for the PerReadAlleleLikelihoodMap. Complete coverage except for .clear() and a method that is a straight call into a separately-tested utility class.
2013-02-04 14:16:28 -05:00
Ryan Poplin d9fd89ecaa Somehow these md5 updates got lost in my previous git rebase disaster. Sorry for the trouble. 2013-02-04 13:26:18 -05:00
Eric Banks 2d518f3063 More RR-related updates and tests.
- ReduceReads by default now sets up-front ReadWalker downsampling to 40x per start position.
   - This is the value I used in my tests with Picard to show that memory issues pretty much disappeared.
   - This should hopefully take care of the memory issues being reported on the forum.
- Added javadocs to SlidingWindow (the main RR class) to follow GATK conventions.
- Added more unit tests to increase coverage of BaseCounts class.
- Added more unit tests to test I/D operators in the SlidingWindow class.
2013-02-04 12:57:43 -05:00
Menachem Fromer 9b77cdec4b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-02-04 12:03:42 -05:00
Guillermo del Angel 971ded341b Swap java Random generator for GATK one to ensure test determinism 2013-02-04 10:57:34 -05:00
Guillermo del Angel f31bf37a6f First step in better BQSR unit tests for covariates (not done yet): more test coverage in basic covariates, test logging several read groups/read lengths and more combinations simultaneously.
Add basic Javadocs headers for PerReadAlleleLikehoodMap.
2013-02-03 15:31:30 -05:00
Eric Banks 03df5e6ee6 - Added more comprehensive tests for consensus creation to RR. Still need to add tests for I/D ops.
- Added RR qual correctness tests (note that this is a case where we don't add code coverage but still need to test critical infrastructure).
- Also added minor cleanup of BaseUtils
2013-02-01 15:37:19 -05:00
Ryan Poplin 2fee000dba Adding unit tests for KBestPaths class and fixing edge case bugs. 2013-02-01 13:51:31 -05:00
David Roazen c6581e4953 Update MD5s to reflect version number change in the BAM header
I've confirmed via a script that all of these differences only
involve the version number bump in the BAM headers and nothing
else:

< @HD   VN:1.0  GO:none SO:coordinate
---
> @HD   VN:1.4  GO:none SO:coordinate
2013-02-01 13:51:31 -05:00
Guillermo del Angel a520058ef6 Add option to specify maximum STR length to RepeatCovariates from command line to ease testing 2013-02-01 13:51:31 -05:00
Mark DePristo 22f7fe0d52 Expanded unit tests for AlignmentUtils
-- Added JIRA entries for the remaining capabilities to be fixed up and unit tested
2013-02-01 13:51:31 -05:00
Ryan Poplin ac033ce41a Intermediate commit of new bubble assembly graph traversal algorithm for the HaplotypeCaller. Adding functionality for a path from an assembly graph to calculate its own cigar string from each of the bubbles instead of doing a massive Smith-Waterman alignment between the path's full base composition and the reference. 2013-01-31 11:32:19 -05:00
Ryan Poplin 495bca3d1a Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-31 10:12:26 -05:00
Ryan Poplin ca6968d038 Use base List and Map types in the GenotypingEngineUnitTest. 2013-01-31 10:12:18 -05:00
Eric Banks 75ceddf9e5 Adding new unit tests for RR. These tests took a frustratingly long time to get to pass, but now we have a framework for
testing the adding of reads into the SlidingWindow plus consensus creation.  Will flesh these out more after I take care of
some other items on my plate.
2013-01-31 09:46:38 -05:00
Ryan Poplin bb29bd7df7 Use base List and Map types in the HaplotypeCaller when possible. 2013-01-30 17:09:27 -05:00
Ryan Poplin 5f4a063def Breaking up my massive commits into smaller pieces that I can successfully merge and digest. This one enables downsampling in the HaplotypeCaller (by lowering the default dcov to 20) and removes my long-standing, temporary region-based downsampling. 2013-01-30 16:14:07 -05:00
David Roazen 591df2be44 Move additional VariantContext utility methods back to the GATK
Thanks to Eric for his feedback
2013-01-30 13:58:17 -05:00
Ryan Poplin ff8ba03249 Updating BQSR integration test md5s to reflect the updates to the hierarchicalBayesianQualityEstimate function 2013-01-30 13:30:18 -05:00
Ryan Poplin 85dabd321f Adding unit tests for hierarchicalBayesianQualityEstimate function 2013-01-30 13:26:07 -05:00
Ryan Poplin 07fe3dd1ef Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-30 13:19:24 -05:00
David Roazen 9985f82a7a Move BaseUtils back to the GATK by request, along with associated utility methods 2013-01-30 13:09:44 -05:00
Ryan Poplin 2967776458 The Empirical quality column in the recalibration report can't be compared in the BQSRGatherer because the value is calculated using the Bayesian estimate with different priors. This value should never be used from a recalibration report anyway except during plotting. 2013-01-30 12:28:14 -05:00
Eric Banks d067c7f136 Resolving merge conflicts 2013-01-30 10:47:59 -05:00
Eric Banks 9025567cb8 Refactoring the SimpleGenomeLoc into the now public utility UnvalidatingGenomeLoc and the RR-specific FinishedGenomeLoc.
Moved the merging utility methods into GenomeLoc and moved the unit tests around accordingly.
2013-01-30 10:45:29 -05:00
Mark DePristo 4852c7404e GenomeLocs are already comparable, so I'm removing the less complete GenomeLocComparator class and updating ReduceReads and CompressionStash to use built-in comparator 2013-01-30 10:12:27 -05:00
Ryan Poplin 59311aeea2 Getting back null values from the tables is perfectly reasonable if those covariates don't appear in your table. Need to handle them gracefully. 2013-01-30 10:06:14 -05:00
Ryan Poplin e7d7d70247 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-30 10:01:06 -05:00
Mark DePristo 92c5635e19 Cleanup, document, and unit test ActiveRegion
-- All functions tested.  In the testing / review I discovered several bugs in the ActiveRegion routines that manipulate reads.  New version should be correct
-- Enforce correct ordering of supporting states in constructor
-- Enforce read ordering when adding reads to an active region in add
-- Fix bug in HaplotypeCaller map with new updating read spans.  Now get the full span before clipping down reads in map, so that variants are correctly placed w.r.t. the full reference sequence
-- Encapsulate isActive field with an accessor function
-- Make sure that all state lists are unmodifiable, and that the docs are clear about this
-- ActiveRegion equalsExceptReads is for testing only, so make it package protected
-- ActiveRegion.hardClipToRegion must resort reads as they can become out of order
-- Previous version of HC clipped reads but, due to clipping, these reads could no longer overlap the active region.  The old version of HC kept these reads, while the enforced contracts on the ActiveRegion detected this was a problem and those reads are removed.  Has a minor impact on PLs and RankSumTest values
-- Updating HaplotypeCaller MD5s to reflect changes to ActiveRegions read inclusion policy
2013-01-30 09:47:12 -05:00
Mauricio Carneiro 3d9a83c759 BaseCoverageDistributions should be 'by reference'
otherwise we miss all the 0 coverage spots.
2013-01-29 22:37:44 -05:00
Mauricio Carneiro 29fd536c28 Updating licenses manually
Please check that your commit hook is properly pointing at ../../private/shell/pre-commit

Conflicts:
	public/java/test/org/broadinstitute/variant/VariantBaseTest.java
2013-01-29 17:27:53 -05:00
David Roazen a536e1da84 Move some VCF/VariantContext methods back to the GATK based on feedback
-Moved some of the more specialized / complex VariantContext and VCF utility
 methods back to the GATK.

-Due to this re-shuffling, was able to return things like the Pair class back
 to the GATK as well.
2013-01-29 16:56:55 -05:00
Eric Banks e4ec899a87 First pass at adding unit tests for the RR framework: I have added 3 tests and all 3 uncovered RR bugs!
One of the fixes was critical: SlidingWindow was not converting between global and relative positions correctly.
Besides not being correct, it was resulting in a massive slow down of the RR traversal.
That fix definitely breaks at least one of the integration tests, but it's not worth changing md5s now because I'll be
changing things all over RR for the next few days, so I am going to let that test fail indefinitely until I can confirm
general correctness of the tool.
2013-01-29 15:51:07 -05:00
Ryan Poplin cba89e98ad Refactoring the Bayesian empirical quality estimates to be in a single unit-testable function. 2013-01-29 15:50:46 -05:00
Guillermo del Angel 1d5b29e764 Unit tests for repeat covariates: generate 100 random reads consisting of tandem repeat units of random content and size, and check that covariates match expected values at all positions in reads.
Fixed corner case where value of covariate at border between 2 tandem repeats of different length/content wasn't consistent
2013-01-29 15:23:02 -05:00
Guillermo del Angel c11197e361 Refactored repeat covariates to eliminate duplicated code - now all inherit from basic RepeatCovariate abstract class. Comprehensive unit tests coming... 2013-01-29 10:10:24 -05:00
Ryan Poplin 35543b9cba updating BQSR integration test values for the PR half of BQSR. 2013-01-29 09:47:57 -05:00
Ryan Poplin bf25196a0b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-28 22:33:13 -05:00
Ryan Poplin 1f254d29df Don't set the empirical quality when reading in the recal table because then we won't be using the new quality estimates for the prior since the value is cached. 2013-01-28 22:16:43 -05:00
Guillermo del Angel ff799cc79a Fixed bad merge 2013-01-28 20:04:25 -05:00
Guillermo del Angel 5995f01a01 Big intermediate commit (mostly so that I don't have to go again through merge/rebase hell) in expanding BQSR capabilities. Far from done yet:
a) Add option to stratify CalibrateGenotypeLikelihoods by repeat - will add integration test in next push.
b) Simulator to produce BAM files with given error profile - for now only given SNP/indel error rate can be given. A bad context can be specified and if such context is present then error rate is increased to given value.
c) Rewrote RepeatLength covariate to do the right thing - not fully working yet, work in progress.
d) Additional experimental covariates to log repeat unit and combined repeat unit+length. Needs code refactoring/testing
2013-01-28 19:55:46 -05:00
Ryan Poplin d665a8ba0c The Bayesian calculation of Qemp in the BQSR is now hierarchical. This fixes issues in which the covariate bins were very sparse and the prior estimate being used was the original quality score. This resulted in large correction factors for each covariate which breaks the equation. There is also now a new option, qlobalQScorePrior, which can be used to ignore the given (very high) quality scores and instead use this value as the prior. 2013-01-28 15:56:33 -05:00
Ryan Poplin aab160372a No need to sort the BQSR tables by default. 2013-01-28 11:26:01 -05:00
David Roazen f63f27aa13 org.broadinstitute.variant refactor, part 2
-removed sting dependencies from test classes
-removed org.apache.log4j dependency
-misc cleanup
2013-01-28 09:03:46 -05:00
Mauricio Carneiro 1aee8f205e Tool to calculate per base coverage distribution
GSATDG-29 #resolve
2013-01-27 23:38:46 -05:00
Mark DePristo 804caf7a45 HaplotypeCaller Optimization: return a inactive (p = 0.0) activity if the context has no bases in the pileup
-- Allows us to avoid doing a lot of misc. work to set up the genotype when we don't have any data to genotype.  Valuable in the case where we are passing through large regions without any data
2013-01-27 14:10:06 -05:00
Ami Levy-Moonshine b4447cdca2 In cases where one uses VariantContextUtils.GenotypeMergeType.REQUIRE_UNIQUE we used to verify that the samples names are unique in VariantContextUtils.simpleMerge for each VCs. It couse to a bug that was reported on the forum (when a VCs had 2 VC from the same sample).
Now we will check it only in CombineVariants.init using the headers. A new function was added to SamplesUtils with unitTests in CVunitTest.java.
2013-01-25 15:49:51 -05:00
Mark DePristo 3f95f39be3 Updating HC md5s for new cutting algorithm and default band pass filter parameters 2013-01-25 11:07:29 -05:00
Eric Banks f7b80116d6 Don't let users play with the different exact model implementations. 2013-01-25 10:52:02 -05:00
Eric Banks 6dd0e1ddd6 Pulled out the --regenotype functionality from SelectVariants into its own tool: RegenotypeVariants.
This allows us to move SelectVariants into the public suite of tools now.
2013-01-25 09:42:04 -05:00
Mark DePristo 592f90aaef ActivityProfile now cuts intelligently at the best local minimum when in a larger than max size active region
-- This new algorithm is essential to properly handle activity profiles that have many large active regions generated from lots of dense variant events.  The new algorithm passes unit tests and passes visualize visual inspection of both running on 1000G and NA12878
-- Misc. commenting of the code
-- Updated ActiveRegionExtension to include a min active region size
-- Renamed ActiveRegionExtension to ActiveRegionTraversalParameters, as it carries more than just the traversal extension now
2013-01-24 13:48:00 -05:00
Eric Banks 6790e103e0 Moving lots of walkers back from protected to public (along with several of the VA annotations).
Let's see whether Mauricio's automatic git hook really works!
2013-01-24 11:42:49 -05:00
Chris Hartl a3b98daf1a Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-23 14:49:34 -05:00
Chris Hartl 7fcfa4668c Since GenotypeConcordance is now a standalone walker, remove the old GenotypeConcordance evaluation module and the associated integration tests. 2013-01-23 14:47:23 -05:00
Mark DePristo 8026199e4c Updating md5s for CountReadsInActiveRegions and HaplotypeCaller to reflect new activity profile mechanics
-- In this process I discovered a few missed sites in the old code.  The new approach actually produces better HC results than the previous version.
2013-01-23 13:46:01 -05:00
Mark DePristo 8d9b0f1bd5 Restructure ActivityProfiler into root class ActivityProfile and derived class BandPassActivityProfile
-- Required before I jump in an redo the entire activity profile so it's can be run imcrementally
-- This restructuring makes the differences between the two functionalities clearer, as almost all of the functionality is in the base class. The only functionality provided by the BandPassActivityProfile is isolated to a finalizeProfile function overloaded from the base class.
-- Renamed ActivityProfileResult to ActivityProfileState, as this is a clearer indication of its actual functionality.  Almost all of the misc. walker changes are due to this name update
-- Code cleanup and docs for TraverseActiveRegions
-- Expanded unit tests for ActivityProfile and ActivityProfileState
2013-01-23 13:45:21 -05:00
Chris Hartl c500e1d8ac Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-22 15:31:30 -05:00
Chris Hartl d33c755aea Adding docs. 2013-01-22 15:29:33 -05:00
Chris Hartl 7060e01a8e Fix for broken unit test plus some minor changes to comments. Unit tests were broken by my pulling the site status utility function into the enum. Thankfully the unit tests caught my silly duplication of a line. 2013-01-22 15:14:41 -05:00
Mauricio Carneiro 7b8b064165 Last manual license update (hopefully)
if everyone updates their git hook accordingly, this will be the last time I have to manually run the script.

