Principle is simple: when coverage is deep enough, any single-base read error will look like a rare k-mer but correct sequence will be supported by many reads to correct sequences will look like common k-mers. So, algorithm has 3 main steps:
1. K-mer graph buildup.
For each read in an active region, a map from k-mers to the number of times they have been seen is built.
2. Building correction map.
All "rare" k-mers that are sparse (by default, seen only once), get mapped to k-mers that are good (by default, seen at least 20 times but this is a CL argument), and that lie within a given Hamming distance (by default, =1). This map can be empty (i.e. k-mers can be uncorrectable).
3. Correction proposal
For each constituent k-mer of each read, if this k-mer is rare and maps to a good k-mer, get differing base positions in k-mer and add these to a list of corrections for each base in each read. Then, correct read at positions where correction proposal is unanimous and non-empty.
The algorithm defaults are chosen to be very stringent and conservative in the correction: we only try to correct singleton k-mers, we only look for good k-mers lying at Hamming distance = 1 from them, and we only correct a base in read if all correction proposals are congruent.
By default, algorithm is disabled but can be enabled in HaplotypeCaller via the -readErrorCorrect CL option. However, at this point it's about 3x-10x more expensive so it needs to be optimized if it's to be used.
Ns are treated as wildcards in the PairHMM so creating haplotypes with Ns gives them artificial advantages over other ones.
This was the cause of at least one FN where there were Ns at a SNP position.
Problem:
The sequence graphs can get very complex and it's not enough just to test that any given read has non-unique kmers.
Reads with variants can have kmers that match unique regions of the reference, and this causes cycles in the final
sequence graph. Ultimately the problem is that kmers of 10/25 may not be large enough for these complex regions.
Solution:
We continue to try kmers of 10/25 but detect whether cycles exist; if so, we do not use them. If (and only if) we
can't get usable graphs from the 10/25 kmers, then we start iterating over larger kmers until we either can generate
a graph without cycles or attempt too many iterations.
-- Reuse infrastructure for RODs for reads to implement general IntervalReferenceOrderedView so that both TraverseReads and TraverseActiveRegions can use the same underlying infrastructure
-- TraverseActiveRegions now provides a meaningful RefMetaDataTracker to ActiveRegionWalker.map
-- Cleanup misc. code as it came up
-- Resolves GSA-808: Write general utility code to do rsID allele matching, hook up to UG and HC
-- Variants will be considered matching if they have the same reference allele and at least 1 common alternative allele. This matching algorithm determines how rsID are added back into the VariantContext we want to annotate, and as well determining the overlap FLAG attribute field.
-- Updated VariantAnnotator and VariantsToVCF to use this class, removing its old stale implementation
-- Added unit tests for this VariantOverlapAnnotator class
-- Removed GATKVCFUtils.rsIDOfFirstRealVariant as this is now better to use VariantOverlapAnnotator
-- Now requires strict allele matching, without any option to just use site annotation.
The previous behavior is to process reads with N CIGAR operators as they are despite that many of the tools do not actually support such operator and results become unpredictible.
Now if the there is some read with the N operator, the engine returns a user exception. The error message indicates what is the problem (including the offending read and mapping position) and give a couple of alternatives that the user can take in order to move forward:
a) ask for those reads to be filtered out (with --filter_reads_with_N_cigar or -filterRNC)
b) keep them in as before (with -U ALLOW_N_CIGAR_READS or -U ALL)
Notice that (b) does not have any effect if (a) is enacted; i.e. filtering overrides ignoring.
Implementation:
* Added filterReadsWithMCigar argument to MalformedReadFilter with the corresponding changes in the code to get it to work.
* Added ALLOW_N_CIGAR_READS unsafe flag so that N cigar containing reads can be processed as they are if that is what the user wants.
* Added ReadFilterTest class commont parent for ReadFilter test cases.
* Refactor ReadGroupBlackListFilterUnitTest to extend ReadFilterTest and push up some functionality to that class.
* Modified MalformedReadFilterUnitTest to extend ReadFilterTest and to test the new filter functionality.
* Added AllowNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALLOW_N_CIGAR_READS flag is used.
* Added UnsafeNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALL flag is used.
* Updated a broken test case in UnifiedGenotyperIntegrationTest resulting from the new behavior.
* Updated EngineFeaturesIntegrationTest testdata to be compliant with new behavior
- Memoized MathUtil's cumulative binomial probability function.
- Reduced the default size of the read name map in reduced reads and handle its resets more efficiently.
-- Created a new annotation DepthPerSampleHC that is by default on in the HaplotypeCaller
-- The depth for the HC is the sum of the informative alleles at this site. It's not perfect (as we cannot differentiate between reads that align over the event but aren't informative vs. those that aren't even close) but it's a pretty good proxy and it matches with the AD field (i.e., sum(AD) = DP).
-- Update MD5s
-- delivers [#48240601]
-- In the case where we have multiple potential alternative alleles *and* we weren't calling all of them (so that n potential values < n called) we could end up trimming the alleles down which would result in the mismatch between the PerReadAlleleLikelihoodMap alleles and the VariantContext trimmed alleles.
-- Fixed by doing two things (1) moving the trimming code after the annotation call and (2) updating AD annotation to check that the alleles in the VariantContext and the PerReadAlleleLikelihoodMap are concordant, which will stop us from degenerating in the future.
-- delivers [#50897077]
-- Ultimately this was caused by overly aggressive merging of CommonSuffixMerger. In the case where you have this graph:
ACT [ref source] -> C
G -> ACT -> C
we would merge into
G -> ACT -> C
which would linearlize into
GACTC
Causing us to add bases to the reference source node that couldn't be recovered. The solution was to ensure that CommonSuffixMerger only operates when all nodes to be merged aren't source nodes themselves.
-- Added a convenient argument to the haplotype caller (captureAssemblyFailureBAM) that will write out the exact reads to a BAM file that went into a failed assembly run (going to a file called AssemblyFailure.BAM). This can be used to rerun the haplotype caller to produce the exact error, which can be hard in regions of deep coverage where the downsampler state determines the exact reads going into assembly and therefore makes running with a sub-interval not reproduce the error
-- Did some misc. cleanup of code while debugging
-- [delivers #50917729]
-- Ultimately this was caused by an underlying bug in the reverting of soft clipped bases in the read clipper. The read clipper would fail to properly set the alignment start for reads that were 100% clipped before reverting, such as 10H2S5H => 10H2M5H. This has been fixed and unit tested.
-- Update 1 ReduceReads MD5, which was due to cases where we were clipping away all of the MATCH part of the read, leaving a cigar like 50H11S and the revert soft clips was failing to properly revert the bases.
-- delivers #50655421
-- The previous implementation attempted to be robust to this, but not all cases were handled properly. Added a helper function updateInde() that bounds up the update to be in the range of the indel array, and cleaned up logic of how the method works. The previous behavior was inconsistent across read fwd/rev stand, so that the indel cigars at the end of read were put at the start of reads if the reads were in the forward strand but not if they were in the reverse strand. Everything is now consistent, as can be seen in the symmetry of the unit tests:
tests.add(new Object[]{"1D3M", false, EventType.BASE_DELETION, new int[]{0,0,0}});
tests.add(new Object[]{"1M1D2M", false, EventType.BASE_DELETION, new int[]{1,0,0}});
tests.add(new Object[]{"2M1D1M", false, EventType.BASE_DELETION, new int[]{0,1,0}});
tests.add(new Object[]{"3M1D", false, EventType.BASE_DELETION, new int[]{0,0,1}});
tests.add(new Object[]{"1D3M", true, EventType.BASE_DELETION, new int[]{1,0,0}});
tests.add(new Object[]{"1M1D2M", true, EventType.BASE_DELETION, new int[]{0,1,0}});
tests.add(new Object[]{"2M1D1M", true, EventType.BASE_DELETION, new int[]{0,0,1}});
tests.add(new Object[]{"3M1D", true, EventType.BASE_DELETION, new int[]{0,0,0}});
tests.add(new Object[]{"4M1I", false, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
tests.add(new Object[]{"3M1I1M", false, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
tests.add(new Object[]{"2M1I2M", false, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});
tests.add(new Object[]{"1M1I3M", false, EventType.BASE_INSERTION, new int[]{1,0,0,0,0}});
tests.add(new Object[]{"1I4M", false, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});
tests.add(new Object[]{"4M1I", true, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});
tests.add(new Object[]{"3M1I1M", true, EventType.BASE_INSERTION, new int[]{0,0,0,0,1}});
tests.add(new Object[]{"2M1I2M", true, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
tests.add(new Object[]{"1M1I3M", true, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
tests.add(new Object[]{"1I4M", true, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});
-- delivers #50445353
-- We now inject the given alleles into the reference haplotype and add them to the graph.
-- Those paths are read off of the graph and then evaluated with the appropriate marginalization for GGA mode.
-- This unifies how Smith-Waterman is performed between discovery and GGA modes.
-- Misc minor cleanup in several places.
The problem ultimately was that ReadUtils.readStartsWithInsertion() ignores leading hard/softclips, but
ReduceReads does not. So I refactored that method to include a boolean argument as to whether or not
clips should be ignored. Also rebased so that return type is no longer a Pair.
Added unit test to cover this situation.
-Throw a UserException if a Locus or ActiveRegion walker is run with -dcov < 200,
since low dcov values can result in problematic downsampling artifacts for locus-based
traversals.
-Read-based traversals continue to have no minimum for -dcov, since dcov for read traversals
controls the number of reads per alignment start position, and even a dcov value of 1 might
be safe/desirable in some circumstances.
-Also reorganize the global downsampling defaults so that they are specified as annotations
to the Walker, LocusWalker, and ActiveRegionWalker classes rather than as constants in the
DownsamplingMethod class.
-The default downsampling settings have not been changed: they are still -dcov 1000
for Locus and ActiveRegion walkers, and -dt NONE for all other walkers.
-- Started by Mark. Finished up by Ryan.
-- GGA mode still respected glm argument for SNP and INDEL models, so that you would silently fail to genotype indels at all if the -glm INDEL wasn't provided, but you'd still emit the sites, so you'd see records in the VCF but all alleles would be no calls.
-- https://www.pivotaltracker.com/story/show/48924339 for more information
-- [resolves#48924339]
Problem
--------
Diagnose Targets is outputting missing intervals to stdout if the argument -missing is not provided
Solution
--------
Make it NOT default to stdout
[Delivers #50386741]
BandedHMM
---------
-- An implementation of a linear runtime, linear memory usage banded logless PairHMM. Thought about 50% faster than current PairHMM, this implementation will be superceded by the GraphHMM when it becomes available. The implementation is being archived for future reference
Useful infrastructure changes
-----------------------------
-- Split PairHMM into a N2MemoryPairHMM that allows smarter implementation to not allocate the double[][] matrices if they don't want, which was previously occurring in the base class PairHMM
-- Added functionality (controlled by private static boolean) to write out likelihood call information to a file from inside of LikelihoodCalculationEngine for using in unit or performance testing. Added example of 100kb of data to private/testdata. Can be easily read in with the PairHMMTestData class.
-- PairHMM now tracks the number of possible cell evaluations, and the LoglessCachingPairHMM updates the nCellsEvaluated so we can see how many cells are saved by the caching calculation.
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion. This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element. New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set. Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
-- [Delivers #49876703]
-- Add integration test and test file
-- Update SymbolicAlleles combine variant tests, which was turning unfiltered records into PASS!
Bug fixes and missing interval functionality for Diagnose Targets
While the code seems fine, the complex parts of it are untested. This is probably fine for now, but private code can have a tendency to creep into the codebase once accepted. I would have preferred that unit test OR a big comment stating that the code is untested (and thus broken by Mark's rule).
It is with these cavets that I accept the pull request.
Problem
------
Diagnose Targets identifies holes in the coverage of a targetted experiment, but it only reports them doesn't list the actual missing loci
Solution
------
This commit implements an optional intervals file output listing the exact loci that did not pass filters
Itemized changes
--------------
* Cache callable statuses (to avoid recalculation)
* Add functionality to output missing intervals
* Implement new tool to qualify the missing intervals (QualifyMissingIntervals) by gc content, size, type of missing coverage and origin (coding sequence, intron, ...)
Problem
-------
When the interval had no reads, it was being sent to the VCF before the intervals that just got processed, therefore violating the sort order of the VCF.