GSATDG-5
2013-01-18 16:13:07 -05:00
Ami Levy-Moonshine 0fb7b73107 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-18 15:03:42 -05:00
Ami Levy-Moonshine 826c29827b change the default VCFs gatherer of the GATK (not just the UG) 2013-01-18 15:03:12 -05:00
Eric Banks cac439bc5e Optimized the Allele Biased Downsampling: now it doesn't re-sort the pileup but just removes reads from the original one.
Added a small fix that slightly changed md5s.
2013-01-18 11:17:31 -05:00
Chris Hartl 08d2da9057 Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-18 10:28:45 -05:00
Chris Hartl bf5748a538 Forgot to actually put in the md5. Also with the new change to record pairing and filtering, the multiple-records integration test changed: the indel records (T/TG | T/TGACA) are matched up (rather than left separate) resulting in properly identifying mismatching alleles, rather than HET-UNAVAILABLE and UNAVAILABLE-HET. Very nice. 2013-01-18 10:25:36 -05:00
Chris Hartl 91030e9afa Bugfix: records that get paired up during the resolution of multiple-records-per-site were not going into genotype-level filtering. Caught via testing.
Testing for moltenized output, and for genotype-level filtering. This tool is now fully functional. There are three todo items:

1) Docs
2) An additional output table that gives concordance proportions normalized by records in both eval and comp (not just total in eval or total in comp)
3) Code cleanup for table creation (putting a table together the way I do takes -way- too many lines of code)
2013-01-18 09:49:48 -05:00
Eric Banks 39c73a6cf5 1. Ryan and I noticed that the FisherStrand annotation was completely busted for indels with reduced reads; fixed.
2. While making the previous fix and unifying FS for SNPs and indels, I noticed that FS was slightly broken in the general case for indels too; fixed.
3. I also fixed a minor bug in the Allele Biased Downsampling code for reduced reads.
2013-01-18 03:35:48 -05:00
Eric Banks 6a903f2c23 I finally gave up on trying to get the Haplotype/Allele merging to work in the HaplotypeCaller.
I've resigned myself instead to create a mapping from Allele to Haplotype.  It's cheap so not a big deal, but really shouldn't be necessary.
Ryan and I are talking about refactoring for GATK2.5.
2013-01-18 01:21:08 -05:00
Eric Banks 6db3e473af Better error message for bad qual 2013-01-17 10:30:04 -05:00
Eric Banks 953592421b I think we got out of sync with the HC tests as we were clobbering each other's changes. Only differences here are to some RankSumTest values. 2013-01-17 09:19:21 -05:00
Eric Banks ded659232b Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 22:49:56 -05:00
Eric Banks a623cca89a Bug fix for HaplotypeCaller, as reported on the forum: when reduced reads didn't completely overlap a deletion call,
we were incorrectly trying to find the reference position of a base on the read that didn't exist.
Added integration test to cover this case.
2013-01-16 22:47:58 -05:00
Eric Banks dbb69a1e10 Need to use ints for quals in HaplotypeScore instead of bytes because of overflow (they are summed when haplotypes are combined) 2013-01-16 22:33:16 -05:00
Chris Hartl e15d4ad278 Addition of moltenize argument for moltenized tabular output. NRD/NRS not moltenized because there are only two columns. 2013-01-16 18:00:23 -05:00
Mark DePristo 3c476a92a2 Add dummy functionality (currently throws an error) to allow HC to include unmapped reads during assembly and calling 2013-01-16 16:25:36 -05:00
Eric Banks 4cf34ee9da Bug fix to FisherStrand: do not let it output INFINITY. This all needs to be unit tested, but that's coming on the horizon. 2013-01-16 15:35:04 -05:00
Mark DePristo 2a42b47e4a Massive expansion of ActiveRegionTraversal unit tests, resulting in several bugfixes to ART
-- UnitTests now include combinational tiling of reads within and spanning shard boundaries
-- ART now properly handles shard transitions, and does so efficiently without requiring hash sets or other collections of reads
-- Updating HC and CountReadsInActiveRegions integration tests
2013-01-16 15:30:00 -05:00
Eric Banks e47a389b26 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 14:59:11 -05:00
Eric Banks d18dbcbac1 Added tests for changing IUPAC bases to Ns, for failing on bad ref bases, and for the HaplotypeCaller not failing when running over a region with an IUPAC base.
Out of curiosity, why does Picard's IndexedFastaSequenceFile allow one to query for start position 0?  When doing so, that base is a line feed (-1 offset to the first base in the contig) which is an illegal base (and which caused me no end of trouble)...
2013-01-16 14:55:33 -05:00
Khalid Shakir 4ffb43079f Re-committing the following changes from Dec 18:
Refactored interval specific arguments out of GATKArgumentCollection into InvtervalArgumentCollection such that it can be used in other CommandLinePrograms.
Updated SelectHeaders to print out full interval arguments.
Added RemoteFile.createUrl(Date expiration) to enable creation of presigned URLs for download over http: or file:.
2013-01-16 12:43:15 -05:00
Eric Banks 445735a4a5 There was no reason to be sharing the Haplotype infrastructure between the HaplotypeCaller and the HaplotypeScore annotation since they were really looking for different things.
Separated them out, adding efficiencies for the HaplotypeScore version.
2013-01-16 11:10:13 -05:00
Eric Banks 392b5cbcdf The CachingIndexedFastaSequenceFile now automatically converts IUPAC bases to Ns and errors out on other non-standard bases.
This way walkers won't see anything except the standard bases plus Ns in the reference.
Added option to turn off this feature (to maintain backwards compatibility).

As part of this commit I cleaned up the BaseUtils code by adding a Base enum and removing all of the static indexes for
each of the bases.  This uncovered a bug in the way the DepthOfCoverage walker counts deletions (it was counting Ns instead!) that isn't covered by tests.  Fortunately that walker is being deprecated soon...
2013-01-16 10:22:43 -05:00
Eric Banks 4fb3e48099 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-16 00:13:38 -05:00
Eric Banks 0d282a7750 Bam writing from HaplotypeCaller seems to be working on all my test cases. Note that it's a hidden debugging option for now.
Please let me know if you notice any bad behavior with it.
2013-01-16 00:12:02 -05:00
Chris Hartl 327169b283 Refactor the method that identifies the site overlap type into the type enum class (so it can be used elsewhere potentially).
Completed todo item: for sites like

(eval)
20   12345   A    C
20   12345   A    AC

(comp)
20   12345   A    C
20   12345   A    ACCC

the records will be matched by the presence of a non-empty intersection of alleles. Any leftover records are then paired with an empty variant context (as though the call was unique). This has one somewhat counterintuitive feature, which is that normally

(eval)
20  12345  A   AC
(comp)
20  12345  A   ACCC

would be classified as 'ALLELES_DO_NOT_MATCH' (and not counted in genotype tables), in the presence of the SNP, they're counted as EVAL_ONLY and TRUTH_ONLY respectively.