Solution
--------
Use a linked hash map, and make the insertion and removal all happen in one place regardless of having reads or not. Since the input is ordered, the output has to be ordered as well.
Itemized changes
--------------
* Clean up code duplication in LocusStratification and SampleStratification
* Add number of uncovered sites and number of low covered sites to the VCF output.
* Add new VCF format fields
* Fix outputting multiple status when threshold is 0 (ratio must be GREATER THAN not equal to the threshold to get reported)
[fixes#48780333]
[fixes#48787311]
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
-- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
-- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
* A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
right thing for indels at the edges of the alignments.
* Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
* Lots of systematic testing added for this implementation.
* NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
* bitset could legitimately be in an unfinished state but we were trying to access it without finalizing.
* added --cancer_mode argument per Mark's suggestion to force the user to explicitly enable multi-sample mode.
* tests were easiest to implement as integration tests (this was a really complicated case).
Problem
-------
The DeBruijn assembler was too slow. The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp). This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.
Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers. The algorithm operates as follows:
identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
for each base in the sequence from the starting vertex kmer:
look at the existing outgoing nodes of current vertex V. If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
If no matching next vertex exists, find a unique vertex with kmer K. If one exists, merge the sequence into this vertex, and continue
If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue
This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size. This allows us to assemble well with even very short kmers.
This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:
-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples. This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor. This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization. This change is essential for us to get good variants from our paths when the kmer size is small. It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation. Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary. This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler
Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations. This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate. Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
* This is emerging now because BWA-MEM produces lots of reads that are not primary alignments
* The ConstrainedMateFixingManager class used by IndelRealigner was mis-adjusting SAM flags because it
was getting confused by these secondary alignments
* Added unit test to cover this case
Only try to clip adaptors when both reads of the pair are on opposite strands
-- Read pairs that have unusual alignments, such as two reads both oriented like:
<-----
<-----
where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs. This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
Output didn't "mix-up" the genotypes, it outputed the same HET vs HET (e.g.) 3 times rather than the combinations of HET vs {HET, HOM, HOM_REF}, etc.
This was only a problem in the text, _not_ the actual numbers, which were outputted correctly.
- Updated MD5's after looking at diffs to verify that the change is what I expected.
-Changes in Java 7 related to comparators / sorting produce a large number
of innocuous differences in our test output. Updating expectations now
that we've moved to using Java 7 internally.
-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
intermittent failures.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly. Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.
The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly. Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).
Also:
1. counts are now maintained as ints whenever possible. Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
-- Added check to see if read spans beyond reference window MINUS padding and event length. This guarantees that read will always be contained in haplotype.
-- Changed md5's that happen when long reads from old 454 data have their likelihoods changed because of the extra base clipping.
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts. Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly. Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
Use case:
The default AF priors used (infinite sites model, neutral variation) is appropriate in the case where the reference allele is ancestral, and the called allele is a derived allele.
Most of the times this is true but in several population studies and in ancient DNA analyses this might introduce reference biases, and in some other cases it's hard to ascertain what the ancestral allele is (normally requiring to look up homologous chimp sequence).
Specifying no prior is one solution, but this may introduce a lot of artifactual het calls in shallower coverage regions.
With this option, users can specify what the prior for each AC should be according to their needs, subject to the restrictions documented in the code and in GATK docs.
-- Updated ancient DNA single sample calling script with filtering options and other cleanups.
-- Added integration test. Removed old -noPrior syntax.
-Do not throw an exception when parsing snpEff output files
generated by not-officially-supported versions of snpEff,
PROVIDED that snpEff was run with -o gatk
-Requested by the snpEff author
-Relevant integration tests updated/expanded
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.
Added lots of unit tests for new functionality.
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences. If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference. Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions. Then we get the
best of both worlds. As a note, coverage refers to just the individual base counts and not the entire pileup.
2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.
3. Each consensus keeps track of its own number of softclipped bases. There was no reason that that number
should be shared between them.
4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now. Don't lose that
information. Maybe we'll decide to change this in the future, but for now we are conservative.
5. Also implemented various small performance optimizations based on profiling.
Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
Calling everything statistics was very confusing. Diagnose Targets stratifies the data three ways: Interval, Sample and Locus. Each stratification then has it's own set of metrics (plugin system) to calculate -- LocusMetric, SampleMetric, IntervalMetric.
Metrics are generalized by the Metric interface. (for generic access)
Stratifications are generalized by the AbstractStratification abstract class. (to aggressively limit code duplication)
-- In case there are no informative bases in a pileup but pileup isn't empty (like when all bases have Q < min base quality) the GLs were still computed (but were all zeros) and fed to the exact model. Now, mimic case of diploid Gl computation where GLs are only added if # good bases > 0
-- I believe general case where only non-informative GLs are fed into AF calc model is broken and yields bogus QUAL, will investigate separately.
* Make most classes final, others package local
* Move to diagnostics.diagnosetargets package
* Aggregate statistics and walker classes on the same package for simplified visibility.
* Make status list a LinkedList instead of a HashSet
A plugin enabled implementation of DiagnoseTargets
Summarized Changes:
-------------------
* move argument collection into Thresholder object
* make thresholder object private member of all statistics classes
* rework the logic of the mate pairing thresholds
* update unit and integration tests to reflect the new behavior
* Implements Locus Statistic plugins
* Extend Locus Statistic plugins to determine sample status
* Export all common plugin functionality into utility class
* Update tests accordingly
[fixes#48465557]
* remove interval statistic low_median_coverage -- it is already captured by low coverage and coverage gaps.
* add gatkdocs to all the parameters
* clean up the logic on callable status a bit (still need to be re-worked into a plugin system)
* update integration tests
This is not really feasible with the current mandate of this walker. We would have to traverse by reference and that would make the runtime much higher, and we are not really interested in the status 99% of the time anyway. There are other walkers that can report this, and just this, status more cheaply.
[fixes#48442663]
Problem
-------
Diagnose targets is outputting both LOW_MEDIAN_COVERAGE and NO_READS when no reads are covering the interval
Solution
--------
Only allow low median coverage check if there are reads
[fixes#48442675]
Problem
-------
Diagnose targets was skipping intervals when they were not covered by any reads.
Solution
--------
Rework the interval iteration logic to output all intervals as they're skipped over by the traversal, as well as adding a loop on traversal done to finish outputting intervals past the coverage of teh BAM file.
Summarized Changes
------------------
* Outputs all intervals it iterates over, even if uncovered
* Outputs leftover intervals in the end of the traversal
* Updated integration tests
[fixes#47813825]
-- The problem is that the common suffix splitter could eliminate the reference source vertex when there's an incoming node that contains all of the reference source vertex bases and then some additional prefix bases. In this case we'd eliminate the reference source vertex. Fixed by checking for this condition and aborting the simplification
-- Update MD5s, including minor improvements
-- Reduce the min read length to 10 bp in the filterNonPassingReads in the HC. Now that we filter out reads before genotyping, we have to be more tolerant of shorter, but informative, reads, in order to avoid a few FNs in shallow read data
-- Reduce the min usable base qual to 8 by default in the HC. In regions with low coverage we sometimes throw out our only informative kmers because we required a contiguous run of bases with >= 16 QUAL. This is a bit too aggressive of a requirement, so I lowered it to 8.
-- Together with the previous commit this results in a significant improvement in the sensitivity and specificity of the caller
NA12878 MEM chr20:10-11
Name VariantType TRUE_POSITIVE FALSE_POSITIVE FALSE_NEGATIVE TRUE_NEGATIVE CALLED_NOT_IN_DB_AT_ALL
branch SNPS 1216 0 2 194 0
branch INDELS 312 2 13 71 7
master SNPS 1214 0 4 194 1
master INDELS 309 2 16 71 10
-- Update MD5s in the integration tests to reflect these two new changes
* Moved redundant code out of UGEngine
* Added overloaded methods that assume p=0.5 for speed efficiency
* Added unit test for the binomialCumulativeProbability method
The Problem:
Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
regions in an exome) causes RR (with default settings) to consider it a variant region. This
seriously hurts compression performance.
The Solution:
1. We now use a probabilistic model for determining whether we can create a consensus (in other
words, whether we can error correct a site) instead of the old ratio threshold. We calculate
the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
2. We also allow het compression globally, not just at known sites. So if we cannot create a
consensus at a given site then we try to perform het compression; and if we cannot perform het
compression that we just don't reduce the variant region. This way very wonky regions stay
uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
locus get het compressed.
Details:
1. -minvar is now deprecated in favor of -min_pvalue.
2. Added integration test for bad pvalue input.
3. -known argument still works to force het compression only at known sites; if it's not included
then we allow het compression anywhere. Added unit tests for this.
4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
Before finalizing het compression, we now check for insertions or other variant regions (usually due
to multi-allelics) which can render a region incompressible (and we back out if we find one). We
were checking for excessive softclips before, but now we add these tests too.
5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
out instead of backing out all of them.
6. We no longer create a mini read at the stop of the variant window for het compression. Instead, we
allow it to be part of the next global consensus.
7. The coverage test is no longer run systematically on all integration tests because the quals test
supercedes it. The systematic quals test is now much stricter in order to catch bugs and edge cases
(very useful!).
8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
for a consensus was affected by good and bad bases/reads).
9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
with insertions from a header.
Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples. This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes. The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects. After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model. It's worse than the current version in both single and multiple samples:
1000G EUR samples:
10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes
Name VariantType TRUE_POSITIVE FALSE_POSITIVE FALSE_NEGATIVE TRUE_NEGATIVE CALLED_NOT_IN_DB_AT_ALL
per_sample SNPS 50 0 5 8 1
per_sample INDELS 6 0 7 2 1
pooled SNPS 49 0 6 8 1
pooled INDELS 5 0 8 2 1
100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes
Name VariantType TRUE_POSITIVE FALSE_POSITIVE FALSE_NEGATIVE TRUE_NEGATIVE CALLED_NOT_IN_DB_AT_ALL
per_sample SNPS 144 0 22 28 1
per_sample INDELS 28 1 16 9 11
pooled SNPS 143 0 23 28 1
pooled INDELS 27 1 17 9 11
java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug
haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds
java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug
haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
-- It's useful to know which sites have been used in the training of the model. The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.
Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
-- The PairHMM no longer allows us to create haplotypes with 0 bases. The UG indel caller used to create such haplotypes. Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes#47523579]
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.
Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.
Summarized Changes
------------------
* Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
* Updated related MD5's
Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble. The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls. I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.
-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all
General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly. Depreciated old call to inline constants. This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default. Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
-- Ensure that BQSR works properly for an Ion Torrent BAM. (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
-- old algorithm was O(kmerSize * readLen) for each read. New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph. Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
-- The previous creation algorithm used the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to the graph
add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
update edge count by 1 if kmer1 -> kmer2 already existed in the graph
-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)). This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap
for each kmer pair 1 and 2 in the hash counter
add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
update edge count by count from map if kmer1 -> kmer2 already existed in the graph
-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:
X -> A -> B
Y -> A -> B
So that the incoming vertices of B all have the same sequence. This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph. Fixed and unit tested
-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging. So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph. Equals here means that all vertices have equivalents in both graphs, as do all edges. If the two graphs are equal we stop simplifying. It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
-- HC now throws a UserException if this model is provided. Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5]. The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding. Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i. Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models. Allowing cycles can be re-enabled with an HC command line switch.
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes. This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype. All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension). Radically speeds up calculations when using large active region extensions. The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible. The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter. The previous error corrector was just broken (conceptually) and was disabled by default in the engine. Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so. This would introduce large deletion events at the start / end of the assemblies. Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go. Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains. The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator. For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed. Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well. Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp. In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M. The new code supports this. UnitTested and documented as well. LDMerger handles case where merging two alleles results in a no-op event. Merging CA/C + A/AA -> CAA/CAA -> no op. Handles this case by removing the two events. UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right). Here's the new algorithm:
* Compute probability that two variants are in phase with each other and that no
* compound hets exist in the population.
*
* Implemented as a likelihood ratio test of the hypothesis:
*
* x11 and x22 are the only haplotypes in the populations
*
* vs.
*
* all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
*
* Now, since we have to have both variants in the population, we exclude the x11 & x11 state. So the
* p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
*
* Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
*
* - P(x11 & x12 & x21) -- we have hom-ref and both hets
* - P(x22 & x12 & x21) -- we have hom-alt and both hets
* - P(x22 & x12) -- one haplotype is 22 and the other is het 12
* - P(x22 & x21) -- one haplotype is 22 and the other is het 21
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)
Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.
Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)
[fixes#47399227]
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
* This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
* Added integration test to confirm failure with User Error
* Removed illegal header line in KB test VCF that was causing related tests to fail.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm. Created unit test that reproduced the issue, and then fixed the underlying issue.
-- Only try to genotype PASSing records in the alleles file
-- Don't attempt to genotype multiple records with the same start location. Instead take the first record and throw a warning message.
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
* Moved to protected for packaging purposes.
* Cleaned up and removed debugging output.
* Fixed logic for epsilons so that we really only test significant differences between BAMs.
* Other small fixes (e.g. don't include low quality reduced reads in overall qual).
* Most RR integration tests now automatically run the quals test on output.
* A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".
How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.
Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter
Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31
Issue Tracker:
--------------
[fixes 47100885]
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
# Initial conditions were not being set properly
# Emission probabilities in the last row were not adding up to 1
The following commit fixes both by
# averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
# discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)
Summarized changes:
* Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
* Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
* Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
* Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
* Rename metric lengths to read and haplotype lengths for clarity
* Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
* Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
* Remove unnecessary parameters from updateCell()
* Fix the expected probabilities coming from the exact model in PairHMMUnitTest
* Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
* Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.
[fix 47164949]
that are tested), resulting in slightly different numbers of calls to the RNG, and ultimately
different sets of selected variants.
This commits updates the md5 values for the validation site selector integration test to reflect
these new random subsets of variants that are selected.
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
Currently, the multi-allelic test is covering the following case:
Eval A T,C
Comp A C
reciprocate this so that the reverse can be covered.
Eval A C
Comp A T,C
And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.
This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:
Eval: A G,T 0/0 2/0 2/2 1/1
Comp: A C,T 0/0 1/0 0/0 0/0
Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:
Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)
Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.
Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
- dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
- vectorSum
- array shuffle, random subset
- countOccurances (general forms, the char form is used in the codebase)
- getNMaxElements
- array permutation
- sorted array permutation
- compare floats
- sum() (for integer arrays and lists).
Final keyword was extensively added to MathUtils.
The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).
The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.
In addition, more extensive tests were added for
- logBinomialCoefficient (Newton's identity should always hold)
- logFactorial
- log10sumlog10 and its approximation
All unit tests pass
-- These new algorithms are more powerful than the restricted diamond merging algoriths, in that they can merge nodes with multiple incoming and outgoing edges. Together the splitter + merger algorithms will correctly merge many more cases than the original headless and tailless diamond merger.
-- Refactored haplotype caller infrastructure into graphs package, code cleanup
-- Cleanup new merging / splitting algorithms, with proper docs and unit tests
-- Fix bug in zipping of linear chains. Because the multiplicity can be 0, protect ourselves with a max function call
-- Fix BaseEdge.max unit test
-- Add docs and some more unit tests
-- Move error correct from DeBruijnGraph to DeBruijnAssembler
-- Replaced uses of System.out.println with logger.info
-- Don't make multiplicity == 0 nodes look like they should be pruned
-- Fix toString of Path
-- Previous algorithms were applying pruneGraph inappropriately on the raw sequence graph (where each vertex is a single base). This results in overpruning of the graph, as prunegraph really relied on the zipping of linear chains (and the sharing of weight this provides) to avoid over-pruning the graph. Probably we should think hard about this. This commit fixes this logic, so we zip the graph between pruning
-- In this process ID's a fundamental problem with how we were trimming away vertices that occur on a path from the reference source to sink. In fact, we were leaving in any vertex that happened to be accessible from source, any vertices in cycles, and any vertex that wasn't the absolute end of a chain going to a sink. The new algorithm fixes all of this, using a BaseGraphIterator that's a general approach to walking the base graph. Other routines that use the same traversal idiom refactored to use this iterator. Added unit tests for all of these capabilities.
-- Created new BaseGraphIterator, which abstracts common access patterns to graph, and use this where appropriate
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users. The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not. That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves. There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second. For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads. All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event. In this case our annotations will all fall apart, returning their default values. Added a JIRA to address this (should be discussed in group meeting)
-- Though not intended, it was possible to create reference graphs with cycles in the case where you started the graph with a homopolymer of length > the kmer. The previous test would fail to catch this case. Now its not possible
-- Lots of code cleanup and refactoring in this push. Split the monolithic createGraphFromSequences into simple calls to addReferenceKmersToGraph and addReadKmersToGraph which themselves share lower level functions like addKmerPairFromSeqToGraph.
-- Fix performance problem with reduced reads and the HC, where we were calling add kmer pair for each count in the reduced read, instead of just calling it once with a multiplicity of count.
-- Refactor addKmersToGraph() to use things like addOrUpdateEdge, now the code is very clear
-- The previous version would generate graphs that had no reference bases at all in the situation where the reference haplotype was < the longer read length, which would cause the kmer size to exceed the reference haplotype length. Now return immediately with a null graph when this occurs as opposed to continuing and eventually causing an error
-- The error correction algorithm can break the reference graph in some cases by error correcting us into a bad state for the reference sequence. Because we know that the error correction algorithm isn't ideal, and worse, doesn't actually seem to improve the calling itself on chr20, I've simply disabled error correction by default and allowed it to be turned on with a hidden argument.
-- In the process I've changed a bit the assembly interface, moving some common arguments us into the LocalAssemblyEngine, which are turned on/off via setter methods.
-- Went through the updated arguments in the HC to be @Hidden and @Advanced as appropriate
-- Don't write out an errorcorrected graph when debugging and error correction isn't enabled
* It is now cleaner and easier to test; added tests for newly implemented methods.
* Many fixes to the logic to make it work
* The most important change was that after triggering het compression we actually need to back it out if it
creates reads that incorporated too many softclips at any one position (because they get unclipped).
* There was also an off-by-one error in the general code that only manifested itself with het compression.
* Removed support for creating a het consensus around deletions (which was broken anyways).
* Mauricio gave his blessing for this.
* Het compression now works only against known sites (with -known argument).
* The user can pass in one or more VCFs with known SNPs (other variants are ignored).
* If no known SNPs are provided het compression will automatically be disabled.
* Added SAM tag to stranded (i.e. het compressed) reduced reads to distinguish their
strandedness from normal reduced reads.
* GATKSAMRecord now checks for this tag when determining whether or not the read is stranded.
* This allows us to update the FisherStrand annotation to count het compressed reduced reads
towards the FS calculation.
* [It would have been nice to mark the normal reads as unstranded but then we wouldn't be
backwards compatible.]
* Updated integration tests accordingly with new het compressed bams (both for RR and UG).
* In the process of fixing the FS annotation I noticed that SpanningDeletions wasn't handling
RR properly, so I fixed it too.
* Also, the test in the UG engine for determining whether there are too many overlapping
deletions is updated to handle RR.
* I added a special hook in the RR integration tests to additionally run the systematic
coverage checking tool I wrote earlier.
* AssessReducedCoverage is now run against all RR integration tests to ensure coverage is
not lost from original to reduced bam.
* This helped uncover a huge bug in the MultiSampleCompressor where it would drop reads
from all but 1 sample (now fixed).
* AssessReducedCoverage moved from private to protected for packaging reasons.
* #resolve GSA-639
At this point, this commit encompasses most of what is needed for het compression to go live.
There are still a few TODO items that I want to get in before the 2.5 release, but I will save
those for a separate branch because as it is I feel bad for the person who needs to review all
these changes (sorry, Mauricio).
-- Generalizes previous node merging and splitting approaches. Can split common prefixes and suffices among nodes, build a subgraph representing this new structure, and incorporate it into the original graph. Introduces the concept of edges with 0 multiplicity (for purely structural reasons) as well as vertices with no sequence (again, for structural reasons). Fully UnitTested. These new algorithms can now really simplify diamond configurations as well as ones sources and sinks that arrive / depart linearly at a common single root node.
-- This new suite of algorithms is fully integrated into the HC, replacing previous approaches
-- SeqGraph transformations are applied iteratively (zipping, splitting, merging) until no operations can be performed on the graph. This further simplifies the graphs, as splitting nodes may enable other merging / zip operations to go.
-- Previously we tried to include lots of these low mapping quality reads in the assembly and calling, but we effectively were just filtering them out anyway while generating an enormous amount of computational expense to handle them, as well as much larger memory requirements. The new version simply uses a read filter to remove them upfront. This causes no major problems -- at least, none that don't have other underlying causes -- compared to 10-11mb of the KB
-- Update MD5s to reflect changes due to no longer including mmq < 20 by default
-- Simply don't do more than MAX_CORRECTION_OPS_TO_ALLOW = 5000 * 1000 operations to correct a graph. If the number of ops would exceed this threshold, the original graph is used.
-- Overall the algorithm is just extremely computational expensive, and actually doesn't implement the correct correction. So we live with this limitations while we continue to explore better algorithms
-- Updating MD5s to reflect changes in assembly algorithms
-- Previous version was just incorrectly accumulating information about nodes that were completely eliminated by the common suffix, so we were dropping some reference connections between vertices. Fixed. In the process simplified the entire algorithm and codebase
-- Resolves https://jira.broadinstitute.org/browse/GSA-884
-- DeBruijnAssemblerUnitTest and AlignmentUtilsUnitTest were both in DEBUG = true mode (bad!)
-- Remove the maxHaplotypesToConsider feature of HC as it's not useful
-- Don't clone sequence upon construction or in getSequence(), as these are frequently called, memory allocating routines and cloning will be prohibitively expensive
-- UnitTest for isRootOfDiamond along with key bugfix detected while testing
-- Fix up the equals methods in BaseEdge. Now called hasSameSourceAndTarget and seqEquals. A much more meaningful naming
-- Generalize graphEquals to use seqEquals, so it works equally well with Debruijn and SeqGraphs
-- Add BaseVertex method called seqEquals that returns true if two BaseVertex objects have the same sequence
-- Reorganize SeqGraph mergeNodes into a single master function that does zipping, branch merging, and zipping again, rather than having this done in the DeBruijnAssembler itself
-- Massive expansion of the SeqGraph unit tests. We now really test out the zipping and branch merging code.
-- Near final cleanup of the current codebase
-- DeBruijnVertex cleanup and optimizations. Since kmer graphs don't allow sequences longer than the kmer size, the suffix is always a byte, not a byte[]. Optimize the code to make use of this constraint
-- Only minor differences, with improvement in allele discovery where the sites differ. The test of an insertion at the start of the MT no longer calls a 1 bp indel at position 0 in the genome
-- Split Path from inner class of KBestPaths
-- Use google MinMaxPriorityQueue to track best k paths, a more efficient implementation
-- Path now properly typed throughout the code
-- Path maintains a on-demand hashset of BaseEdges so that path.containsEdge is fast
-- DeBruijnAssembler functions are no longer static. This isn't the right way to unit test your code
-- An a HaplotypeCaller command line option to use low-quality bases in the assembly
-- Refactored DeBruijnGraph and associated libraries into base class
-- Refactored out BaseEdge, BaseGraph, and BaseVertex from DeBruijn equivalents. These DeBruijn versions now inherit from these base classes. Added some reasonable unit tests for the base and Debruijn edges and vertex classes.
-- SeqVertex: allows multiple vertices in the sequence graph to have the same sequence and yet be distinct
-- Further refactoring of DeBruijnAssembler in preparation for the full SeqGraph <-> DeBruijnGraph split
-- Moved generic methods in DeBruijnAssembler into BaseGraph
-- Created a simple SeqGraph that contains SeqVertex objects
-- Simple chain zipper for SeqGraph that reproduces the results for the mergeNode function on DeBruijnGraphs
-- A working version of the diamond remodeling algorithm in SeqGraph that converts graphs that look like A -> Xa, A -> Ya, Xa -> Z, Ya -> Z into A -> X -> a, A -Y -> a, a -> Z
-- Allow SeqGraph zip merging of vertices where the in vertex has multiple incoming edges or the out vertex has multiple outgoing edges
-- Fix all unit tests so they work with the new SeqGraph system. All tests passed without modification.