+ integration test
2013-01-15 12:13:45 -05:00
Eric Banks d3baa4b8ca Have Haplotype extend the Allele class.
This way, we don't need to create a new Allele for every read/Haplotype pair to be placed in the PerReadAlleleLikelihoodMap (very inefficient).  Also, now we can easily get the Haplotype associated with the best allele for a given read.
2013-01-15 11:36:20 -05:00
Mark DePristo 3c37ea014b Retire original TraverseActiveRegion, leaving only the new optimized version
-- Required some updates to MD5s, which was unexpected, and will be sorted out later with more detailed unit tests
2013-01-15 10:24:45 -05:00
Eric Banks 94800771e3 1. Initial implementation of bam writing for the HaplotypeCaller with -bam argument; currently only assembled haplotypes are emitted.
2. Framework is set up in the VariantAnnotator for the HaplotypeCaller to be able to call in to annotate dbSNP plus comp RODs.  Until the HC uses meta data though, this won't work.
2013-01-15 10:19:18 -05:00
Chris Hartl 682c59ff04 Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-14 13:27:34 -05:00
Chris Hartl 61bc334df1 Ensure output table formatting does not contain NaNs. For (0 eval ref calls)/(0 comp ref calls), set the proportion to 0.00.
Added integration tests (checked against manual tabulation)
2013-01-14 09:21:30 -05:00
Menachem Fromer c33105bead Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-13 18:27:38 -05:00
Ryan Poplin a7fe334a3f calculating the md5s for the new tests. 2013-01-11 15:43:52 -05:00
Ryan Poplin 65afec2a53 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-11 15:22:52 -05:00
Mark DePristo 85b529cced Updating MD5s in HC and UG that changed due to new LIBS
-- Resolved what was clearly a bug in UG (GGA mode was returning a neighboring, equivalent indel site that wasn't in input list.  Not ideal)
-- Trivial read count differences in HC
2013-01-11 15:17:19 -05:00
Mark DePristo 8b83f4d6c7 Near final cleanup of PileupElement
-- All functions documented and unit tested
-- New constructor interface
-- Cleanup some uses of old / removed functionality
2013-01-11 15:17:17 -05:00
Mark DePristo fb9eb3d4ee PileupElement and LIBS cleanup
-- function to create pileup elements in AlignmentStateMachine and LIBS
-- Cleanup pileup element constructors, directing users to LIBS.createPileupFromRead() that really does the right thing
2013-01-11 15:17:17 -05:00
Mark DePristo cc1d259cac Implement get Length and Bases of OfImmediatelyFollowingIndel in PileupElement
-- Added unit tests for this behavior.  Updated users of this code
2013-01-11 15:17:17 -05:00
Mark DePristo 2c38310868 Create LIBS using new AlignmentStateMachine infrastructure
-- Optimizations to AlignmentStateMachine
-- Properly count deletions.  Added unit test for counting routines
-- AlignmentStateMachine.java is no longer recursive
-- Traversals now use new LIBS, not the old one
2013-01-11 15:17:17 -05:00
Mark DePristo b53286cc3c HaplotypeCaller mode to skip assembly and genotyping for performance testing
-- Added HCPerformance evaluation Qscript
-- Added some docs about one of the HC integration tests
-- HaplotypeCaller / ART performance evaluation script
2013-01-11 15:17:16 -05:00
Ryan Poplin e952296c10 Adding HC GGA integration test to cover duplicated input alleles. 2013-01-11 15:01:27 -05:00
Ryan Poplin 7f7f40f851 Adding additional HC GGA integration tests to cover more complicated input alleles. 2013-01-11 14:36:21 -05:00
Eric Banks 85baf71b39 Merged bug fix from Stable into Unstable 2013-01-11 11:05:27 -05:00
Eric Banks d78539774f Another RR bug: off by one error led to ArrayIndexOutOfBoundsException when working with multiple samples and the variant region ended 1 base after the end of the last read for a given sample. 2013-01-11 11:05:09 -05:00
Eric Banks 79b93f659c Merged bug fix from Stable into Unstable 2013-01-11 09:20:13 -05:00
Eric Banks 67fafbb625 Forgot an include 2013-01-11 09:19:46 -05:00
Eric Banks 6bf0cc32f9 When reducing multiple samples it is possible to try to close a region that for a given sample has no reads. Currently we'd NPE. Fixed. 2013-01-11 09:16:19 -05:00
Eric Banks e7906713d9 Moving some random walkers back to public as requested by Mark. Mauricio will the licenses get updated automatically? 2013-01-11 02:03:43 -05:00
Eric Banks 3a51823c2a Clean up imports 2013-01-10 23:35:01 -05:00
Eric Banks e4b7b1955c Forgot to add the note about length normalization to the QD docs 2013-01-10 23:34:06 -05:00
Eric Banks ff5ac986d8 Fix docs for QD 2013-01-10 23:31:46 -05:00
Mauricio Carneiro 2a4ccfe6fd Updated all JAVA file licenses accordingly
GSATDG-5
2013-01-10 17:06:41 -05:00
Mauricio Carneiro dd177b1714 Removing fully commented out varianteval evaluators
- Files were completely commmented out, and were screwing up my license script. Dont like them. Removed them.

GSATDG-5
2013-01-10 17:06:12 -05:00
Chris Hartl 80dec72c53 Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-10 14:35:59 -05:00
Chris Hartl 31a5f88c4f Expanded unit tests to cover the Concordance Metrics class fairly uniformly. 2013-01-10 14:33:47 -05:00
Ryan Poplin 1a18947abf Adding new command line argument requested on the forum to control the maximum number of haplotypes that are sent forward for genotyping. In the presence of a large degree of heterozygosity the current algorithm breaks down and so this argument would need to be increased. 2013-01-09 15:54:02 -05:00
Ryan Poplin 487fb2afb4 Bug fix for the case of overlapping assembled and partially-assembled events created by the HC. Unfortunately the symbolic allele can't be combined with the indel allele because the reference basis will change. 2013-01-09 15:30:46 -05:00
Menachem Fromer 077ea8f30c Added more options to control RBP behavior; raised default RBP PQ threshold to 20 2013-01-09 14:44:22 -05:00
Menachem Fromer 6089a4bf62 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-09 13:26:40 -05:00
Chris Hartl 6787f86803 Eliminate the import of DiploidGenotype, which switched public/private underneath me but for some reason didn't stop me from compiling... 2013-01-09 13:23:24 -05:00
Chris Hartl c1de92b511 Add in some todo items 2013-01-09 13:16:06 -05:00
Chris Hartl 8d126161e2 Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable 2013-01-09 13:15:04 -05:00
Eric Banks 3a0dd4b175 Oops, I broke the build. NOW we shouldn't have any more public->protected dependancies. 2013-01-09 11:12:28 -05:00
Eric Banks a921b06e02 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-09 11:06:17 -05:00
Eric Banks 4fa439d89e Move some classes back to public because they are used in the engine. Move some test classes to protected. We should have no more public->protected dependancies now 2013-01-09 11:06:10 -05:00
Menachem Fromer da3aa68492 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-09 11:04:53 -05:00
Ryan Poplin 396bce1f28 Reverting this change until we can figure out the right thing to do here. 2013-01-09 10:51:30 -05:00
Eric Banks 676e79542a Bring CombineVariants back to public since it's used for SG. I needed to break ChromosomeCountConstants out of ChromosomeCounts to make this work. 2013-01-09 10:39:48 -05:00
Ryan Poplin c87ad8c0ef Bug fixes related to HC's GGA mode. Tracking just the artificial allele isn't sufficient when there are multiple GGA records that change the reference basis. Also, duplicated records screw up the tracking of merged alleles. 2013-01-09 10:00:46 -05:00
Chris Hartl ad7c2a08d4 Normalize by the event type counts, not the total genotype counts: more useful normalization. 2013-01-09 09:12:41 -05:00
Chris Hartl b56754606b Initial break-out of GenotypeConcordance as a standalone walker. Some basic functionality testing. Currently performs only a pairwise comparison, but is very careful about proper tabulation through the GenotypeType enum. 2013-01-09 00:34:07 -05:00
Menachem Fromer 13c05a6cf2 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-08 16:40:44 -05:00
Eric Banks 264cc9e78d Resolve protected->public dependencies for BQSR by wrapping the BQSR-specific arguments in a new class.
Instead of the GATK Engine creating a new BaseRecalibrator (not clean), it just keeps track of the arguments (clean).

There are still some dependency issues, but it looks like they are related to Ami's code.  Need to look into it further.
2013-01-08 16:23:29 -05:00
Eric Banks ee7d85c6e6 Move around the DiploidGenotype classes (so it can be used by the GATKPaperGenotyper) 2013-01-08 15:53:11 -05:00
Eric Banks 0e2e672521 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-08 15:46:39 -05:00
Eric Banks f0bd1b5ae5 Okay, all public->protected dependencies are gone except for the BQSR arguments. I'll need to think through this but should be able to make that work too. 2013-01-08 15:46:32 -05:00
Tad Jordan 9cbb2b868f ErrorRatePerCycleIntegrationTest fix
-- sorting by row is required
2013-01-08 14:53:07 -05:00
Eric Banks b099e2b4ae Moving integration tests to protected 2013-01-08 09:34:08 -05:00
Eric Banks dfe4cf1301 When merging the PerReadAlleleLikelihoodMap classes, I forgot to initialize the underlying objects. This was causing the LargeScaleTests to fail. 2013-01-08 09:24:12 -05:00
Eric Banks 9e6c2afb28 Not sure why IntelliJ didn't add this for commit like the other dirs 2013-01-07 18:11:07 -05:00
Ami Levy-Moonshine 3787ee6de7 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-07 17:07:29 -05:00
Eric Banks 47d030a52d Oops, move the covariates over too 2013-01-07 15:47:25 -05:00
Eric Banks 35699a8376 Move bqsr utils to protected 2013-01-07 15:41:21 -05:00
Eric Banks a0219acfaa Collapse the PerReadAlleleLikelihoodMap classes into 1 now that Lite is gone 2013-01-07 14:55:21 -05:00
Eric Banks 35d9bd377c Moved (nearly) all Walkers from public to protected and removed GATKLite utils 2013-01-07 14:42:40 -05:00
Ryan Poplin 4f95f850b3 Bug fix in the HC's allele mapping for multi-allelic events. Using the allele alone as a key isn't sufficient because alleles change when the reference allele changes during VariantContextUtils.simpleMerge for multi-allelic events. 2013-01-07 11:05:44 -05:00
Ami Levy-Moonshine d3c2c97fb2 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-06 23:35:47 -05:00
Ami Levy-Moonshine 81eef3aa37 merge development branchs of log-less HMM and FastGatherer to master 2013-01-06 23:01:58 -05:00
Eric Banks 52067f0549 Handle merge conflicts 2013-01-06 12:29:12 -05:00
Chris Hartl 41bc416b65 Remove AAL and update MD5s. 2013-01-04 16:46:14 -05:00
Eric Banks bce6fce58d Resolving merge conflicts after Mark's latest push 2013-01-04 14:46:39 -05:00
Eric Banks dd7f5e2be7 Hooking up the Bayesian estimate code for calculating Qemp in BQSR; various fixes after adding unit tests. 2013-01-04 14:43:11 -05:00
Mark DePristo bbdf9ee91b BQSR cleanup: merge Advanced and Standard recalibration engine into just the RecalibrationEngine
-- As we are no longer maintaining a public/protected system we need only have one RecalibrationEngine.
-- Misc. code cleanup and docs along the way
2013-01-04 11:39:24 -05:00
Mark DePristo 7df47418d8 BQSR optimization: make RecalibrationTables thread-local, and merge results in onTraversalDone
-- With the newer, faster BQSR, scaling was limited by the NestedIntegerArray.  The solution to this is to make the entire table thread-local, so that each nct thread has its own data and doesn't have any collisions.
-- Removed the previous partial solution of having a thread-local quality score table
-- Added a new argument -lowMemory
2013-01-04 11:39:24 -05:00
Chris Hartl 3753209584 One md5sum slipped past in the HC integration test. 2013-01-02 15:09:28 -05:00
Chris Hartl e1d09ab0db QD is now divided by the average length of the alternate allele (weighted by the allele count). The average length is stored in a related annotation, "AAL", which can be used to re-compute the "old" QD by simple multiplication. Integration tests *should* all pass. 2013-01-02 14:41:29 -05:00
Eric Banks 275575462f Protect against non-standard ref bases. Ryan, please review. 2012-12-26 15:46:21 -05:00
Mark DePristo 7bf1f67273 BQSR optimization: read group x quality score calibration table is thread-local
-- AdvancedRecalibrationEngine now uses a thread-local table for the quality score table, and in finalizeData merges these thread-local tables into the final table.  Radically reduces the contention for RecalDatum in this very highly used table
-- Refactored the utility function to combine two tables into RecalUtils, and created UnitTests for this function, as well as all of RecalibrationTables.  Updated combine in RecalibrationReport to use this table combiner function
-- Made several core functions in RecalDatum into final methods for performance
-- Added RecalibrationTestUtils, a home for recalibration testing utilities
2012-12-24 13:35:58 -05:00
Mark DePristo 0f0188ddb1 Optimization of BQSR
-- Created a ReadRecalibrationInfo class that holds all of the information (read, base quality vectors, error vectors) for a read for the call to updateDataForRead in RecalibrationEngine.  This object has a restrictive interface to just get information about specific qual and error values at offset and for event type.  This restrict allows us to avoid creating an vector of byte 45 for each read to represent BI and BD values not in the reads.  Shaves 5% of the runtime off the entire code.
-- Cleaned up code and added lots more docs
-- With this commit we no longer have much in the way of low-hanging fruit left in the optimization of BQSR.  95% of the runtime is spent in BAQing the read, and updating the RecalData in the NestedIntegerArrays.
2012-12-24 13:35:09 -05:00
Ami Levy-Moonshine 6590039bc3 add fast gather to UG; change UG to work with log-lessHMM (work in prograss) 2012-12-20 14:58:57 -05:00
Ryan Poplin c8cd6ac465 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-20 14:58:04 -05:00
Ryan Poplin a098888f4d Updating missed UG md5 2012-12-20 14:57:53 -05:00
Tad Jordan b491c177ff Added functionality of outputting sorted GATKReport Tables
- Added an optional argument to BaseRecalibrator to produce sorted GATKReport Tables
- Modified BSQR Integration Tests to include the optional argument. Tests now produce sorted tables
2012-12-20 14:02:21 -05:00
Eric Banks 4a7e0427a3 Pushing the RR bug fix that I puished into unstable into stable, as requested by Tim 2012-12-19 11:47:16 -05:00
Ryan Poplin 54e5c84018 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-19 11:31:40 -05:00
Ryan Poplin aa39037be8 updating UG integration tests. 2012-12-19 11:31:35 -05:00
Eric Banks 70479cb71d RR bug fix: we were failing when a read started with an insertion just at the edge of the consensus region.
The weird part is that the comments claimed it was doing what it was supposed to, but it didn't actually do it.
Now we maintain the last header element of the consensus (but without bases and quals) if it adjoins an element with an insertion.

Added the user's test file as an integration test.
2012-12-19 10:59:07 -05:00
David Roazen 07b369ca7e Move VCF/BCF2/VariantContext to new standalone org.broadinstitute.variant package
This is an intermediate commit so that there is a record of these changes in our
commit history. Next step is to isolate the test classes as well, and then move
the entire package to the Picard repository and replace it with a jar in our repo.

-Removed all dependencies on org.broadinstitute.sting (still need to do the test classes,
though)

-Had to split some of the utility classes into "GATK-specific" vs generic methods
(eg., GATKVCFUtils vs. VCFUtils)

-Placement of some methods and choice of exception classes to replace the StingExceptions
and UserExceptions may need to be tweaked until everyone is happy, but this can be
done after the move.
2012-12-19 10:25:22 -05:00
Ryan Poplin 92185dd5f4 updating HC integration tests. 2012-12-19 10:12:07 -05:00
Ryan Poplin 902ca7ea70 Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-18 15:45:33 -05:00
Ryan Poplin b5d590ba92 Based on NA12878 knowledge base experiments updating HC to allow for a much smaller minimum kmer length in the assembly graph. 2012-12-18 15:43:56 -05:00
Mark DePristo a481d006f0 Optimizations for applying BQSR table with PrintReads
-- Cleaned up code in updateDataForRead so that constant values where not computed in inner loops
-- BaseRecalibrator doesn't create it's own fasta index reader, it just piggy backs on the GATK one
-- ReadCovariates <init> now uses a thread local cache for it's int[][][] keys member variable.  This stops us from recreating an expensive array over and over.  In order to make this really work had to update recordValues in ContextCovariate so it writes 0s over base values its skipping because of low quality base clipping.  Previously the values in the ReadCovariates keys were 0 because they were never modified by ContextCovariates. Now these values are actually zero'd out explicitly by the covariates.
2012-12-17 16:47:27 -05:00
Mark DePristo 5ec25797b3 Optimizations for BaseRecalibrator
-- No longer computes at each update the overall read group table.  Now computes this derived table only at the end of the computation, using the ByQual table as input.  Reduces BQSR runtime by 1/3 in my test
2012-12-17 16:47:27 -05:00
Ryan Poplin 98f18b5f9e Changing the HC over to using the non-contamination-downsampled read maps for the purposes of annotations. This behavior now matches the UG. There is a new command line option to go back to the older behavior to explore the differences. 2012-12-17 11:27:44 -05:00
Mauricio Carneiro 5f1afb4136 Fixing an off-by-one clipping error in ReduceReads for reads off the contig
Reads that are soft-clipped off the contig (before the beginning of the contig) were being soft-clipped to position 0 instead of 1 because of an off-by-one issue. Fixed and included in the integration test.
2012-12-13 22:10:11 -05:00
Mauricio Carneiro 74344a3871 Bringing in the changes from the CMI repo 2012-12-13 21:59:37 -05:00
Mark DePristo aeab932c63 Actual working version of unflushing VCFWriter
-- Uses high-performance local writer backed by byte array that writes the entire VCF line in some write operation to the underlying output stream.
-- Fixes problems with indexing of unflushed writes while still allowing efficient block zipping
-- Same (or better) IO performance as previous implementation
-- IndexingVariantContextWriter now properly closes the underlying output stream when it's closed
-- Updated compressed VCF output file
2012-12-13 16:15:08 -05:00
Ryan Poplin 211a6e78ea Further related bug fixes to GGA mode in the HC: some variants (especially MNPs) were causing problems because they don't have to start at the current location to match the allele being genotyped. Fixed. 2012-12-12 14:53:02 -05:00
Mauricio Carneiro 33290bfe0c Added integration test to catch the read off contig in ReduceReads.
So upstream changes won't break it again.
2012-12-12 13:49:54 -05:00
Mark DePristo 5632c13bf2 Resolves GSA-681 / Compressed VCF.gz output is too big because of unnecessary call to flush().
-- Now compressed output VCFs are properly blocked compressed (i.e., they are actually smaller than the uncompressed VCF)
2012-12-12 10:27:07 -05:00
Mark DePristo dd52a70d45 Fix AFCalcResult unit test
-- I was simply passing in the wrong values into the function.  Fixed the calls, and expanded the docs on what needs to be passed in.
2012-12-11 10:40:12 -05:00
Mauricio Carneiro 8a115edbaf ReduceReads is now scattered by contig
It's no longer safe to scatter/gather by interval because now we don't hard-clip to the intervals anymore.
2012-12-10 15:25:27 -05:00
Eric Banks bdda63d973 Related bug fixes to GGA mode in the HC: some variants (especially MNPs) were causing problems because they don't have to start at the current location to match the allele being genotyped. Fixed. 2012-12-10 14:47:04 -05:00
David Roazen 46edab6d6a Use the new downsampling implementation by default
-Switch back to the old implementation, if needed, with --use_legacy_downsampler

-LocusIteratorByStateExperimental becomes the new LocusIteratorByState, and
the original LocusIteratorByState becomes LegacyLocusIteratorByState

-Similarly, the ExperimentalReadShardBalancer becomes the new ReadShardBalancer,
with the old one renamed to LegacyReadShardBalancer

-Performance improvements: locus traversals used to be 20% slower in the new
downsampling implementation, now they are roughly the same speed.

-Tests show a very high level of concordance with UG calls from the previous
implementation, with some new calls and edge cases that still require more examination.

-With the new implementation, can now use -dcov with ReadWalkers to set a limit
on the max # of reads per alignment start position per sample. Appropriate value
for ReadWalker dcov may be in the single digits for some tools, but this too
requires more investigation.
2012-12-10 09:44:50 -05:00
Eric Banks 574d5b467f Bug fix for indel HMM: protect against situation where long reads (e.g. Sanger) in a pileup can lead to a read starting after the haplotype end for a given haplotype. 2012-12-09 02:09:34 -05:00
Eric Banks 406adb8d44 The allele biased downsampling should not abort if there's a reduced read. Rather it should always keep the RR and downsample only original reads in the pileup. 2012-12-05 23:15:36 -05:00
Mark DePristo d0cab795b7 Got caught in the middle of a bad integration test, that was fixed in independent push. Moved test bam into testdata. 2012-12-05 14:49:22 -05:00
Eric Banks ef87b18e09 In retrospect, it wasn't a good idea to have FisherStrand handle reduced reads since they are always on the forward strand. For now, FS ignores reduced reads but I've added a note (and JIRA) to make this work once the RR het compression is enabled (since we will have directionality in reads then). 2012-12-05 02:00:35 -05:00
Eric Banks 726332db79 Disabling the testNoCmdLineHeaderStdout test in UG because it keeps crashing when I run it locally 2012-12-05 00:54:00 -05:00
Eric Banks bca860723a Updating tests to handle bad validation data files (that used the wrong qual score encoding); overrides push from stable. 2012-12-03 22:01:07 -05:00
Ryan Poplin d5ed184691 Updating the HC integration test md5s. According to the NA12878 knowledge base this commit cuts down the FP rate by more than 50 percent with no loss in sensitivity. 2012-12-03 15:38:59 -05:00
Ryan Poplin 156d6a5e0b misc minor bug fixes to GenotypingEngine. 2012-12-03 12:47:35 -05:00
Ryan Poplin 18b002c99c Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2012-12-03 10:08:56 -05:00
Ryan Poplin 1bdf17ef53 Reworking of how the likelihood calculation is organized in the HaplotypeCaller to facilitate the inclusion of per allele downsampling. We now use the downsampling for both the GL calculations and the annotation calculations. 2012-12-02 11:58:32 -05:00
Mark DePristo 2849889af5 Updating md5 for UG 2012-12-01 14:24:19 -05:00
Joel Thibault 198923b597 Add ActiveRegionReadState handling 2012-11-28 13:59:57 -05:00
Mark DePristo c676853731 Merged bug fix from Stable into Unstable. Updating md5s
Conflicts:
	protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java
2012-11-28 12:54:36 -05:00
Mark DePristo a1d6461121 Critical bugfix to AFCalcResult affecting UG/HC quality score emission thresholds
As reported by Menachem Fromer: a critical bug in AFCalcResult:

Specifically, the implementation:
    public boolean isPolymorphic(final Allele allele, final double log10minPNonRef) {
        return getLog10PosteriorOfAFGt0ForAllele(allele) >= log10minPNonRef;
    }

seems incorrect and should probably be:

getLog10PosteriorOfAFEq0ForAllele(allele) <= log10minPNonRef

The issue here is that the 30 represents a Phred-scaled probability of *error* and it's currently being compared to a log probability of *non-error*.

Instead, we need to require that our probability of error be less than the error threshold.
This bug has only a minor impact on the calls -- hardly any sites change -- which is good.  But the inverted logic effects multi-allelic sites significantly.  Basically you only hit this logic with multiple alleles, and in that case it'\s including extra alt alleles incorrectly, and throwing out good ones.