-- Debugging makes it easier to tell which kmer graph contributes to a haplotype
-- Better docs and unit tests for BaseVertex, SeqVertex, BaseEdge, and KMerErrorCorrector
-- Remove unnecessary printing of cleaning info in BaseGraph
-- Turn off kmer graph creation in DeBruijnAssembler.java
-- Only print SeqGraphs when debugGraphTransformations is set to true
-- Rename DeBruijnGraphUnitTest to SeqGraphUnitTest. Now builds DeBruijnGraph, converts to SeqGraph, uses SeqGraph.mergenodes and tests for equality.
-- Update KBestPathsUnitTest to use SeqGraphs not DebruijnGraphs
-- DebruijnVertex now longer takes kmer argument -- it's implicit that the kmer length is the sequence.length now
-- Error correction algorithm for the assembler. Only error correct reads to others that are exactly 1 mismatch away
-- The assembler logic is now: build initial graph, error correct*, merge nodes*, prune dead nodes, merge again, make haplotypes. The * elements are new
-- Refactored the printing routines a bit so it's easy to write a single graph to disk for testing.
-- Easier way to control the testing of the graph assembly algorithms
-- Move graph printing function to DeBruijnAssemblyGraph from DeBruijnAssembler
-- Simple protected parsing function for making DeBruijnAssemblyGraph
-- Change the default prune factor for the graph to 1, from 2
-- debugging graph transformations are controllable from command line
-- Previous version would not trim down soft clip bases that extend beyond the active region, causing the assembly graph to go haywire. The new code explicitly reverts soft clips to M bases with the ever useful ReadClipper, and then trims. Note this isn't a 100% fix for the issue, as it's possible that the newly unclipped bases might in reality extend beyond the active region, should their true alignment include a deletion in the reference. Needs to be fixed. JIRA added
-- See https://jira.broadinstitute.org/browse/GSA-822
-- #resolve #fix GSA-822
-- Added a -dontGenotype mode for testing assembly efficiency
-- However, it looks like this has a very negative impact on the quality of the results, so the code should be deleted
-- Annotations were being called on VariantContext that might needed to be trimmed. Simply inverted the order of operations so trimming occurs before the annotations are added.
-- Minor cleanup of call to PairHMM in LikelihoodCalculationEngine
In particular, someone produced a tandem repeat site with 57 alt alleles (sic) which made the caller blow up.
Inelegant fix is to detect if # of alleles is > our max cached capacity, and if so, emit an informative warning and skip site.
-- Added unit test to UG engine to cover this case.
-- Commit to posterity private scala script currently used for 1000G indel consensus (still very much subject to changes).
GSA-878 #resolve
--Mostly doc block tweaks
--Added @DocumentedGATKFeature to some walkers that were undocumented because they were ending up in "uncategorized". Very important for GSA: if a walker is in public or protected, it HAS to be properly tagged-in. If it's not ready for the public, it should be in private.
Name cache was filling up with names of all reads in entire file, which for large file eventually
consumes all of memory. Only keep read name cache for the reads that are together in one variant
region, so that a pair of reads within the same variant region will still be joined via read name.
Otherwise the ability to connect a read to its mate is lost.
Update MD5s in integration test to reflect altered output.
Add new integration test that confirms that pair within variant region is joined by read name.
-- This is a temporarily fix / hack to deal with the very high QD values that are generated by the haplotype caller when nearby events occur within reads. In that case, the QUAL field can be many fold higher than normal, and results in an inflated QD value. This hack projects such high QD values back into the good range (as these are good variants in general) so they aren't filtered away by VQSR.
-- The long-term solution to this problem is to move the HaplotypeCaller to the full bubble calling algorithm
-- Update md5s
- Moved AverageAltAlleleLength, MappingQualityZeroFraction and TechnologyComposition to Private
- VariantType, TransmissionDisequilibriumTest, MVLikelihoodRatio and GCContent are no longer Experimental
- AlleleBalanceBySample, HardyWeinberg and HomopolymerRun are Experimental and available to users with a big bold caveat message
- Refactored getMeanAltAlleleLength() out of AverageAltAlleleLength into GATKVariantContextUtils in order to make QualByDepth independent of where AverageAltAlleleLength lives
- Unrelated change, bundled in for convenience: made HC argument includeUnmappedreads @Hidden
- Removed unnecessary check in AverageAltAlleleLength
ALL GATK DEVELOPERS PLEASE READ NOTES BELOW:
I have updated the @Output annotation to behave differently and to include a 'defaultToStdout' tag.
* The 'defaultToStdout' tags lets walkers specify whether to default to stdout if -o is not provided.
* The logic for @Output is now:
* if required==true then -o MUST be provided or a User Error is generated.
* if required==false and defaultToStdout==true then the output is assigned to stdout if no -o is provided.
* this is the default behavior (i.e. @Output with no modifiers).
* if required==false and defaultToStdout==false then the output object is null.
* use this combination for truly optional outputs (e.g. the -badSites option in AssessNA12878).
* I have updated walkers so that previous behavior has been maintained (as best I could).
* In general, all @Outputs with default long/short names have required=false.
* Walkers with nWayOut options must have required==false and defaultToStdout==false (I added checks for this)
* I added unit tests for @Output changes with David's help (thanks!).
* #resolve GSA-837
-- Strandless GATK reads are ones where they don't really have a meaningful strand value, such as Reduced Reads or fragment merged reads. Added GATKSAMRecord support for such reads, along with unit tests
-- The merge overlapping fragments code in FragmentUtils now produces strandless merged fragments
-- FisherStrand annotation generalized to treat strandless as providing 1/2 the representative count for both strands. This means that that merged fragments are properly handled from the HC, so we don't hallucinate fake strand-bias just because we managed to merge a lot of reads together.
-- The previous getReducedCount() wouldn't work if a read was made into a reduced read after getReducedCount() had been called. Added new GATKSAMRecord method setReducedCounts() that does the right thing. Updated SlidingWindow and SyntheticRead to explicitly call this function, and so the readTag parameter is now gone.
-- Update MD5s for change to FS calculation. Differences are just minor updates to the FS
GATK-73 updated docs for bqsr args
GATK-9 differentiate CountRODs from CountRODsByRef
GATK-76 generate GATKDoc for CatVariants
GATK-4 made resource arg required
GATK-10 added -o, some docs to CountMales; some docs to CountLoci
GATK-11 fixed by MC's -o change; straightened out the docs.
GATK-77 fixed references to wiki
GATK-76 Added Ami's doc block
GATK-14 Added note that these annotations can only be used with VariantAnnotator
GATK-15 specified required=false for two arguments
GATK-23 Added documentation block
GATK-33 Added documentation
GATK-34 Added documentation
GATK-32 Corrected arg name and docstring in DiffObjects
GATK-32 Added note to DO doc about reference (required but unused)
GATK-29 Added doc block to CountIntervals
GATK-31 Added @Output PrintStream to enable -o
GATK-35 Touched up docs
GATK-36 Touched up docs, specified verbosity is optional
GATK-60 Corrected GContent annot module location in gatkdocs
GATK-68 touched up docs and arg docstrings
GATK-16 Added note of caution about calling RODRequiringAnnotations as a group
GATK-61 Added run requirements (num samples, min genotype quality)
Tweaked template and generic doc block formatting (h2 to h3 titles)
GATK-62 Added a caveat to HR annot
Made experimental annotation hidden
GATK-75 Added setup info regarding BWA
GATK-22 Clarified some argument requirements
GATK-48 Clarified -G doc comments
GATK-67 Added arg requirement
GATK-58 Added annotation and usage docs
GSATDG-96 Corrected doc
Updated MD5 for DiffObjectsIntegrationTests (only change is link in table title)
* Allow RR to write its BAM to stdout by setting required=true for @Output.
* Fixed bug in sliding window where a break in coverage after a long stretch without
a variant region was causing a doubling of all the reads before the break.
* Refactored SlidingWindow.updateHeaderCounts() into 3 separate tested methods.
* Refactored polyploid consensus code out of SlidingWindow.compressVariantRegion().
Ancient DNA sequencing data is in many ways different from modern data, and methods to analyze it need to be adapted accordingly.
Feature 1: Read adaptor trimming. Ancient DNA libraries typically have very short inserts (in the order of 50 bp), so typical Illumina libraries sequenced in, say, 100bp HiSeq will have a large adaptor component being read after the insert.
If this adaptor is not removed, data will not be aligneable. There are third party tools that remove adaptor and potentially merge read pairs, but are cumbersome to use and require precise knowledge of the library construction and adaptor sequence.
-- New walker ReadAdaptorTrimmer walks through paired end data, computes pair overlap and trims auto-detected adaptor sequence.
-- Unit tests added for trimming operation.
-- Utility walker (may be retired later) DetailedReadLengthDistribution computes insert size or read length distribution stratified by read group and mapping status and outputs a GATKReport with data.
-- Renamed MaxReadLengthFilter to ReadLengthFilter and added ability to specify minimum read length as a filter (may be useful if, as a consequence of adaptor trimming, we're left with a lot of very short reads which will map poorly and will just clutter output BAMs).
Feature 2: Unbiased site QUAL estimation: many times ancestral allele status is not known and VCF fields like QUAL, QD, GQ, etc. are affected by the pop. gen. prior at a site. This might introduce subtle biases in studies where a species is aligned against the reference of another species, so an option for UG and HC not to apply such prior is introduced.
-- Added -noPrior argument to StandardCallerArgumentCollection.
-- Added option not to fill priors is such argument is set.
-- Added an integration test.
- This was needed since samples with spaces in their names are regularly found in the picard pipeline.
- Modified the tests to account for this (removed spaces from the good tests, and changed the failing tests accordingly)
- Cleaned up the unit tests using a @DataProvider (I'm in love...).
- Moved AlleleBiasedDownsamplingUtilsUnitTest to public to match location of class it is testing (due to the way bamboo operates)
* ReadTransformers can say they must be first, must be last, or don't care.
* By default, none of the existing ones care about ordering except BQSR (must be first).
* This addresses a bug reported on the forum where BAQ is incorrectly applied before BQSR.
* The engine now orders the read transformers up front before applying iterators.
* The engine checks for enabled RTs that are not compatible (e.g. both must be first) and blows up (gracefully).
* Added unit tests.
-- The new code includes a new mode to write out a BAM containing reads realigned to the called haplotypes from the HC, which can be easily visualized in IGV.
-- Previous functionality maintained, with bug fixes
-- Haplotype BAM writing code now lives in utils
-- Created a base class that includes most of the functionality of writing reads realigned to haplotypes onto haplotypes.
-- Created two subclasses, one that writes all haplotypes (previous functionality) and a CalledHaplotypeBAMWriter that will only write reads aligned to the actually called haplotypes
-- Extended PerReadAlleleLikelihoodMap.getMostLikelyAllele to optionally restrict set of alleles to consider best
-- Massive increase in unit tests in AlignmentUtils, along with several new powerful functions for manipulating cigars
-- Fix bug in SWPairwiseAlignment that produces cigar elements with 0 size, and are now fixed with consolidateCigar in AlignmentUtils
-- HaplotypeCaller now tracks the called haplotypes in the GenotypingEngine, and returns this information to the HC for use in visualization.
-- Added extensive docs to HaplotypeCaller on how to use this capability
-- BUGFIX -- don't modify the read bases in GATKSAMRecord in LikelihoodCalculationEngine in the HC
-- Cleaned up SWPairwiseAlignment. Refactored out the big main and supplementary static methods. Added a unit test with a bug TODO to fix what seems to be an edge case bug in SW
-- Integration test to make sure we can actually write a BAM for each mode. This test only ensures that the code runs and doesn't exception out. It doesn't actually enforce any MD5s
-- HaplotypeBAMWriter also left aligns indels in the reads, as SW can return a random placement of a read against the haplotype. Calls leftAlign to make the alignments more clear, with unit test of real read to cover this case
-- Writes out haplotypes for both all haplotype and called haplotype mode
-- Haplotype writers now get the active region call, regardless of whether an actual call was made. Only emitting called haplotypes is moved down to CalledHaplotypeBAMWriter
This is to facilitate the current experiment with class-level test
suite parallelism. It's our hope that with these changes, we can get
the runtime of the integration test suite down to 20 minutes or so.