Change was to create a new function that properly handles thresholds that are PhredScaled quality scores:

    /**
     * Same as #isPolymorphic but takes a phred-scaled quality score as input
     */
    public boolean isPolymorphicPhredScaledQual(final Allele allele, final double minPNonRefPhredScaledQual) {
        if ( minPNonRefPhredScaledQual < 0 ) throw new IllegalArgumentException("phredScaledQual " + minPNonRefPhredScaledQual + " < 0 ");
        final double log10Threshold = Math.log10(QualityUtils.qualToProb(minPNonRefPhredScaledQual));
        return isPolymorphic(allele, log10Threshold);
    }
2012-11-28 12:08:02 -05:00
Mauricio Carneiro 97fd5de260 Merging latest CMI updates with UNSTABLE 2012-11-27 09:08:00 -05:00
Ryan Poplin 59cef880d1 Updating HC integration tests because experimental, HC-specific annotations have been removed. 2012-11-26 12:20:07 -05:00
Ryan Poplin c3b7dd1374 Misc cleanup in the HaplotypeCaller. Cleaning up unused arguments after recent changes to HC-GenotypingEngine 2012-11-26 12:19:11 -05:00
Ryan Poplin fedc4fde6c Merged bug fix from Stable into Unstable 2012-11-25 21:55:55 -05:00
Ryan Poplin d978cfe835 Soft clipped bases shouldn't be counted in the delocalized BQSR. 2012-11-25 21:55:29 -05:00
Eric Banks 937ac7290f Lots more GGA fixes for the HC now that I understand what's going on internally. Integration tests pass except for the GGA test which I believe now produces better results. 2012-11-20 16:13:29 -05:00
Eric Banks f0b8a0228f Quick fix for HC refactoring: when copying over Haplotype objects, make sure to copy over the artificial allele used to create it too. 2012-11-19 09:57:55 -05:00
Eric Banks ff180a8e02 Significant refactoring of the Haplotype Caller to handle problems with GGA. The main fix is that we now maintain a mapping from 'original' allele to 'Smith-Waterman-based' allele so that we no longer need to do a (buggy) matching throughout the calling process. 2012-11-19 09:09:57 -05:00
Mauricio Carneiro 8b749673bc centralize header element removal in reduce reads 2012-11-14 13:59:34 -05:00
Mauricio Carneiro e35fd1c717 Merging CMI-0.5.0 and GATK-2.2 together. 2012-11-14 10:42:03 -05:00
Mauricio Carneiro a079d8d0d1 Breaking the utility to write @PG tags for SAMFileWriters and StingSAMFileWriters 2012-11-14 10:33:22 -05:00
Mauricio Carneiro dba31018f4 Implementation of BySampleSAMFileWriter
ReduceReads now works with the n-way-out capability, splitting by sample.
DEV-27 #resolve #time 3m
2012-11-14 10:33:22 -05:00
Mauricio Carneiro a17cd54b68 Co-Reduction implementation in ReduceReads
ReduceReads now co-reduces bams if they're passed in toghether with multiple -I. Co-reduction forces every variant region in one sample to be a variant region in all samples.
Also:
  * Added integrationtest for co-reduction
  * Fixed bug with new no-recalculation implementation of the marksites object where the last object wasn't being removed after finalizing a variant region (updated MD5's accordingly)

DEV-200 #resolve #time 8m
2012-11-14 10:33:21 -05:00
Eric Banks e93d461910 Adding integration test to BQSR for the csv file 2012-11-09 09:11:04 -05:00
Eric Banks 2da76db945 Updating integration tests 2012-11-06 22:23:05 -08:00
Eric Banks 0a2dded093 Fixes for bugs uncovered by unit tests 2012-11-06 16:07:40 -08:00
Eric Banks b07106b3a7 Reimplement the allele biased downsampling to be smarter. Now we don't blindly pull n% of reads off of each allele. Instead, we try all possible genotype conformations for the contaminating sample and choose the one that provides the best genotype for the target sample (based heuristically on allele balance). This method allows us to save some of the reads that belong to the target sample, which should make Daniel M happy. Added unit tests to test the biased downsampling functionality. 2012-11-06 14:39:58 -08:00
Mark DePristo 1444cd753b Bugfix for GSA-647 HaplotypeCaller misses good variant because the active region doesn't trigger for an exome
-- The logic for determining active regions was a bit broken in the HC when intervals were used in the system
-- TraverseActiveRegions now uses the AllLocus view, since we always want to see all reference sites, not just those covered.  Simplifies logic of TAR
-- Non-overlapping intervals are always treated as separate objects for determing active / inactive state.  This means that each exon will stand on its own when deciding if it should be active or inactive
-- Misc. cleanup, docs of some TAR infrastructure to make it safer and easier to debug in the future.
-- Committing the SingleExomeCalling script that I used to find this problem, and will continue to use in evaluating calling of a single exome with the HC
-- Make sure to get all of the reads into the set of potentially active reads, even for genomic locations that themselves don't overlap the engine intervals but may have reads that overlap the regions
-- Remove excessively expensive calls to check bases are upper cased in ReferenceContext
-- Update md5s after a lot of manual review and discussion with Ryan
2012-11-01 15:34:04 -04:00
Eric Banks f8af8a2355 Moving UG integration tests to protected since they use protected-only contamination filtering. Adding a new UGLite integration test to confirm that contamination filtering is ignored in lite. 2012-10-31 21:28:07 -04:00
Guillermo del Angel 51a9ce28e1 Merge remote-tracking branch 'unstable/master' into develop 2012-10-31 10:29:48 -04:00
Ryan Poplin 4e661847b2 DelocalizedBaseRecalibrator becomes the BaseRecalibrator. 2012-10-29 12:53:39 -04:00
David Roazen 35483a7eef Update MD5s for PrintReads with BQSR Integration Test
The MD5s for these tests were changed in commit 87435f1074615b2cd016f042980109fd53962c8d
to match the output of a broken version of BaseRecalibration. With the patch in
commit c397102ecc1fd1d2cd8f209a8f358ab4a60b50a7, the output once again matches the
*original* MD5s for these tests, and does not vary as you increase -nct.

Final resolution to GSA-632
2012-10-26 14:25:25 -04:00
Eric Banks ed11b7dab2 Fix UG parallelization test 2012-10-26 12:10:44 -04:00
Eric Banks 7a706ed345 Fix some of the broken integration tests 2012-10-26 11:23:44 -04:00
Eric Banks b06f689d4b Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-26 02:13:26 -04:00
Eric Banks a53e03d525 Do not let reduced reads get removed in the contamination down-sampling 2012-10-26 02:13:04 -04:00
Eric Banks bf3d61ce82 The default value for --contamination_fraction_to_filter is now 0.05 (5%) in both UG and HC. Users of GATK-lite get pushed down to 0% by default (since it's not enabled) or get a user error if they try to set it. 2012-10-26 01:04:51 -04:00
Mark DePristo cc8c12b954 Committing a broken version of BaseRecalibration
-- I'm committing because there's some kind of fundamental problem with the ReadCovariates cache, in that historical data isn't being cleared / computed properly, and I'd rather it fail for a while than leave it in JIRA.
-- The integration tests test the -nct with PrintReads to get 1, 2, 4 and the 4 fails.  But that's because of this incorrect calculation
-- Updating GATKPerformanceOverTime with the new @ClassType annotation
2012-10-25 14:46:35 -04:00
Eric Banks df9e0b7045 Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-25 02:49:54 -04:00
Eric Banks 72714ee43e Minor patches to get the contamination down-sampling working for indels. Adding @Hidden logging output for easy debugging. 2012-10-25 02:47:42 -04:00
Eric Banks c6b57fffda Added allele biased down-sampling capabilities to the PerReadAlleleLikelihoodMap object, which means that both the UG and HC can use this functionality. Note that it's only available in protected, so GATK-lite users won't be allowed to enable it. Needs more testing. 2012-10-24 22:52:25 -04:00
Eric Banks 9da7bbf689 Refactoring the PerReadAlleleLikelihoodMap in preparation for adding contntamination downsampling into protected only. 2012-10-24 15:49:07 -04:00
David Roazen 02018ca764 Legacy BaseRecalibrator walker is neither TreeReducible nor NanoSchedulable
The old BaseRecalibrator walker is and never will be thread-safe, since it's a
LocusWalker that uses read attributes to track state.

ONLY the newer DelocalizedBaseRecalibrator is believed likely to be thread-safe
at this point. It is safe to run the DelocalizedBaseRecalibrator with -nct > 1
for testing purposes, but wait for further testing to be done before using it
for production purposes in multithreaded mode.
2012-10-24 15:22:50 -04:00
David Roazen 991658acf4 BQSR: use more granular locking for concurrency control
-With this change, BQSR performance scales properly by thread rather
 than gaining nothing from additional threads.
-Benefits are seen when using either -nt (HierarchicalMicroScheduler) or -nct
 (NanoScheduler)
-Removes high-level locks in the recalibration engines and NestedIntegerArray
 in favor of maximally-granular locks on and around manipulation of the leaf
 nodes of the NestedIntegerArray.
-NestedIntegerArray now creates all interior nodes upfront rather than on
 the fly to avoid the need for locking during tree traversals. This uses
 more memory in the initial part of BQSR runs, but the BQSR would eventually
 converge to use this memory anyway over the course of a typical run.

IMPORTANT NOTE: This does not mean it's safe to run the old BaseRecalibrator
walker with multiple threads. The BaseRecalibrator walker is and will never be
thread-safe, as it's a LocusWalker that uses read attributes to track
state information. ONLY the newer DelocalizedBaseRecalibrator can be made
thread-safe (and will hopefully be made so in my subsequent commits). This
commit addresses performance, not correctness.
2012-10-24 15:22:50 -04:00
Ryan Poplin a27ee26481 updating HC integration test. 2012-10-24 14:08:39 -04:00
Ryan Poplin 094db7bf24 We now require at least 10 samples to merge variants into complex events in the HC. Added a new population based bam for the complex event integration test. 2012-10-24 14:07:36 -04:00
Mauricio Carneiro 4cd1a92358 Updating RR integration tests
Forgot to update the integration tests after merging DEV-117 with optimizations from GATK main repo.
2012-10-23 11:26:26 -04:00
Mauricio Carneiro c210b7cde4 Merge GATK repo into CMI-GATK
Bringing in the following relevant changes:
	* Fixes the indel realigner N-Way out null pointer exception DEV-10
	* Optimizations to ReduceReads that bring the run time to 1/3rd.

Conflicts:
	protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SlidingWindow.java

DEV-10 #resolve #time 2m
2012-10-23 10:59:11 -04:00
Mauricio Carneiro bbf7a0fb09 Adding integration test to ReduceReads coreduction
DEV-117 #resolve
2012-10-23 10:56:33 -04:00
Mark DePristo 90f59803fd MaxAltAlleles now defaults to 6, no more MaxAltAllelesForIndels
-- Updated StandardCallerArgumentCollection to remove MaxAltAllelesForIndels. Previous argument is deprecated with meaningful doc message for people to use maxAltAlleles
-- All constructores, factory methods, and test builders and their users updated to provide just a single argument
-- Updating MD5s for integration tests that change due to genotyping more alleles
-- Adding more alleles to genotyping results in slight changes in the QUAL value for multi-allelic loci where one or more alleles aren't polymorphic.  That's simply due to the way that alternative hypotheses contribute as reference evidence against each true allele.  The effect can be large (new qual = old qual / 2 in one case here).
-- If we want more precision in our estimates we could decide (Eric, should we discuss?) to actually separately do a discovery phase in the genotyping, eliminate all variants not considered polymorphic, and then do a final round of calling to get the exact QUAL value for only those that are segregating.  This would have the value of having the QUAL stay constant as more alleles are genotyped, at the cost of some code complexity increase and runtime.  Might be worth it through
2012-10-22 13:47:56 -04:00
Eric Banks ccae6a5b92 Fixed the RR bug I (knowingly) introduced last week: turns out we can't trust a context size's worth of data from the previous marking. I think Mauricio warned me about this but I forgot. 2012-10-22 11:48:34 -04:00
Mark DePristo 9f2851d769 Updating UnifiedGenotyperGeneralPloidyIntegrationTest following rebasing
-- Created a JIRA ticket https://jira.broadinstitute.org/browse/GSA-623 for Guillermo to look at the differences as the multi-allelic nature of many sites seems to change with the new more protected infrastructure.  This may be due to implementation issues in the pooled caller, problems with my interface, or could be a genuine improvement.
2012-10-21 20:23:11 -04:00
Mark DePristo d21e42608a Updating integration tests for minor changes due to switching to EXACT_INDEPENDENT model by default 2012-10-21 12:43:46 -04:00
Mark DePristo 0fcd358ace Original EXACT model implementation lives, providing another reference (bi-allelic only) EXACT model
-- Potentially a very fast implementation (it's very clean) but restricted to the biallelic case
-- A starting point for future bi-allelic only optimized (logless) or generalized (bi-allelic general ploidy) implementations
-- Added systematic unit tests covering this implementation, and comparing it to others
-- Uncovered a nasty normalization bug in StateTracker that was capping our likelihoods at 0, even after summing up multiple likelihoods, which is just not safe to do and was causing us to lose likelihood in some cases
-- Removed the restriction that a likelihood be <= 0 in StateTracker, and the protection for these cases in GeneralPloidyExactAFCalc which just wasn't right
2012-10-21 12:42:31 -04:00
Mark DePristo eaffb814d3 IndependentExactAFCalc is now the default EXACT model implementation
-- Changed UG / HC to use this one via the StandardCallerArgumentCollection
-- Update the AFCalcFactory.Calculation to have a getDefault() value instead of having a duplicate entry in the enums
2012-10-21 12:42:31 -04:00
Mark DePristo 326f429270 Bugfixes to make new AFCalc system pass integrationtests
-- GeneralPloidyExactAFCalc turns -Infinity values into -Double.MAX_VALUE, so our calculations pass unit tests
-- Bugfix for GeneralPloidyGenotypeLikelihoodsCalculationModel, return a null VC when the only allele we get from our final alleles to use method is the reference base
-- Fix calculation of reference posteriors when P(AF == 0) = 0.0 and P(AF == 0) = X for some meaningful value of X.  Added unit test to ensure this behavior is correct
-- Fix horrible sorting bug in IndependentAllelesDiploidExactAFCalc that applied the theta^N priors in the wrong order.  Add contract to ensure this doesn't ever happen again
-- Bugfix in GLBasedSampleSelector, where VCs without any polymorphic alleles were being sent to the exact model
--
2012-10-21 12:42:31 -04:00
Mark DePristo 695cf83675 More docs and contracts for classes in genotyper.afcalc
-- Future protection of the output of GeneralPloidyExactAFCalc, which produces in some cases bad likelihoods (positive values)
2012-10-21 12:42:31 -04:00
Mark DePristo 99c9031cb4 Merge AFCalcResultTracker into StateTracker, cleanup
-- These two classes were really the same, and now they are actually the same!
-- Cleanuped the interfaces, removed duplicate data
-- Added lots of contracts, some of which found numerical issues with GeneralPloidyExactAFCalc (which have been patched over but not fixed)
-- Moved goodProbability and goodProbabilityVector utilities to MathUtils.  Very useful for contracts!
2012-10-21 12:42:31 -04:00
Guillermo del Angel e9b7324dc1 Merge branch 'master' of ssh://gsa3/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-21 12:38:49 -04:00
Guillermo del Angel 67b9e7319e Fix for integration tests: new criterion in AF exact calculation model to trim alleles based on likelihoods does produce better results and resulting alleles changed in 2 sites at integration tests (and all subsequent sites after this had minor annotation differences due to RankSum dithering) 2012-10-21 12:38:33 -04:00
Eric Banks 0616b98551 Not sure why we were setting the UAC variables instead of the simpleUAC ones when that's what we wanted. 2012-10-21 08:26:26 -04:00
Eric Banks 2c624f76c8 Refactoring the Unified (and Standard) Argument Collections because it was really ugly that the subclass had to do all the cloning for the super class. The clone() method is really not recommended best practice in Java anyways, so I changed it so that we use standard overloaded constructors. Confirmed that the Haplotype Caller --help docs do not include UG-specific arguments. 2012-10-20 20:35:54 -04:00
Ryan Poplin a647f1e076 Refactoring the PairHMM util class to allow for multiple implementations which can be specified by the callers via an enum argument. Adding an optimized PairHMM implementation which caches per-read calculations as well as a logless implementation which drastically reduces the runtime of the HMM while also increasing the precision of the result. In the HaplotypeCaller we now lexicographically sort the haplotypes to take maximal benefit of the haplotype offset optimization which only recalculates the HMM matrices after the first differing base in the haplotype. Many thanks to Mauricio for all the initial groundwork for these optimizations. The change to the one HC integration test is in the fourth decimal of HaplotypeScore. 2012-10-20 16:38:18 -04:00
Eric Banks 4622896312 Oops, killed contracts 2012-10-19 13:04:05 -04:00
Eric Banks f7bd4998fc No need for dummy GLs 2012-10-19 12:13:59 -04:00
Eric Banks deca564aef Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-19 12:01:49 -04:00
Eric Banks d3cf37dfaf Bug fix for general ploidy model: when choosing the most likely alternate allele(s), you need to weight the likelihood mass by the ploidy of the specific alleles (otherwise all alt alleles will have the same probability). This fixes Yossi's issue with pooled validation calling. This may brek integration tests, but I will leave that to GdA to handle. 2012-10-19 12:01:45 -04:00
Eric Banks 27d8d3f51e RR optimization: don't recalculate the entire bitset of variant sites for every read added to the sliding window. Instead, reuse as much of the previously calculated bitset as you can (basically from the window start until the start of the new read minus the context size). In some awfully performing regions this cuts down the runtime in half, although in others this doesn't seem to help much (so clearly something else is going on). Note that I still need to fix one last bug here, but it's almost done. 2012-10-19 11:59:34 -04:00
Ryan Poplin b4e69239dd In order to be considered an informative read in the PerReadAlleleLikelihoodMap it has to be informative compared to all other alleles not just the worst allele. Also, fixing a bug when there is only one allele in the map. 2012-10-18 14:31:15 -04:00
Eric Banks 20ffbcc86e RR optimization: profiling was showing that the BaseCounts class was a major bottleneck because the underlying implementation was a HashMap. Given that the map index was an indexable Enum anyways, it makes a lot more sense to implement as a native array. Knocks 30% off the runtime in bad regions. 2012-10-17 21:44:53 -04:00
Mauricio Carneiro 32ee2c7dff Refactored the compression interface per sample in ReduceReadsa
The CompressionStash is now responsible for keeping track of all intervals that must be kept uncompressed by all samples. In general this is a list generated by a tumor sample that will enforce all normal samples to abide.
  - Updated ReduceReads integration tests
  - Sliding Window is now using the CompressionStash (single sample).