-UnifiedGenotyper tests: these divided nicely into logical categories
that also happened to distribute the runtime fairly evenly
-UnifiedGenotyperPloidy: these had to be divided arbitrarily into two
classes in order to halve the runtime
-HaplotypeCaller: turns out that the tests for complex and symbolic
variants make up half the runtime here, so merely moving these into
a separate class was sufficient
-BiasedDownsampling: most of these tests use excessively large intervals
that likely can't be reduced without defeating the goals of the tests. I'm
disabling these tests for now until they can either be redesigned to use smaller
intervals around the variants of interest, or refactored into unit tests
(creating a JIRA for Yossi for this task)
* Removed from codebase NestedHashMap since it is unused and untested.
* Integration tests change because the BQSR CSV is now sorted automatically.
* Resolves GSA-732
-Some QScripts used by public pipeline tests unnecessarily used the (now protected) UnifiedGenotyper.
Changed them to use PrintReads instead.
-Moved ExampleUnifiedGenotyperPipelineTest to protected
-Attempt to fix the flawed and sporadically failing MisencodedBaseQualityUnitTest:
After looking at this class a bit, I think the problem was the use of global arrays for the quals
shared across all reads in all tests (BAMRecord class definitely does not make a separate copy for
each read!). One test (testFixBadQuals) modifies the bad quals array, and if this happens to run
before the testBadQualsThrowsError test the bad quals array will have been "fixed" and no exception
will be thrown.
-replace unnecessary uses of the UnifiedGenotyper by public integration tests
with PrintReads
-move NanoSchedulerIntegrationTest to protected, since it's completely dependent
on the UnifiedGenotyper
-was previously set to 30, which seems far too aggressive given that with
ActiveRegionWalkers, as with LocusWalkers, this limits the depth of any
pileup returned by LIBS
-250 is a more conservative default used by the UG
-can adjust down/up later based on further experiments (GSA-699 will
remain open)
-verified with Ryan that all integration test differences are either
innocent or represent an improvement
GSA-699
The issue here is that the OptimizedLikelihoodTestProvider uses the same basic underlying class as the
BasicLikelihoodTestProvider and we were using the BasicTestProvider functionality to pull out tests of
that class; so if the optimized tests were run first we were unintentionally running those same tests
again with the basic ones (but expecting different results).
-- This is done to take advantage of longer reads which can produce less ambiguous haplotypes
-- Integration tests change for HC and BiasedDownsampling
-- Instead of doing a full SW alignment against the reference we read off bubbles from the assembly graph.
-- Smith-Waterman is run only on the base composition of the bubbles which drastically reduces runtime.
-- Refactoring graph functions into a new DeBruijnAssemblyGraph class.
-- Bug fix in path.getBases().
-- Adding validation code to the assembly engine.
-- Renaming SimpleDeBruijnAssembler to match the naming of the new Assembly graph class.
-- Adding bug fixes, docs and unit tests for DeBruijnAssemblyGraph and KBestPaths classes.
-- Added ability to ignore bubbles that are too divergent from the reference
-- Max kmer can't be bigger than the extension size.
-- Reverse the order that we create the assembly graphs so that the bigger kmers are used first.
-- New algorithm for determining unassembled insertions based on the bubble traversal instead of the full SW alignment.
-- Don't need the full read span reference loc for anything any more now that we clip down to the extended loc for both assembly and likelihood evaluation.
-- Updating HaplotypeCaller and BiasedDownsampling integration tests.
-- Rebased everything into one commit as requested by Eric
-- improvements to the bubble traversal are coming as a separate push
These 2 changes improve runtime performance almost as much as Ryan's previous attempt (with ID-based comparisons):
* Don't unnecessarily overload Allele.getBases() in the Haplotype class.
* Haplotype.getBases() was calling clone() on the byte array.
* Added a constructor to Allele (and Haplotype) that takes in an Allele as input.
* It makes a copy of he given allele without having to go through the validation of the bases (since the Allele has already been validated).
* Rev'ed the variant jar accordingly.
For the reviewer: all tests passed before rebasing, so this should be good to go as far as correctness.
-- modified ReadBin GenomeLoc to keep track of softStart() and softEnd() of the reads coming in, to make sure the reference will always be sufficient even if we want to use the soft-clipped bases
-- changed the verification from readLength to aligned bases to allow reads with soft-clipped bases
-- switched TreeSet -> PriorityQueue in the ConstrainedMateFixer as some different reads can be considered equal by picard's SAMRecordCoordinateComparator (the Set was replacing them)
-- pulled out ReadBin class so it can be testable
-- added unit tests for ReadBin with soft-clips
-- added tests for getMismatchCount (AlignmentUtils) to make sure it works with soft-clipped reads
GSA-774 #resolve
-- Active regions are created as normal, but they are split and trimmed to the engine intervals when added to the traversal, if there are intervals present.
-- UnitTests for ActiveRegion.splitAndTrimToIntervals
-- GenomeLocSortedSet.getOverlapping uses binary search to efficiently in ~ log N time find overlapping intervals
-- UnitTesting overlap function in GenomeLocSortedSet
-- Discovered fundamental implementation bug in that adding genome locs out of order (elements on 20 then on 19) produces an invalid GenomeLocSortedSet. Created a JIRA to address this: https://jira.broadinstitute.org/browse/GSA-775
-- Constructor that takes a collection of genome locs now sorts its input and merges overlapping intervals
-- Added docs for the constructors in GLSS
-- Update HaplotypeCaller MD5s, which change because ActiveRegions are now restricted to the engine intervals, which changes slightly the regions in the tests and so the reads in the regions, and thus the md5s
-- GenomeAnalysisEngineUnitTest needs to provide non-null genome loc parser
-- Increase the allowed runtime of one UG integration test
-- The GGA indels mode runs two UG commands, and was barely under the 10 minute limit before. Some updates can push this right over the edge. Increased limit
-- CalibrateGenotypeLikelihoods runs on a small data set now, so it's faster
-- Updating MD5s due to more correct quality utils. DuplicatesWalkers quality estimates have changed. One UG test has different FS and rank sum tests because the conversion to phred scores are slightly (second decimal place) different
-- The UG was using MathUtils binomial probability backward, so that the estimated confidence was always NaN, and was as a side effect other utils converted this to a meaningless 0.0. This is all because there wasn't a unit test.
-- I've fixed the calculation, so it's now log10 based, uses robust MathUtils and QualityUtils functions to compute probabilities, and added a unit test.
-- Fixed a few conversion bugs with edge case quals (ones that were very high)
-- Fixed a critical bug in the conversion of quals that was causing near capped quals to fall below their actual value. Will undoubtedly need to fix md5s
-- More precise prob -> qual calculations for very high confidence events in phredScaleCorrectRate, trueProbToQual, and errorProbToQual. Very likely to improve accuracy of many calculations in the GATK
-- Added errorProbToQual and trueProbToQual calculations that accept an integer cap, and perform the (tricky) conversion from int to byte correctly.
-- Full docs and unit tests for phredScaleCorrectRate and phredScaleErrorRate.
-- Renamed probToQual to trueProbToQual
-- Added goodProbability and log10OneMinusX to MathUtils
-- Went through the GATK and cleaned up many uses of QualityUtils
-- Cleanup constants in QualityUtils
-- Added full docs for all of the constants
-- Rename MAX_QUAL_SCORE to MAX_SAM_QUAL_SCORE for clarity
-- Moved MAX_GATK_USABLE_Q_SCORE to RecalDatum, as it's s BQSR specific feature
-- Convert uses of QualityUtils.errorProbToQual(1-x) to QualityUtils.trueProbToQual(x)
-- Cleanup duplicate quality score routines in MathUtils. Moved and renamed MathUtils.log10ProbabilityToPhredScale => QualityUtils.phredScaleLog10ErrorRate. Removed 3 routines from MathUtils, and remapped their usages into the better routines in QualityUtils
-- Renamed ValidatePileup to CheckPileup since validation is reserved word
-- Renamed AlignmentValidation to CheckAlignment (same as above)
-- Refactored category definitions to use constants defined in HelpConstants
-- Fixed a couple of minor typos and an example error
-- Reorganized the GATKDocs index template to use supercategories
-- Refactored integration tests for renamed walkers (my earlier refactoring had screwed them up or not carried over)
- got md5s from a interim version that does not have the per-sample downsampling hookedup
- added an integration test that forces the result from flat-downsampling to equal that which results from an equivalent flat contamination file
-- HaplotypeCaller and PerReadAlleleLikelihoodMap should use LinkedHashMaps instead of plain HashMaps. That way the ordering when traversing alleles is maintained. If the JVM traverses HashMaps with random ordering, different reads (with same likelihood) may be removed by contamination checker, and different alleles may be picked if they have same likelihoods for all reads.
-- Put in some GATKDocs and contracts in HaplotypeCaller files (far from done, code is a beast)
-- Update md5's due to different order of iteration in LinkedHashMaps instead of HashMaps inside HaplotypeCaller (due to change in PerReadAlleleLikelihoodMap that also slightly modifies reads chosen by per-read downsampling).
-- Reenabled testHaplotypeCallerMultiSampleGGAMultiAllelic test
-- Added some defensive argument checks into HaplotypeCaller public functions (not intended to be done yet).
-- Sorted out contents of BAM Processing vs. Diagnostics & QC Tools
-- Moved two validation-related walkers from Diagnostics & QC to Validation Utilities
-- Reworded some category names and descriptions to be more explicit and user-friendly
-- New HMM has two impacts on MD5s. First, all indel calls with UG and all calls by HC no longer have the HaplotypeScore computed. This is for the good, especially given the computational cost of this annotationa and unclear value for HC. Second, the BaseQualityRankSum values are changing by tiny amounts because of the changes in the HMM likelihoods.
-- Disabled three tests from Yossi that cause strange MD5 differences with calls for HC, created a JIRA for him to enable and fix
-- Disabled the non-deterministic GGA test. Assigned JIRA to Guillermo
-- With this push I expect all integration tests to pass
-- The new HMM new edge conditions the likelihoods are offset by log10(n possible starts) so the results don't really mean "fits the haplotype well" any longer. This results in grossly inflated HaplotypeScores for indels and with the HaplotypeCaller. So I'm simply not going to emit this annotation value any longer for indels and for the HC
-- Uses 1/N for N potential start sites as the probability of starting at any one of the potential start sites
-- Add flag that says to use the original edge condition, respected by all subclasses. This brings the new code back to the original state, but with all of the cleanup I've done
-- Only test configurations where the read length <= haplotype length. I think this is actually the contract, but we'll talk about this tomorrow
-- Fix egregious bug with the myLog10SumLog10 function doing the exact opposite of the requested arguments, so that doExact really meant don't do exact
-- PairHMM now exposes computeReadLikelihoodGivenHaplotypeLog10 but subclasses must overload subComputeReadLikelihoodGivenHaplotypeLog10. This protected function does the work, and the public function will do argument and result QC
-- Have to be more tolerant of reference (approximate) HMM. All unit tests from the original HMM implementations pass now
-- Added locs of docs
-- Generalize unit tests with multiple equivalent matches of read to haplotype
-- Added runtime argument checking for initial and computeReadLikelihoodGivenHaplotypeLog10
-- Functions to dumpMatrices for debugging
-- Fix nasty bug (without original unit tests) in LoglessPairHMM
-- Max read and haplotype lengths only worked in previous code if they were exactly equal to the provided read and haplotype sizes. Fixed bug. Added unit test to ensure this doesn't break again.
-- Added dupString(string, n) method to Utils
-- Added TODOs for next commit. Need to compute number of potential start sites not in initialize but in the calc routine since this number depends not on the max sizes but the actual read sizes
-- Unit tests for the hapStartIndex functionality of PairHMM
-- Moved computeFirstDifferingPosition to PairHMM, and added unit tests
-- Added extensive unit tests for the hapStartIndex functionality of computeReadLikelihoodGivenHaplotypeLog10
-- Still TODOs left in the code that I'll fix up
-- Logless now compute constants, if they haven't been yet initialized, even if you forgot to say so
-- General: the likelihood penalty for potential start sites is now properly computed against the actual read and reference bases, not the maximum. This involved moving some initialize() code into the computeLikelihoods function. That's ok because all of the potential log10 functions are actually going to cached versions, so the slowdown is minimal
-- Added some unit tests to ensure that common errors (providing haplotypes too long, reads too long, not initializing the HMM) are captured as errors
-- Would have been squashed but could not because of subsequent deletion of Caching and Exact/Original PairHMMs
-- Actual working unit tests for PairHMMUnitTest
-- Fixed incorrect logic in how I compared hmm results to the theoretical and exact results
-- PairHMM has protected variables used throughout the subclasses
-- Base distribution optionally includes deletions
-- Implemented an optional filtered coverage distribution option
-- Integration tests added for every feature of the traversal
This walker is specially fast for the task due to the ability to calculate uncovered bases without having to visit the loci. This capability should be made generic in the future for the advantage of DiagnoseTargets and DepthOfCoverage.