DEV-104 #resolve #time 3m
2012-10-17 16:40:40 -04:00
Mauricio Carneiro b57df6cac8 Bringing CMI changes into the main GATK repo.
Merge remote-tracking branch 'cmi/master'
2012-10-17 15:23:19 -04:00
Mark DePristo fa93681f51 Scalability test for EXACT models 2012-10-17 14:15:11 -04:00
Mark DePristo c9e7a947c2 Improve interface of ExactCallLogger, use it to have a more informative AFCalcPerformanceTest 2012-10-17 14:15:11 -04:00
Eric Banks 33df1afe0e More BaseCounts optimizations for RR. 2012-10-17 00:55:44 -04:00
Eric Banks 19e2b5f0d5 RR optimization: since total count in BaseCounts is requested so often, don't keep computing it from scratch each time. 2012-10-17 00:44:23 -04:00
Mark DePristo 9bcefadd4e Refactor ExactCallLogger into a separate class
-- Update minor integration tests with NanoSchedule due to qual accuracy update
2012-10-16 13:30:09 -04:00
Mark DePristo c74d7061fe Added AFCalcResultUnitTest
-- Ensures that the posteriors remain within reasonable ranges.  Fixed bug where normalization of posteriors = {-1e30, 0.0} => {-100000, 0.0} which isn't good.  Now tests ensure that the normalization process preserves log10 precision where possible
-- Updated MathUtils to make this possible
2012-10-16 08:11:06 -04:00
Mark DePristo 9b0ab4e941 Cleanup IndependentAllelesDiploidExactAFCalc
-- Remove capability to truncate genotype likelihoods -- this wasn't used and isn't really useful after all
-- Added lots of contracts and docs, still more to come.
-- Created a default makeMaxLikelihoods function in ReferenceDiploidExactAFCalc and DiploidExactAFCalc so that multiple subclasses don't just do the default thing
-- Generalized reference bi-allelic model in IndependentAllelesDiploidExactAFCalc so that in principle any bi-allelic reference model can be used.
2012-10-16 08:11:06 -04:00
Mark DePristo d1511e38ad Removing ConstrainedAFCalculationModel; AFCalcPerformanceTest
-- Superceded by IndependentAFCalc
-- Added support to read in an ExactModelLog in AFCalcPerformanceTest and run the independent alleles model on it.
-- A few misc. bug fixes discovered during running the performance test
2012-10-16 08:11:06 -04:00
Ryan Poplin 31be807664 Updating missed integration test. 2012-10-15 22:31:52 -04:00
Ryan Poplin d27ae67bb6 Updating the multi-step UG integration test. 2012-10-15 22:30:01 -04:00
Mauricio Carneiro a234bacb02 Making nContigs parameter hidden in ReduceReads
For now, the het reduction should only be performed for diploids (n=2). We haven't really tested it for other ploidy so it should remain hidden until someone braves it out.
2012-10-15 13:49:08 -04:00
Ryan Poplin 25be94fbb8 Increasing the precision of MathUtils.approximateLog10SumLog10 from 1E-3 to 1E-4. Genotyper integration tests change as a result. Expanding the unit tests of MathUtils.log10sumLog10. 2012-10-15 13:24:32 -04:00
Mark DePristo dcf8af42a8 Finalizing IndependentAllelesDiploidExactAFCalc
-- Updating integration tests, confirming that results for the original EXACT model are as expected given our new more rigorous application of likelihoods, priors, and posteriors
-- Fix basic logic bug in AFCalcResult.isPolymorphic and UnifiedGenotypeEngine, where isNonRef really meant isRef.  Not ideal.  Finally caught by some tests, but good god it almost made it into the code
-- Now takes the Math.abs of the phred-scaled confidence so that we don't see -0.0
-- Massive new suite of unit tests to ensure that bi-allelic and tri-allele events are called properly with all models, and that the IndependentAllelesDiploidExactAFCalc calls events with up to 4 alt alleles correctly.  ID'd some of the bugs below
-- Fix sort order bug in IndependentAllelesDiploidExactAFCalc caught by new unit tests
-- Fix bug in GeneralPloidyExactAFCalc where the AFCalcResult has meaningless values in the likelihoods when no there we no informative GLs.
2012-10-15 08:21:03 -04:00
Mark DePristo 6b639f51f0 Finalizing new exact model and tests
-- New capabilities in IndependentAllelesDiploidExactAFCalc to actually apply correct theta^n.alt.allele prior.
-- Tests that theta^n.alt.alleles is being applied correctly
-- Bugfix: keep in logspace when computing posterior probability in toAFCalcResult in AFCalcResultTracker.java
-- Bugfix: use only the alleles used in genotyping when assessing if an allele is polymorphic in a sample in UnifiedGenotyperEngine
2012-10-15 07:53:57 -04:00
Mark DePristo 2d72265f7d AFCalcUnit test a more appropriate name 2012-10-15 07:53:57 -04:00
Mark DePristo cb857d1640 AFCalcs must be made by factory method now
-- AFCalcFactory is the only way to make AFCalcs now.  There's a nice ordered enum there describing the models and their ploidy and max alt allele restrictions.  The factory makes it easy to create them, and to find models that work for you given your ploidy and max alt alleles.
-- AFCalc no longer has UAC constructor -- only AFCalcFactory does.  Code cleanup throughout
-- Enabling more unit tests, all of which almost pass now (except for IndependentAllelesDiploidExactAFCalc which will be fixed next)
-- It's now possible to run the UG / HC with any of the exact models currently in the system.
-- Code cleanup throughout the system, reorganizing the unit tests in particular
2012-10-15 07:53:56 -04:00
Mark DePristo 6bbe750e03 Continuing work on IndependentAllelesDiploidExactAFCalc
-- Continuing to get IndependentAllelesDiploidExactAFCalc working correctly.  A long way towards the right answer now, but still not there
-- Restored (but not tested) OriginalDiploidExactAFCalc, the clean diploid O(N) version for Ryan
-- MathUtils.normalizeFromLog10 no longer returns -Infinity when kept in log space, enforces the min log10 value there
-- New convenience method in VariantContext that looks up the allele index in the alleles
2012-10-15 07:53:56 -04:00
Mark DePristo 176b74095d Intermediate commit on the path to getting a working IndependentAllelesDiploidExact calculation
-- Still not work, but I know what's wrong
-- Many tests disabled, that need to be reanabled
2012-10-15 07:53:56 -04:00
Mark DePristo 91aeddeb5a Steps on the way to a fully described and semantically meaningful AFCalcResult
-- AFCalcResult now sports a isPolymorphic and getLog10PosteriorAFGt0ForAllele functions that allow you to ask individually whether specific alleles we've tried to genotype are polymorphic given some confidence threshold
-- Lots of contracts for AFCalcResult
-- Slowly killing off AFCalcResultsTracker
-- Fix for the way UG checks for alt alleles being polymorphic, which is now properly conditioned on the alt allele
-- Change in behavior for normalizeFromLog10 in MathUtils: now sets the log10 for 0 values to -10000, instead of -Infinity, since this is really better to ensure that we don't have -Infinity values traveling around the system
-- ExactAFCalculationModelUnitTest now checks for meaningful pNonRef values for each allele, uncovering a bug in the GeneralPloidy (not fixed, related to Eric's summation issue from long ago that was reverted) in that we get different results for diploid and general-ploidy == 2 models for multi-allelics.
2012-10-15 07:53:56 -04:00
Mark DePristo 4f1b1c4228 Intermediate commit II on simplifying AFCalcResult
-- All of the code now uses the AFCalc object, not the not package protected AFCalcResultTracker.  Nearly all unit tests pass (expect for a contract failing one that will be dealt with in subsequent commit), due to -Infinity values from normalizeLog10.
-- Changed the way that UnifiedGenotyper decides if the best model is non-ref.  Previously looked at the MAP AC, but the MAP AC values are no longer provided by AFCalcResult.  This is on purpose, because the MAP isn't a meaningful quantity for the exact model (i.e., everything is going to go to MLE AC in some upcoming commit).  If you want to understand why come talk to me.  Now uses the isPolymorphic function and the EMIT confidence, so that if pNonRef > EMIT then the site is poly, otherwise it's mono.
2012-10-15 07:53:56 -04:00
Mark DePristo 06687bfaf6 Intermediate commit on simplifying AFCalcResult
-- Renamed old class AFCalcResultTracker.  This object is now allocated by the AFCalc itself, since it is heavy-weight and was badly optimized in the UG with a thread-local variable. Now, since there's already a AFCalc thread-local there, we get that optimization for free.
-- Removed the interface to provide the AFCalcResultTracker to getlog10PNonRef.
-- Wrote new, clean but unused AFCalcResult object that will soon replace the tracker as the external interface to the AFCalc model results, leaving the tracker as an internal tracker structure.  This will allow me to (1) finally test things exhaustively, as the contracts on this class are clear (2) finalize the IndependentAllelesDiploidExactAFCalc class as it can work with a meaningfully defined result across each object
2012-10-15 07:53:56 -04:00
Mark DePristo c82aa01e0e Generalize testing infrastructure to allow us to run specific n.samples calculation 2012-10-15 07:53:55 -04:00
Mark DePristo ec935f76f6 Initial implementation and tests for IndependentAllelesDiploidExactAFCalc
-- This model separates each of N alt alleles, combines the genotype likelihoods into the X/X, X/N_i, and N_i/N_i biallelic case, and runs the exact model on each independently to handle the multi-allelic case.  This is very fast, scaling at O(n.alt.alleles x n.samples)
-- Many outstanding TODOs in order to truly pass unit tests
-- Added proper unit tests for the pNonRef calculation, which all of the models pass
2012-10-15 07:53:55 -04:00
Mark DePristo 5a4e2a5fa4 Test code to ensure that pNonRef is being computed correctly for at least 1 genotype, bi and tri allelic 2012-10-15 07:53:55 -04:00
Mark DePristo ee2f12e2ac Simpler naming convention for AlleleFrequencyCalculation => AFCalc 2012-10-15 07:53:55 -04:00
Mark DePristo cf3f9d6ee8 Reorganize and cleanup AFCalculations
-- Now contained in a package called afcalc
-- Extracted standard alone classes from private static classes in ExactAF
-- Most fields are now private, with accessors
-- Overall cleaner organization now
2012-10-15 07:53:55 -04:00
Mark DePristo 13211231c7 Restructure and cleanup ExactAFCalculations
-- Now there's no duplication between exact old and constrained models.  The behavior is controlled by an overloaded abstract function
-- No more static function to access the linear exact model -- you have to create the surrounding class.  Updated code in the system
-- Everything passes unit tests
2012-10-15 07:53:54 -04:00
Mark DePristo 99ad7b2d71 GeneralPloidyExact should use indel max alt alleles 2012-10-15 07:53:54 -04:00
Mark DePristo bf276baca0 Don't try to compute full exact model for > 100 samples 2012-10-15 07:53:54 -04:00
Mark DePristo b924e9ebb4 Add OptimizedDiploidExactAF to PerformanceTesting framework 2012-10-15 07:53:54 -04:00
Mark DePristo f800f3fb88 Optimized diploid exact AF calculation uses maxACs to stop the calculation by maxAC by allele
-- Added unit tests to ensure the approximation isn't so far from our reference implementation (DiploidExactAFCalculation)
2012-10-15 07:53:54 -04:00
Mark DePristo efad215edb Greedy version of function to compute the max achievable AC for each alt allele
-- walks over the genotypes in VC, and computes for each alt allele the maximum AC we need to consider in that alt allele dimension.  Does the calculation based on the PLs in each genotype g, choosing to update the max AC for the alt alleles corresponding to that PL.  Only takes the first lowest PL, if there are multiple genotype configurations with the same PL value.  It takes values in the order of the alt alleles.
2012-10-15 07:53:54 -04:00
Mark DePristo 7666a58773 Function to compute the max achievable AC for each alt allele
-- Additional minor cleanup of ExactAFCalculation
2012-10-15 07:53:53 -04:00
Guillermo del Angel 5971006678 Bug fix when running nondiploid mode in UG with EMIT_ALL_SITES: if site was reference-only, QUAL is produced OK but genotypes were being set to no-call because of unnecessary likelihood normalization. May change integration test md5 which I'll fix later today 2012-10-12 12:45:55 -04:00
Ryan Poplin 2a9ee89c19 Turning on allele trimming for the haplotype caller. 2012-10-10 10:47:26 -04:00
Eric Banks be9fcba546 Don't allow triggering of polyploid consensus creation in regions where there is more than one het, as it just doesn't work properly. We could probably refactor at some point to make it work, but it's not worth doing that now (especially as it should be rare to have multiple proximal known hets in a single sample exome). 2012-10-07 16:32:48 -04:00
Eric Banks 08ac80c080 RR bug: when the last base in the window around the polyploid consensus is filtered (low quality), the filtered consensus is not flushed and subsequent filtered bases (but importantly not contiguous to this one) are just added to this position. In other words, bases were being added to the wrong genomic positions. Fixed. 2012-10-07 10:52:01 -04:00
Eric Banks e8a6460a33 After merging with Yossi's fix I can confirm that the AD is fixed when going through the HC too. Added similar fixes to DP and FS annotations too. 2012-10-05 16:37:42 -04:00
Yossi Farjoun ef90beb827 - forgot to use git rm to delete a file from git. Now that VCF is deleted.
- uncommented a HC test that I missed.
2012-10-05 16:14:51 -04:00
Yossi Farjoun d419a33ed1 * Added an integration test for AD annotation in the Haplotype caller.
* Corrected FS Anotation for UG as for AD.
* HC still does not annotate ReducedReads correctly (for FS nor AD)
2012-10-05 15:23:59 -04:00
Eric Banks f840d9edbd HC test should continue using 3 alt alleles for indels 2012-10-05 02:03:34 -04:00
Eric Banks c66ef17cd0 Add a separate max alt alleles argument for indels that defaults to 2 instead of 3. PLEASE TAKE NOTE. 2012-10-04 13:52:14 -04:00
Eric Banks e13e61673b Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-10-04 10:54:23 -04:00
Eric Banks dfddc4bb0e Protect against cases where there are counts but no quals 2012-10-04 10:52:30 -04:00
Eric Banks 0c46845c92 Refactored the BaseCounts classes so that they are safer and allow for calculations on the most probable base (which is not necessarily the most common base). 2012-10-04 10:37:11 -04:00
Mark DePristo b6e20e083a Copied DiploidExactAFCalc to placeholder OptimizedDiploidExact
-- Will be removed.  Only commiting now to fix public -> private dependency
2012-10-03 20:16:38 -07:00
Mark DePristo 51cafa73e6 Removing public -> private dependency 2012-10-03 20:05:03 -07:00
Mark DePristo f8ef4332de Count the number of evaluations in AFResult; expand unit tests
-- AFResult now tracks the number of evaluations (turns through the model calculation) so we can now compute the scaling of exact model itself as a function of n samples
-- Added unittests for priors (flat and human)
-- Discovered nasty general ploidy bug (enabled with Guillermo_FIXME)
2012-10-03 19:55:11 -07:00
Mark DePristo de941ddbbe Cleanup Exact model, better unit tests
-- Added combinatorial unit tests for both Diploid and General (in diploid-case) for 2 and 3 alleles in all combinations of sample types (i.e., AA, AB, BB and equiv. for tri-allelic).  More assert statements to ensure quality of the result.
-- Added docs (DOCUMENT YOUR CODE!) to AlleleFrequencyCalculationResult, with proper input error handling and contracts.  Made mutation functions all protected
-- No longer need to call reset on your AlleleFrequencyCalculationResult -- it'd done for you in the calculation function.  reset is a protected method now, so it's all cleaner and nicer this way
-- TODO still -- need to add edge-case tests for non-informative samples (0,0,0), for the impact of priors, and I need to add some way to test the result of the pNonRef
2012-10-03 19:55:11 -07:00
Mark DePristo 3e01a76590 Clean up AlleleFrequencyCalculation classes
-- Added a true base class that only does truly common tasks (like manage call logging)
   -- This base class provides the only public method (getLog10PNonRef) and calls into a protected compute function that's abstract
   -- Split ExactAF into superclass ExactAF with common data structures and two subclasses: DiploidExact and GeneralPloidyExact
   -- Added an abstract reduceScope function that manages the simplification of the input VariantContext in the case where there are too many alleles or other constraints require us to only attempt a smaller computation
   -- All unit tests pass
2012-10-03 19:55:11 -07:00
Mark DePristo 1c52db4cdd Add exactCallsLog output file to ExactModel and StandardCallerArgumentCollection
-- This allows us to log all of the information about the exact model call (alleles, priors, PLs, result, and runtime) to a file for later debugging / optimization
2012-10-03 19:55:11 -07:00
Eric Banks 2df5be702c Added an argument to RR to allow polyploid consensus creation (by default it is turned off). This will eventually be replaced by the known SNPs track trigger. 2012-09-28 11:44:25 -04:00
Eric Banks 11a71e0390 RR bug: when determining the most common base at a position, break ties by which base has the highest sum of base qualities. Otherwise, sites with 1 Q2 N and 1 Q30 C are ending up as Ns in the consensus. I think perhaps we don't even care about which base has the most observations - it should just be determined by which has the highest sum of base qualities - but I'm not sure that's what users would expect. 2012-09-24 21:46:14 -04:00
Eric Banks 6a73265a06 RR bug: we were adding synthetic reads from the header only before the variant region, which meant that reads that overlap the variant region but that weren't used for the consensus (because e.g. of low base quality for the spanning base) were never being used at all. Instead, add synthetic reads from before and spanning the variant region. 2012-09-24 13:29:37 -04:00
Eric Banks ef680e1e13 RR fix: push the header removal all the way into the inner loops so that we literally remove a read from the general header only if it was added to the polyploid header. Add comments. 2012-09-24 11:14:18 -04:00
Eric Banks 0187f04a90 Proper fix for a previous RR bug fix: only remove reads from the header if they were actually used in the creation of the polyploid consensus. 2012-09-23 00:39:19 -04:00
Eric Banks 344083051b Reverting the fix to the generalized ploidy exact model since it cannot handle it computationally. Will file this in the JIRA. 2012-09-22 23:07:28 -04:00
Eric Banks ced652b3dd RR bug: we need to call removeFromHeader() for reads that were used in creating a polyploid consensus or else they are reused later in creating synthetic reads. In the worst case, this bug caused the tool to create 2 copies of the reduced read. 2012-09-22 21:50:10 -04:00
Eric Banks 60b93acf7d RR bug: we need to test that the mapping and base quals are >= the MIN values and not just >. This was causing us to drop Q20 bases. 2012-09-22 21:32:29 -04:00
Eric Banks dcd31e654d Turn off RR tests while I debug 2012-09-21 17:26:00 -04:00
Eric Banks 21251c29c2 Off-by-one error in sliding window manifests itself at end of a coverage region dropping the last covered base. 2012-09-21 17:22:30 -04:00
Mauricio Carneiro 2c3dc291c0 Added positive/negative strand to the synthetic reads 2012-09-21 10:00:48 -04:00
Mauricio Carneiro 51cb5098e4 Fixed the alignment issues with reads that started with empty consensus headers 2012-09-21 10:00:47 -04:00
Mauricio Carneiro aa1d2f3a5b Not every consensus is well aligned. Need to check more, but starting position has been fixed. 2012-09-21 10:00:45 -04:00
Mauricio Carneiro 97874b92d1 Program runs, but the consensus reads are all out of place and need more tags 2012-09-21 10:00:44 -04:00
Mauricio Carneiro 3494a52ddc another intermediate commit to update changes from stable 2012-09-21 10:00:43 -04:00
Mauricio Carneiro a89ff7b5dd Intermediate commit to resolve conflicts coming from stable 2012-09-21 10:00:41 -04:00
Eric Banks 1316b579f0 Bad news folks: BQSR scatter-gather was totally busted; you absolutely cannot trust any BQSR table that was a product of SG (for any version of BQSR). I fixed BQSR-gathering, rewrote (and enabled) the unit test, and confirmed that outputs are now identical whether or not SG is used to create the table. 2012-09-20 14:14:34 -04:00
Eric Banks 4b7edc72d1 Fixing edge case bug in the Exact model (both standard and generalized) where we could abort prematurely in the special case of multiple polymorphic alleles and samples with widely different depths of coverage (e.g. exome and low-pass). In these cases it was possible to call the site bi-allelic when in fact it was multi-allelic (but it wouldn't cause it to create a monomorphic call). 2012-09-20 10:59:42 -04:00
Mauricio Carneiro ee31a54a03 Merged bug fix from Stable into Unstable 2012-09-19 16:09:45 -04:00
Mauricio Carneiro 7cf9911924 Fixed ReduceReads bug where variant regions were missing.
This affected variant regions with more than 100 reads and less than 250 reads. Only bams reduced with GATK v2 and 2.1 were affected.
2012-09-19 16:09:08 -04:00
Ryan Poplin 26e35e5ee2 updating BQSR integration tests 2012-09-19 14:10:34 -04:00
Ryan Poplin b99099f05c The BaseRecalibrator and DelocalizedBaseRecalibrator have gotten out of sync. Fixing. 2012-09-19 12:30:26 -04:00
Ryan Poplin 7a7103a757 Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-09-19 10:39:18 -04:00
Guillermo del Angel bebd5c14b8 Update general ploidy md5's due to bad merge of md5's in previous commit, and new shortened interval definition for EMIT_ALL_CONFIDENT_SITES was buggy 2012-09-18 20:12:15 -04:00
Guillermo del Angel ca010160a9 Merge fix 2012-09-14 14:05:21 -04:00
Guillermo del Angel 6b37350bc0 Two hairy bugs in pool caller: a) Site error model wasn't counting errors in insertions correctly - Alleles passed in had padded ref byte, but event base in PileupElement doesn't have it. As a result, mismatch rate was grossly overestimated with insertions and we missed several calls we should have made. Integration test reflects changes. b) Adding a ref GL to the exact model is correct mathematically but AFResult wasn't filled properly. As a result, QUAL was junk in pure ref sites, and in all other sites the last ref GL introduced wasn't properly updating Pr(AF>0). c) Added integration test that covers -out_mode EMIT_ALL_CONFIDENT_SITES. Not fully sure if the math is 100% correct (for both diploid and generalized case) but at least now diploid and non-diploid cases behave similarly. md5 of this new test will fail since it's taking me a long time to run so I'll update from Bamboo output shortly 2012-09-14 13:13:22 -04:00
Eric Banks 0206e09a6a Merge branch 'master' of ssh://gsa2/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-09-12 15:18:27 -04:00
Eric Banks d94d0d15c2 Complete overhaul of previous commits to make it all work with scatter-gather. Now tracks output files correctly and can print to stdout. 2012-09-12 15:15:40 -04:00
Ryan Poplin c9111bb23e Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-09-12 14:46:50 -04:00
Ryan Poplin 849a2b8839 Adding HC integration test for _structural_ insertions and deletions. 2012-09-12 12:23:00 -04:00
Eric Banks 994a4ff387 Track all outputs from BQSR (.table, .csv., and .pdf) as @Output arguments. Updated integration tests because we no longer have command-line options not to generate plots (now just don't provide a pdf) or to keep the intermediate csv (now, just provide a filename on the command-line). This is currently busted because we can't access the original filenames from the Engine's storage/stub system and therefore cannot call out to the Rscript with the executor (which requires filename strings). 2012-09-12 11:24:53 -04:00
Mark DePristo bfbf1686cd Fixed nasty bug with defaulting to diploid no-call genotypes
-- For the pooled caller we were writing diploid no-calls even when other samples were haploid.  Changed maxPloidy function to return a defaultPloidy, rather than 0, in the case where all samples are missing.
-- VCF/BCF Writers now create missing genotypes with the ploidy of other samples, or 2 if none are available at all.
-- Updating integration tests for general ploidy, as previously we wrote ./. even when other calls were 0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/1/1/1/1/1, but now we write ./././././././././././././././././././././././. (ugly but correct)
2012-09-12 07:08:03 -04:00
Ryan Poplin 35d15278af Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-09-11 14:34:17 -04:00
Guillermo del Angel 13831106d5 Fix GSA-535: storing likelihoods in allele map was busted when running HaplotypeCaller, only the last likelihood of a haplotype was being stored, as opposed to the max likelihood of all haplotypes mapping to an allele 2012-09-11 11:01:26 -04:00
Ryan Poplin aa9829b55c fixing typo 2012-09-10 13:36:37 -04:00
Guillermo del Angel 10c720cbba Merge branch 'master' of ssh://gsa4/humgen/gsa-scr1/gsa-engineering/git/unstable 2012-09-10 09:56:47 -04:00
Guillermo del Angel 2d4b00833b Bug fix for logging likelihoods in new read allele map: reads which were filtered out were being excluded from map, but they should be included in annotations 2012-09-09 20:35:45 -04:00
Ryan Poplin 36913706c0 Bug fix in HC GenotypingEngine to ensure that all the merged complex events get properly added to the priority list used by VariantContextUtils when combining multiallelic events. 2012-09-09 13:47:54 -04:00
Ryan Poplin 688fc9fb56 Bug fix in HC GenotypingEngine to ensure that all the merged complex events get properly added to the priority list used by VariantContextUtils when combining multiallelic events. 2012-09-09 10:36:09 -04:00
David Roazen cb84a6473f Downsampling: experimental engine integration
-Off by default; engine fork isolates new code paths from old code paths,
so no integration tests change yet