GSATDG-45 #resolve
* After consulting Tim/David/Mauricio we determined that the md5 changes were due to different encodings of binary arrays in samjdk
* However, it made no functional difference to the results (confirmed by Eric) so we agreed to update md5s
* Also, the header of one of the test bams was malformed but old picard jar didn't perform checks so it only started failing now
* Fixed the bam
-- If the VariantContext is a bi-allelic variant already, don't split up the VC (it doesn't do anything) and then combine it back together. This saves us a lot of work on average
-- Be more protective of calls to AFCalc with a VariantContext that might only have ref allele, throwing an exception
- Throws user exception if it is.
- Can be turned off with --allow_bqsr_on_reduced_bams_despite_repeated_warnings argument.
- Added test to check this is working.
- Added docs to BQSRReadTransformer explaining why this check is not performed on PrintReads end.
- Added small bug fix to GenomeAnalysisEngine that I uncovered in this process.
- Added comment about not changing the program record name, as per reviewer comments.
- Removed unused variable.
- I had added the framework in the VA engine but should not have hooked it up to the HC yet since the RefMetaDataTracker is always null.
- Added contracts and docs to the relevant methods in the VA engine so that this doesn't happen in the future.
- It's now written into the recal report so that it can be used in the PrintReads step.
- Note that we also now write the --deletions_default_quality value which accidentally wasn't being written before!
- Added tests to make sure that the value of the --maximum_cycle_value is being used properly by PR with -BQSR.
(This is my last non-branch commit; all future pushes will follow new GATK practices)
The migration of org.broadinstitute.variant into the Picard repo is
complete. This commit deletes the org.broadinstitute.variant sources
from our repo and replaces it with a jar built from a checkout of the
latest Picard-public svn revision.
- Uncovered small bug in the fix that I added yesterday, which is now fixed properly.
- Uncovered massive general bug: polyploid consensus is totally busted for deletions (because of call to read.getReadBases()[readPos]).
- Need to consult Mauricio on what to do here (are we supporting het compression for deletions? (Insertions are definitely not supported)
contain two columns, Sample (String) and Fraction (Double) that form the Sample-Fraction map for the per-sample AlleleBiasedDownsampling.
-Integration tests to UnifiedGenotyper (Using artificially contaminated BAMs created from a mixure of two broadly concented samples) were added
-includes throwing an exception in HC if called using per-sample contamination file (not implemented); tested in a new integration test.
-(Note: HaplotypeCaller already has "Flat" contamination--using the same fraction for all samples--what it doesn't have is
_per-sample_ AlleleBiasedDownsampling, which is what has been added here to the UnifiedGenotyper.
-New class: DefaultHashMap (a Defaulting HashMap...) and new function: loadContaminationFile (which reads a Sample-Fraction file and returns a map).
-Unit tests to the new class and function are provided.
-Added tests to see that malformed contamination files are found and that spaces and tabs are now read properly.
-Merged the integration tests that pertain to biased downsampling, whether HaplotypeCaller or unifiedGenotyper, into a new IntegrationTest class.
* Fixed implementation of polyploid (het) compression in RR.
* The test for a usable site was all wrong. Worked out details with Mauricio to get it right.
* Added comprehensive unit tests in HeaderElement class to make sure this is done right.
* Still need to add tests for the actual polyploid compression.
* No longer allow non-diploid het compression; I don't want to test/handle it, do you?
* Added nearly full coverage of tests for the BaseCounts class.
-- Testing that cycles in the reference graph fail graph construction appropriately.
-- Minor bug fix in assembly with reduced reads.
Added some docs and contracts to SimpleDeBruijnAssembler
Added a unit test to SimpleDeBruijnAssembler
Part 1 of Variant Annotator Unit tests: PerReadAlleleLikelihoodMap
- Added contract enforcement for public methods
- Refactored the conversion from read -> (allele -> likelihood) to allele -> list[read] into its own method
- added method documentation for non getters/setters
- finals, finals everywhere
- Add in a unit test for the PerReadAlleleLikelihoodMap. Complete coverage except for .clear() and a method that is a straight call into a separately-tested utility class.
- ReduceReads by default now sets up-front ReadWalker downsampling to 40x per start position.
- This is the value I used in my tests with Picard to show that memory issues pretty much disappeared.
- This should hopefully take care of the memory issues being reported on the forum.
- Added javadocs to SlidingWindow (the main RR class) to follow GATK conventions.
- Added more unit tests to increase coverage of BaseCounts class.
- Added more unit tests to test I/D operators in the SlidingWindow class.
- Added RR qual correctness tests (note that this is a case where we don't add code coverage but still need to test critical infrastructure).
- Also added minor cleanup of BaseUtils
I've confirmed via a script that all of these differences only
involve the version number bump in the BAM headers and nothing
else:
< @HD VN:1.0 GO:none SO:coordinate
---
> @HD VN:1.4 GO:none SO:coordinate
testing the adding of reads into the SlidingWindow plus consensus creation. Will flesh these out more after I take care of
some other items on my plate.
-- All functions tested. In the testing / review I discovered several bugs in the ActiveRegion routines that manipulate reads. New version should be correct
-- Enforce correct ordering of supporting states in constructor
-- Enforce read ordering when adding reads to an active region in add
-- Fix bug in HaplotypeCaller map with new updating read spans. Now get the full span before clipping down reads in map, so that variants are correctly placed w.r.t. the full reference sequence
-- Encapsulate isActive field with an accessor function
-- Make sure that all state lists are unmodifiable, and that the docs are clear about this
-- ActiveRegion equalsExceptReads is for testing only, so make it package protected
-- ActiveRegion.hardClipToRegion must resort reads as they can become out of order
-- Previous version of HC clipped reads but, due to clipping, these reads could no longer overlap the active region. The old version of HC kept these reads, while the enforced contracts on the ActiveRegion detected this was a problem and those reads are removed. Has a minor impact on PLs and RankSumTest values
-- Updating HaplotypeCaller MD5s to reflect changes to ActiveRegions read inclusion policy
Please check that your commit hook is properly pointing at ../../private/shell/pre-commit
Conflicts:
public/java/test/org/broadinstitute/variant/VariantBaseTest.java
-Moved some of the more specialized / complex VariantContext and VCF utility
methods back to the GATK.
-Due to this re-shuffling, was able to return things like the Pair class back
to the GATK as well.
One of the fixes was critical: SlidingWindow was not converting between global and relative positions correctly.
Besides not being correct, it was resulting in a massive slow down of the RR traversal.
That fix definitely breaks at least one of the integration tests, but it's not worth changing md5s now because I'll be
changing things all over RR for the next few days, so I am going to let that test fail indefinitely until I can confirm
general correctness of the tool.
a) Add option to stratify CalibrateGenotypeLikelihoods by repeat - will add integration test in next push.
b) Simulator to produce BAM files with given error profile - for now only given SNP/indel error rate can be given. A bad context can be specified and if such context is present then error rate is increased to given value.
c) Rewrote RepeatLength covariate to do the right thing - not fully working yet, work in progress.
d) Additional experimental covariates to log repeat unit and combined repeat unit+length. Needs code refactoring/testing
-- Allows us to avoid doing a lot of misc. work to set up the genotype when we don't have any data to genotype. Valuable in the case where we are passing through large regions without any data
-- This new algorithm is essential to properly handle activity profiles that have many large active regions generated from lots of dense variant events. The new algorithm passes unit tests and passes visualize visual inspection of both running on 1000G and NA12878
-- Misc. commenting of the code
-- Updated ActiveRegionExtension to include a min active region size
-- Renamed ActiveRegionExtension to ActiveRegionTraversalParameters, as it carries more than just the traversal extension now
-- Required before I jump in an redo the entire activity profile so it's can be run imcrementally
-- This restructuring makes the differences between the two functionalities clearer, as almost all of the functionality is in the base class. The only functionality provided by the BandPassActivityProfile is isolated to a finalizeProfile function overloaded from the base class.
-- Renamed ActivityProfileResult to ActivityProfileState, as this is a clearer indication of its actual functionality. Almost all of the misc. walker changes are due to this name update
-- Code cleanup and docs for TraverseActiveRegions
-- Expanded unit tests for ActivityProfile and ActivityProfileState
Testing for moltenized output, and for genotype-level filtering. This tool is now fully functional. There are three todo items:
1) Docs
2) An additional output table that gives concordance proportions normalized by records in both eval and comp (not just total in eval or total in comp)
3) Code cleanup for table creation (putting a table together the way I do takes -way- too many lines of code)
2. While making the previous fix and unifying FS for SNPs and indels, I noticed that FS was slightly broken in the general case for indels too; fixed.
3. I also fixed a minor bug in the Allele Biased Downsampling code for reduced reads.
I've resigned myself instead to create a mapping from Allele to Haplotype. It's cheap so not a big deal, but really shouldn't be necessary.
Ryan and I are talking about refactoring for GATK2.5.
-- UnitTests now include combinational tiling of reads within and spanning shard boundaries
-- ART now properly handles shard transitions, and does so efficiently without requiring hash sets or other collections of reads
-- Updating HC and CountReadsInActiveRegions integration tests
Out of curiosity, why does Picard's IndexedFastaSequenceFile allow one to query for start position 0? When doing so, that base is a line feed (-1 offset to the first base in the contig) which is an illegal base (and which caused me no end of trouble)...
Refactored interval specific arguments out of GATKArgumentCollection into InvtervalArgumentCollection such that it can be used in other CommandLinePrograms.
Updated SelectHeaders to print out full interval arguments.
Added RemoteFile.createUrl(Date expiration) to enable creation of presigned URLs for download over http: or file:.
This way walkers won't see anything except the standard bases plus Ns in the reference.
Added option to turn off this feature (to maintain backwards compatibility).
As part of this commit I cleaned up the BaseUtils code by adding a Base enum and removing all of the static indexes for
each of the bases. This uncovered a bug in the way the DepthOfCoverage walker counts deletions (it was counting Ns instead!) that isn't covered by tests. Fortunately that walker is being deprecated soon...
Completed todo item: for sites like
(eval)
20 12345 A C
20 12345 A AC
(comp)
20 12345 A C
20 12345 A ACCC
the records will be matched by the presence of a non-empty intersection of alleles. Any leftover records are then paired with an empty variant context (as though the call was unique). This has one somewhat counterintuitive feature, which is that normally
(eval)
20 12345 A AC
(comp)
20 12345 A ACCC
would be classified as 'ALLELES_DO_NOT_MATCH' (and not counted in genotype tables), in the presence of the SNP, they're counted as EVAL_ONLY and TRUTH_ONLY respectively.
+ integration test
This way, we don't need to create a new Allele for every read/Haplotype pair to be placed in the PerReadAlleleLikelihoodMap (very inefficient). Also, now we can easily get the Haplotype associated with the best allele for a given read.
2. Framework is set up in the VariantAnnotator for the HaplotypeCaller to be able to call in to annotate dbSNP plus comp RODs. Until the HC uses meta data though, this won't work.
-- Resolved what was clearly a bug in UG (GGA mode was returning a neighboring, equivalent indel site that wasn't in input list. Not ideal)
-- Trivial read count differences in HC
-- function to create pileup elements in AlignmentStateMachine and LIBS
-- Cleanup pileup element constructors, directing users to LIBS.createPileupFromRead() that really does the right thing
-- Optimizations to AlignmentStateMachine
-- Properly count deletions. Added unit test for counting routines
-- AlignmentStateMachine.java is no longer recursive
-- Traversals now use new LIBS, not the old one
-- Added HCPerformance evaluation Qscript
-- Added some docs about one of the HC integration tests
-- HaplotypeCaller / ART performance evaluation script
Instead of the GATK Engine creating a new BaseRecalibrator (not clean), it just keeps track of the arguments (clean).
There are still some dependency issues, but it looks like they are related to Ami's code. Need to look into it further.
-- With the newer, faster BQSR, scaling was limited by the NestedIntegerArray. The solution to this is to make the entire table thread-local, so that each nct thread has its own data and doesn't have any collisions.
-- Removed the previous partial solution of having a thread-local quality score table
-- Added a new argument -lowMemory
-- AdvancedRecalibrationEngine now uses a thread-local table for the quality score table, and in finalizeData merges these thread-local tables into the final table. Radically reduces the contention for RecalDatum in this very highly used table
-- Refactored the utility function to combine two tables into RecalUtils, and created UnitTests for this function, as well as all of RecalibrationTables. Updated combine in RecalibrationReport to use this table combiner function
-- Made several core functions in RecalDatum into final methods for performance
-- Added RecalibrationTestUtils, a home for recalibration testing utilities
-- Created a ReadRecalibrationInfo class that holds all of the information (read, base quality vectors, error vectors) for a read for the call to updateDataForRead in RecalibrationEngine. This object has a restrictive interface to just get information about specific qual and error values at offset and for event type. This restrict allows us to avoid creating an vector of byte 45 for each read to represent BI and BD values not in the reads. Shaves 5% of the runtime off the entire code.
-- Cleaned up code and added lots more docs
-- With this commit we no longer have much in the way of low-hanging fruit left in the optimization of BQSR. 95% of the runtime is spent in BAQing the read, and updating the RecalData in the NestedIntegerArrays.
- Added an optional argument to BaseRecalibrator to produce sorted GATKReport Tables
- Modified BSQR Integration Tests to include the optional argument. Tests now produce sorted tables
The weird part is that the comments claimed it was doing what it was supposed to, but it didn't actually do it.
Now we maintain the last header element of the consensus (but without bases and quals) if it adjoins an element with an insertion.
Added the user's test file as an integration test.
This is an intermediate commit so that there is a record of these changes in our
commit history. Next step is to isolate the test classes as well, and then move
the entire package to the Picard repository and replace it with a jar in our repo.
-Removed all dependencies on org.broadinstitute.sting (still need to do the test classes,
though)
-Had to split some of the utility classes into "GATK-specific" vs generic methods
(eg., GATKVCFUtils vs. VCFUtils)
-Placement of some methods and choice of exception classes to replace the StingExceptions
and UserExceptions may need to be tweaked until everyone is happy, but this can be
done after the move.
-- Cleaned up code in updateDataForRead so that constant values where not computed in inner loops
-- BaseRecalibrator doesn't create it's own fasta index reader, it just piggy backs on the GATK one
-- ReadCovariates <init> now uses a thread local cache for it's int[][][] keys member variable. This stops us from recreating an expensive array over and over. In order to make this really work had to update recordValues in ContextCovariate so it writes 0s over base values its skipping because of low quality base clipping. Previously the values in the ReadCovariates keys were 0 because they were never modified by ContextCovariates. Now these values are actually zero'd out explicitly by the covariates.
-- No longer computes at each update the overall read group table. Now computes this derived table only at the end of the computation, using the ByQual table as input. Reduces BQSR runtime by 1/3 in my test
Reads that are soft-clipped off the contig (before the beginning of the contig) were being soft-clipped to position 0 instead of 1 because of an off-by-one issue. Fixed and included in the integration test.
-- Uses high-performance local writer backed by byte array that writes the entire VCF line in some write operation to the underlying output stream.
-- Fixes problems with indexing of unflushed writes while still allowing efficient block zipping
-- Same (or better) IO performance as previous implementation
-- IndexingVariantContextWriter now properly closes the underlying output stream when it's closed
-- Updated compressed VCF output file
-Switch back to the old implementation, if needed, with --use_legacy_downsampler
-LocusIteratorByStateExperimental becomes the new LocusIteratorByState, and
the original LocusIteratorByState becomes LegacyLocusIteratorByState
-Similarly, the ExperimentalReadShardBalancer becomes the new ReadShardBalancer,
with the old one renamed to LegacyReadShardBalancer
-Performance improvements: locus traversals used to be 20% slower in the new
downsampling implementation, now they are roughly the same speed.
-Tests show a very high level of concordance with UG calls from the previous
implementation, with some new calls and edge cases that still require more examination.
-With the new implementation, can now use -dcov with ReadWalkers to set a limit
on the max # of reads per alignment start position per sample. Appropriate value
for ReadWalker dcov may be in the single digits for some tools, but this too
requires more investigation.
As reported by Menachem Fromer: a critical bug in AFCalcResult:
Specifically, the implementation:
public boolean isPolymorphic(final Allele allele, final double log10minPNonRef) {
return getLog10PosteriorOfAFGt0ForAllele(allele) >= log10minPNonRef;
}
seems incorrect and should probably be:
getLog10PosteriorOfAFEq0ForAllele(allele) <= log10minPNonRef
The issue here is that the 30 represents a Phred-scaled probability of *error* and it's currently being compared to a log probability of *non-error*.
Instead, we need to require that our probability of error be less than the error threshold.
This bug has only a minor impact on the calls -- hardly any sites change -- which is good. But the inverted logic effects multi-allelic sites significantly. Basically you only hit this logic with multiple alleles, and in that case it'\s including extra alt alleles incorrectly, and throwing out good ones.
Change was to create a new function that properly handles thresholds that are PhredScaled quality scores:
/**
* Same as #isPolymorphic but takes a phred-scaled quality score as input
*/
public boolean isPolymorphicPhredScaledQual(final Allele allele, final double minPNonRefPhredScaledQual) {
if ( minPNonRefPhredScaledQual < 0 ) throw new IllegalArgumentException("phredScaledQual " + minPNonRefPhredScaledQual + " < 0 ");
final double log10Threshold = Math.log10(QualityUtils.qualToProb(minPNonRefPhredScaledQual));
return isPolymorphic(allele, log10Threshold);
}
ReduceReads now co-reduces bams if they're passed in toghether with multiple -I. Co-reduction forces every variant region in one sample to be a variant region in all samples.
Also:
* Added integrationtest for co-reduction
* Fixed bug with new no-recalculation implementation of the marksites object where the last object wasn't being removed after finalizing a variant region (updated MD5's accordingly)
DEV-200 #resolve #time 8m
-- The logic for determining active regions was a bit broken in the HC when intervals were used in the system
-- TraverseActiveRegions now uses the AllLocus view, since we always want to see all reference sites, not just those covered. Simplifies logic of TAR
-- Non-overlapping intervals are always treated as separate objects for determing active / inactive state. This means that each exon will stand on its own when deciding if it should be active or inactive
-- Misc. cleanup, docs of some TAR infrastructure to make it safer and easier to debug in the future.
-- Committing the SingleExomeCalling script that I used to find this problem, and will continue to use in evaluating calling of a single exome with the HC
-- Make sure to get all of the reads into the set of potentially active reads, even for genomic locations that themselves don't overlap the engine intervals but may have reads that overlap the regions
-- Remove excessively expensive calls to check bases are upper cased in ReferenceContext
-- Update md5s after a lot of manual review and discussion with Ryan
The MD5s for these tests were changed in commit 87435f1074615b2cd016f042980109fd53962c8d
to match the output of a broken version of BaseRecalibration. With the patch in
commit c397102ecc1fd1d2cd8f209a8f358ab4a60b50a7, the output once again matches the
*original* MD5s for these tests, and does not vary as you increase -nct.
Final resolution to GSA-632
-- I'm committing because there's some kind of fundamental problem with the ReadCovariates cache, in that historical data isn't being cleared / computed properly, and I'd rather it fail for a while than leave it in JIRA.
-- The integration tests test the -nct with PrintReads to get 1, 2, 4 and the 4 fails. But that's because of this incorrect calculation
-- Updating GATKPerformanceOverTime with the new @ClassType annotation
The old BaseRecalibrator walker is and never will be thread-safe, since it's a
LocusWalker that uses read attributes to track state.
ONLY the newer DelocalizedBaseRecalibrator is believed likely to be thread-safe
at this point. It is safe to run the DelocalizedBaseRecalibrator with -nct > 1
for testing purposes, but wait for further testing to be done before using it
for production purposes in multithreaded mode.
-With this change, BQSR performance scales properly by thread rather
than gaining nothing from additional threads.
-Benefits are seen when using either -nt (HierarchicalMicroScheduler) or -nct
(NanoScheduler)
-Removes high-level locks in the recalibration engines and NestedIntegerArray
in favor of maximally-granular locks on and around manipulation of the leaf
nodes of the NestedIntegerArray.
-NestedIntegerArray now creates all interior nodes upfront rather than on
the fly to avoid the need for locking during tree traversals. This uses
more memory in the initial part of BQSR runs, but the BQSR would eventually
converge to use this memory anyway over the course of a typical run.
IMPORTANT NOTE: This does not mean it's safe to run the old BaseRecalibrator
walker with multiple threads. The BaseRecalibrator walker is and will never be
thread-safe, as it's a LocusWalker that uses read attributes to track
state information. ONLY the newer DelocalizedBaseRecalibrator can be made
thread-safe (and will hopefully be made so in my subsequent commits). This
commit addresses performance, not correctness.
Bringing in the following relevant changes:
* Fixes the indel realigner N-Way out null pointer exception DEV-10
* Optimizations to ReduceReads that bring the run time to 1/3rd.
Conflicts:
protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SlidingWindow.java
DEV-10 #resolve #time 2m
-- Updated StandardCallerArgumentCollection to remove MaxAltAllelesForIndels. Previous argument is deprecated with meaningful doc message for people to use maxAltAlleles
-- All constructores, factory methods, and test builders and their users updated to provide just a single argument
-- Updating MD5s for integration tests that change due to genotyping more alleles
-- Adding more alleles to genotyping results in slight changes in the QUAL value for multi-allelic loci where one or more alleles aren't polymorphic. That's simply due to the way that alternative hypotheses contribute as reference evidence against each true allele. The effect can be large (new qual = old qual / 2 in one case here).
-- If we want more precision in our estimates we could decide (Eric, should we discuss?) to actually separately do a discovery phase in the genotyping, eliminate all variants not considered polymorphic, and then do a final round of calling to get the exact QUAL value for only those that are segregating. This would have the value of having the QUAL stay constant as more alleles are genotyped, at the cost of some code complexity increase and runtime. Might be worth it through
-- Created a JIRA ticket https://jira.broadinstitute.org/browse/GSA-623 for Guillermo to look at the differences as the multi-allelic nature of many sites seems to change with the new more protected infrastructure. This may be due to implementation issues in the pooled caller, problems with my interface, or could be a genuine improvement.
-- Potentially a very fast implementation (it's very clean) but restricted to the biallelic case
-- A starting point for future bi-allelic only optimized (logless) or generalized (bi-allelic general ploidy) implementations
-- Added systematic unit tests covering this implementation, and comparing it to others
-- Uncovered a nasty normalization bug in StateTracker that was capping our likelihoods at 0, even after summing up multiple likelihoods, which is just not safe to do and was causing us to lose likelihood in some cases
-- Removed the restriction that a likelihood be <= 0 in StateTracker, and the protection for these cases in GeneralPloidyExactAFCalc which just wasn't right
-- Changed UG / HC to use this one via the StandardCallerArgumentCollection
-- Update the AFCalcFactory.Calculation to have a getDefault() value instead of having a duplicate entry in the enums
-- GeneralPloidyExactAFCalc turns -Infinity values into -Double.MAX_VALUE, so our calculations pass unit tests
-- Bugfix for GeneralPloidyGenotypeLikelihoodsCalculationModel, return a null VC when the only allele we get from our final alleles to use method is the reference base
-- Fix calculation of reference posteriors when P(AF == 0) = 0.0 and P(AF == 0) = X for some meaningful value of X. Added unit test to ensure this behavior is correct
-- Fix horrible sorting bug in IndependentAllelesDiploidExactAFCalc that applied the theta^N priors in the wrong order. Add contract to ensure this doesn't ever happen again
-- Bugfix in GLBasedSampleSelector, where VCs without any polymorphic alleles were being sent to the exact model
--
-- These two classes were really the same, and now they are actually the same!
-- Cleanuped the interfaces, removed duplicate data
-- Added lots of contracts, some of which found numerical issues with GeneralPloidyExactAFCalc (which have been patched over but not fixed)
-- Moved goodProbability and goodProbabilityVector utilities to MathUtils. Very useful for contracts!
The CompressionStash is now responsible for keeping track of all intervals that must be kept uncompressed by all samples. In general this is a list generated by a tumor sample that will enforce all normal samples to abide.