-Experimental implementation is currently BROKEN due to a serious issue
involving file spans. No one can/should use the experimental features
until I've patched this issue.

-There are temporarily two independent versions of LocusIteratorByState.
Anyone changing one version should port the change to the other (if possible),
and anyone adding unit tests for one version should add the same unit tests
for the other (again, if possible). This situation will hopefully be extremely
temporary, and last only until the experimental implementation is proven.
2012-09-06 15:03:27 -04:00
Yossi Farjoun d6884e705a Revert "fixed a typo in StringText.properties"
This reverts commit b74c1c17e748f75e59d23545084b983e2a8d2fa6.
2012-09-05 15:21:00 -04:00
Yossi Farjoun f4b39a7545 Merge branch 'master' of ssh://gsa4/humgen/gsa-scr1/gsa-engineering/git/unstable
merging trivially after a commit
2012-09-05 14:33:39 -04:00
Yossi Farjoun 6e517df5d9 fixed a typo in StringText.properties 2012-09-05 14:33:08 -04:00
Ryan Poplin 9cc1a9931b Resolving merge conflicts. 2012-09-04 10:47:38 -04:00
Ryan Poplin c9944d81ef Skip array needs to also be used in the updateDataForRead function of the delocalized BQSR. 2012-09-04 10:33:37 -04:00
Mark DePristo 1b0ce511a6 Updating BQSR tests due to my change to reset BQSR calibration data 2012-08-31 19:51:09 -04:00
Mark DePristo 817ece37a2 General infrastructure for ReadTransformers
-- These are like read filters but can be applied either on input, on output, of handled by the walker
-- Previous example of BAQ now uses the general framework
    -- Resulted in massive conceptual cleanup of SAMDataSource and ReadProperties!  Yeah!
-- BQSR now uses this framework.  We can now do BQSR on input, on output, or within a walker
-- PrintReads now handles all read transformers in the walker in map, enabling us to parallelize PrintReads with BAQ and BQSR
-- Currently BQSR is excepting in parallel, which subsequent commit with fix
-- Removed global variable setting in GenomeAnalysisEngine for BAQ, as command line parameters are cleanly handled by ReadTransformer infrastructure
-- In principle ReadFilters are just a special kind of ReadTransformer, but this refactoring is larger than I can do. It's a JIRA entry
-- Many files touched simply due to the refactoring and renaming of classes
2012-08-31 13:42:41 -04:00
Mark DePristo 1200848bbf Part II of GSA-462: Consistent RODBinding access across Ref and Read trackers
-- Deleted ReadMetaDataTracker
-- Added function to ReadShard to give us the span from the left most position of the reads in the shard to the right most, which is needed for the new view
2012-08-30 10:15:10 -04:00
Ryan Poplin 57d997f06f Fixing bug from when FragmentUtils merging function moved over to the soft clipped start instead of the unclipped start 2012-08-30 10:10:43 -04:00