- Updated ReduceReads integration tests
- Sliding Window is now using the CompressionStash (single sample).
DEV-104 #resolve #time 3m
-- Ensures that the posteriors remain within reasonable ranges. Fixed bug where normalization of posteriors = {-1e30, 0.0} => {-100000, 0.0} which isn't good. Now tests ensure that the normalization process preserves log10 precision where possible
-- Updated MathUtils to make this possible
-- Remove capability to truncate genotype likelihoods -- this wasn't used and isn't really useful after all
-- Added lots of contracts and docs, still more to come.
-- Created a default makeMaxLikelihoods function in ReferenceDiploidExactAFCalc and DiploidExactAFCalc so that multiple subclasses don't just do the default thing
-- Generalized reference bi-allelic model in IndependentAllelesDiploidExactAFCalc so that in principle any bi-allelic reference model can be used.
-- Superceded by IndependentAFCalc
-- Added support to read in an ExactModelLog in AFCalcPerformanceTest and run the independent alleles model on it.
-- A few misc. bug fixes discovered during running the performance test
For now, the het reduction should only be performed for diploids (n=2). We haven't really tested it for other ploidy so it should remain hidden until someone braves it out.
-- Updating integration tests, confirming that results for the original EXACT model are as expected given our new more rigorous application of likelihoods, priors, and posteriors
-- Fix basic logic bug in AFCalcResult.isPolymorphic and UnifiedGenotypeEngine, where isNonRef really meant isRef. Not ideal. Finally caught by some tests, but good god it almost made it into the code
-- Now takes the Math.abs of the phred-scaled confidence so that we don't see -0.0
-- Massive new suite of unit tests to ensure that bi-allelic and tri-allele events are called properly with all models, and that the IndependentAllelesDiploidExactAFCalc calls events with up to 4 alt alleles correctly. ID'd some of the bugs below
-- Fix sort order bug in IndependentAllelesDiploidExactAFCalc caught by new unit tests
-- Fix bug in GeneralPloidyExactAFCalc where the AFCalcResult has meaningless values in the likelihoods when no there we no informative GLs.
-- New capabilities in IndependentAllelesDiploidExactAFCalc to actually apply correct theta^n.alt.allele prior.
-- Tests that theta^n.alt.alleles is being applied correctly
-- Bugfix: keep in logspace when computing posterior probability in toAFCalcResult in AFCalcResultTracker.java
-- Bugfix: use only the alleles used in genotyping when assessing if an allele is polymorphic in a sample in UnifiedGenotyperEngine
-- AFCalcFactory is the only way to make AFCalcs now. There's a nice ordered enum there describing the models and their ploidy and max alt allele restrictions. The factory makes it easy to create them, and to find models that work for you given your ploidy and max alt alleles.
-- AFCalc no longer has UAC constructor -- only AFCalcFactory does. Code cleanup throughout
-- Enabling more unit tests, all of which almost pass now (except for IndependentAllelesDiploidExactAFCalc which will be fixed next)
-- It's now possible to run the UG / HC with any of the exact models currently in the system.
-- Code cleanup throughout the system, reorganizing the unit tests in particular
-- Continuing to get IndependentAllelesDiploidExactAFCalc working correctly. A long way towards the right answer now, but still not there
-- Restored (but not tested) OriginalDiploidExactAFCalc, the clean diploid O(N) version for Ryan
-- MathUtils.normalizeFromLog10 no longer returns -Infinity when kept in log space, enforces the min log10 value there
-- New convenience method in VariantContext that looks up the allele index in the alleles
-- AFCalcResult now sports a isPolymorphic and getLog10PosteriorAFGt0ForAllele functions that allow you to ask individually whether specific alleles we've tried to genotype are polymorphic given some confidence threshold
-- Lots of contracts for AFCalcResult
-- Slowly killing off AFCalcResultsTracker
-- Fix for the way UG checks for alt alleles being polymorphic, which is now properly conditioned on the alt allele
-- Change in behavior for normalizeFromLog10 in MathUtils: now sets the log10 for 0 values to -10000, instead of -Infinity, since this is really better to ensure that we don't have -Infinity values traveling around the system
-- ExactAFCalculationModelUnitTest now checks for meaningful pNonRef values for each allele, uncovering a bug in the GeneralPloidy (not fixed, related to Eric's summation issue from long ago that was reverted) in that we get different results for diploid and general-ploidy == 2 models for multi-allelics.
-- All of the code now uses the AFCalc object, not the not package protected AFCalcResultTracker. Nearly all unit tests pass (expect for a contract failing one that will be dealt with in subsequent commit), due to -Infinity values from normalizeLog10.
-- Changed the way that UnifiedGenotyper decides if the best model is non-ref. Previously looked at the MAP AC, but the MAP AC values are no longer provided by AFCalcResult. This is on purpose, because the MAP isn't a meaningful quantity for the exact model (i.e., everything is going to go to MLE AC in some upcoming commit). If you want to understand why come talk to me. Now uses the isPolymorphic function and the EMIT confidence, so that if pNonRef > EMIT then the site is poly, otherwise it's mono.
-- Renamed old class AFCalcResultTracker. This object is now allocated by the AFCalc itself, since it is heavy-weight and was badly optimized in the UG with a thread-local variable. Now, since there's already a AFCalc thread-local there, we get that optimization for free.
-- Removed the interface to provide the AFCalcResultTracker to getlog10PNonRef.
-- Wrote new, clean but unused AFCalcResult object that will soon replace the tracker as the external interface to the AFCalc model results, leaving the tracker as an internal tracker structure. This will allow me to (1) finally test things exhaustively, as the contracts on this class are clear (2) finalize the IndependentAllelesDiploidExactAFCalc class as it can work with a meaningfully defined result across each object
-- This model separates each of N alt alleles, combines the genotype likelihoods into the X/X, X/N_i, and N_i/N_i biallelic case, and runs the exact model on each independently to handle the multi-allelic case. This is very fast, scaling at O(n.alt.alleles x n.samples)
-- Many outstanding TODOs in order to truly pass unit tests
-- Added proper unit tests for the pNonRef calculation, which all of the models pass
-- Now contained in a package called afcalc
-- Extracted standard alone classes from private static classes in ExactAF
-- Most fields are now private, with accessors
-- Overall cleaner organization now
-- Now there's no duplication between exact old and constrained models. The behavior is controlled by an overloaded abstract function
-- No more static function to access the linear exact model -- you have to create the surrounding class. Updated code in the system
-- Everything passes unit tests
-- walks over the genotypes in VC, and computes for each alt allele the maximum AC we need to consider in that alt allele dimension. Does the calculation based on the PLs in each genotype g, choosing to update the max AC for the alt alleles corresponding to that PL. Only takes the first lowest PL, if there are multiple genotype configurations with the same PL value. It takes values in the order of the alt alleles.
-- AFResult now tracks the number of evaluations (turns through the model calculation) so we can now compute the scaling of exact model itself as a function of n samples
-- Added unittests for priors (flat and human)
-- Discovered nasty general ploidy bug (enabled with Guillermo_FIXME)
-- Added combinatorial unit tests for both Diploid and General (in diploid-case) for 2 and 3 alleles in all combinations of sample types (i.e., AA, AB, BB and equiv. for tri-allelic). More assert statements to ensure quality of the result.
-- Added docs (DOCUMENT YOUR CODE!) to AlleleFrequencyCalculationResult, with proper input error handling and contracts. Made mutation functions all protected
-- No longer need to call reset on your AlleleFrequencyCalculationResult -- it'd done for you in the calculation function. reset is a protected method now, so it's all cleaner and nicer this way
-- TODO still -- need to add edge-case tests for non-informative samples (0,0,0), for the impact of priors, and I need to add some way to test the result of the pNonRef
-- Added a true base class that only does truly common tasks (like manage call logging)
-- This base class provides the only public method (getLog10PNonRef) and calls into a protected compute function that's abstract
-- Split ExactAF into superclass ExactAF with common data structures and two subclasses: DiploidExact and GeneralPloidyExact
-- Added an abstract reduceScope function that manages the simplification of the input VariantContext in the case where there are too many alleles or other constraints require us to only attempt a smaller computation
-- All unit tests pass
-- This allows us to log all of the information about the exact model call (alleles, priors, PLs, result, and runtime) to a file for later debugging / optimization
-- For the pooled caller we were writing diploid no-calls even when other samples were haploid. Changed maxPloidy function to return a defaultPloidy, rather than 0, in the case where all samples are missing.
-- VCF/BCF Writers now create missing genotypes with the ploidy of other samples, or 2 if none are available at all.
-- Updating integration tests for general ploidy, as previously we wrote ./. even when other calls were 0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/0/1/1/1/1/1, but now we write ./././././././././././././././././././././././. (ugly but correct)
-Off by default; engine fork isolates new code paths from old code paths,
so no integration tests change yet
-Experimental implementation is currently BROKEN due to a serious issue
involving file spans. No one can/should use the experimental features
until I've patched this issue.
-There are temporarily two independent versions of LocusIteratorByState.
Anyone changing one version should port the change to the other (if possible),
and anyone adding unit tests for one version should add the same unit tests
for the other (again, if possible). This situation will hopefully be extremely
temporary, and last only until the experimental implementation is proven.
-- These are like read filters but can be applied either on input, on output, of handled by the walker
-- Previous example of BAQ now uses the general framework
-- Resulted in massive conceptual cleanup of SAMDataSource and ReadProperties! Yeah!
-- BQSR now uses this framework. We can now do BQSR on input, on output, or within a walker
-- PrintReads now handles all read transformers in the walker in map, enabling us to parallelize PrintReads with BAQ and BQSR
-- Currently BQSR is excepting in parallel, which subsequent commit with fix
-- Removed global variable setting in GenomeAnalysisEngine for BAQ, as command line parameters are cleanly handled by ReadTransformer infrastructure
-- In principle ReadFilters are just a special kind of ReadTransformer, but this refactoring is larger than I can do. It's a JIRA entry
-- Many files touched simply due to the refactoring and renaming of classes
-- Deleted ReadMetaDataTracker
-- Added function to ReadShard to give us the span from the left most position of the reads in the shard to the right most, which is needed for the new view
Major idea is that per-read haplotype likelihoods are now stored in a single unified object of class PerReadAlleleLikelihoodMap. Class implementation in theory hides internal storage details from outside work (still may need work cleaning up interface), and this object(or rather, a Map from Sample->perReadAlleleLikelihoodMap) is produced by UGCalcLikelihoods. The genotype calculation is also able to potentially use this info if needed. All InfoFieldAnnotations now get an extra argument with this map. Currently, this map is only produced for indels in UG, or for all variants within HaplotypeCaller. If this map is absent (SNPs in UG), the old Pileup interface is used, but it's avoided whenever possible. FORMAT annotations are not yet changed but will be focus of second step. Major benefit will be that annotations will be able to very easily discard non-informative reads for certain events. HaplotypeCaller also uses this new class, and no longer hard-codes the mapping of allele ->list(reads) but instead uses the same objects and interfaces as the rest of the modules. Code still needs further testing/cleaning/reviewing/debugging
-- Includes header page
-- Table of arguments (Arguments)
-- Summary of counts (RecalData0)
-- Summary of counts by qual (RecalData1)
-- Fixed bug in output that resulted in covariates list always being null (updated md5s accordingly)
-- BQSR.R loads all relevant libaries now, include gplots, grid, and gsalib to run correctly
-- Moved most of BQSR classes (which are used throughout the codebase) to utils.recalibration. It's better in my opinion to keep commonly used code in utils, and only specialized code in walkers. As code becomes embedded throughout GATK its should be refactored to live in utils
-- Removed unncessary imports of BQSR in VQSR v3
-- Now ready to refactor QualQuantizer and unit test into a subclass of RecalDatum, refactor unit tests into RecalDatum unit tests, and generalize into hierarchical recal datum that can be used in QualQuantizer and the analysis of adaptive context covariate
-- Update PluginManager to sort the plugins and interfaces. This allows us to have a deterministic order in which the plugin classes come back, which caused BQSR integration tests to temporarily change because I moved my classes around a bit.
* Did not touch archived walkers... those can be named whatever.
* Kept abstract classes that end in Walker untouched (e.g. LocusWalker, ReadWalker, ...)
* Renamed a few inner classes due to conflict when stripping off Walker from their outer classes: ContigStats, FlagStats and FastaStats.