Commit Graph

57 Commits (3ab2f4edb2e7fd4903ddd8f680e37f49e5c4a1d8)

Author SHA1 Message Date
Valentin Ruano-Rubio 0f99778a59 Adding Graph-based likelihood ratio calculation to HC
To active this feature add '--likelihoodCalculationEngine GraphBased' to the HC command line.

New HC Options (both Advanced and Hidden):
==========================================

  --likelihoodCalculationEngine PairHMM/GraphBased/Random (default PairHMM)

Specifies what engine should be used to generate read vs haplotype likelihoods.

  PairHMM : standard full-PairHMM approach.
  GraphBased : using the assembly graph to accelarate the process.
  Random : generate random likelihoods - used for benchmarking purposes only.

  --heterogeneousKmerSizeResolution COMBO_MIN/COMBO_MAX/MAX_ONLY/MIN_ONLY (default COMBO_MIN)

It idicates how to merge haplotypes produced using different kmerSizes.
Only has effect when used in combination with (--likelihooCalculationEngine GraphBased)

  COMBO_MIN : use the smallest kmerSize with all haplotypes.
  COMBO_MAX : use the larger kmerSize with all haplotypes.
  MIN_ONLY : use the smallest kmerSize with haplotypes assembled using it.
  MAX_ONLY : use the larger kmerSize with haplotypes asembled using it.

Major code changes:
===================

 * Introduce multiple likelihood calculation engines (before there was just one).

 * Assembly results from different kmerSies are now packed together using the AssemblyResultSet class.

 * Added yet another PairHMM implementation with a different API in order to spport
   local PairHMM calculations, (e.g. a segment of the read vs a segment of the haplotype).

Major components:
================

 * FastLoglessPairHMM: New pair-hmm implemtation using some heuristic to speed up partial PairHMM calculations

 * GraphBasedLikelihoodCalculationEngine: delegates onto GraphBasedLikelihoodCalculationEngineInstance the exectution
     of the graph-based likelihood approach.

 * GraphBasedLikelihoodCalculationEngineInstance: one instance per active-region, implements the graph traversals
     to calcualte the likelihoods using the graph as an scafold.

 * HaplotypeGraph: haplotype threading graph where build from the assembly haplotypes. This structure is the one
     used by GraphBasedLikelihoodCalculationEngineInstance to do its work.

 * ReadAnchoring and KmerSequenceGraphMap: contain information as how a read map on the HaplotypeGraph that is
     used by GraphBasedLikelihoodCalcuationEngineInstance to do its work.

Remove mergeCommonChains from HaplotypeGraph creation

Fixed bamboo issues with HaplotypeGraphUnitTest

Fixed probrems with HaplotypeCallerIntegrationTest

Fixed issue with GraphLikelihoodVsLoglessAccuracyIntegrationTest

Fixed ReadThreadingLikelihoodCalculationEngine issues

Moved event-block iteration outside GraphBased*EngineInstance

Removed unecessary parameter from ReadAnchoring constructor.
Fixed test problem

Added a bit more documentation to EventBlockSearchEngine

Fixing some private - protected dependency issues

Further refactoring making GraphBased*Instance and HaplotypeGraph slimmer. Addressed last pull request commit comments

Fixed FastLoglessPairHMM public -> protected dependency

Fixed probrem with HaplotypeGraph unit test

Adding Graph-based likelihood ratio calculation to HC

  To active this feature add '--likelihoodCalculationEngine GraphBased' to the HC command line.

New HC Options (both Advanced and Hidden):
==========================================

  --likelihoodCalculationEngine PairHMM/GraphBased/Random (default PairHMM)

Specifies what engine should be used to generate read vs haplotype likelihoods.

  PairHMM : standard full-PairHMM approach.
  GraphBased : using the assembly graph to accelarate the process.
  Random : generate random likelihoods - used for benchmarking purposes only.

  --heterogeneousKmerSizeResolution COMBO_MIN/COMBO_MAX/MAX_ONLY/MIN_ONLY (default COMBO_MIN)

It idicates how to merge haplotypes produced using different kmerSizes.
Only has effect when used in combination with (--likelihooCalculationEngine GraphBased)

  COMBO_MIN : use the smallest kmerSize with all haplotypes.
  COMBO_MAX : use the larger kmerSize with all haplotypes.
  MIN_ONLY : use the smallest kmerSize with haplotypes assembled using it.
  MAX_ONLY : use the larger kmerSize with haplotypes asembled using it.

Major code changes:
===================

 * Introduce multiple likelihood calculation engines (before there was just one).

 * Assembly results from different kmerSies are now packed together using the AssemblyResultSet class.

 * Added yet another PairHMM implementation with a different API in order to spport
   local PairHMM calculations, (e.g. a segment of the read vs a segment of the haplotype).

Major components:
================

 * FastLoglessPairHMM: New pair-hmm implemtation using some heuristic to speed up partial PairHMM calculations

 * GraphBasedLikelihoodCalculationEngine: delegates onto GraphBasedLikelihoodCalculationEngineInstance the exectution
     of the graph-based likelihood approach.

 * GraphBasedLikelihoodCalculationEngineInstance: one instance per active-region, implements the graph traversals
     to calcualte the likelihoods using the graph as an scafold.

 * HaplotypeGraph: haplotype threading graph where build from the assembly haplotypes. This structure is the one
     used by GraphBasedLikelihoodCalculationEngineInstance to do its work.

 * ReadAnchoring and KmerSequenceGraphMap: contain information as how a read map on the HaplotypeGraph that is
     used by GraphBasedLikelihoodCalcuationEngineInstance to do its work.

Remove mergeCommonChains from HaplotypeGraph creation

Fixed bamboo issues with HaplotypeGraphUnitTest

Fixed probrems with HaplotypeCallerIntegrationTest

Fixed issue with GraphLikelihoodVsLoglessAccuracyIntegrationTest

Fixed ReadThreadingLikelihoodCalculationEngine issues

Moved event-block iteration outside GraphBased*EngineInstance

Removed unecessary parameter from ReadAnchoring constructor.
Fixed test problem

Added a bit more documentation to EventBlockSearchEngine

Fixing some private - protected dependency issues

Further refactoring making GraphBased*Instance and HaplotypeGraph slimmer. Addressed last pull request commit comments

Fixed FastLoglessPairHMM public -> protected dependency

Fixed probrem with HaplotypeGraph unit test
2013-12-02 19:37:19 -05:00
Ryan Poplin ef1d58b7ff Bugfix for hom ref records that aren't GVCF blocks. 2013-09-29 19:19:26 -04:00
MauricioCarneiro 014bc4269e Merge pull request #361 from broadinstitute/bt_pairhmm_array_implementation
Add Array Logless PairHMM
2013-09-08 20:16:53 -07:00
Ryan Poplin 3503050a39 Created a single sample calling pipeline which leverages the reference model calculation mode of the HaplotypeCaller
-- Adding changes to CombineVariants to work with the Reference Model mode of the HaplotypeCaller.
-- Added -combineAnnotations mode to CombineVariants to merge the info field annotations by taking the median
-- Added new StrandBiasBySample genotype annotation for use in computing strand bias from single sample input vcfs
-- Bug fixes to calcGenotypeLikelihoodsOfRefVsAny, used in isActive() as well as the reference model
-- Added active region trimming capabilities to the reference model mode, not perfect yet, turn off with --dontTrimActiveRegions
-- We only realign reads in the reference model if there are non-reference haplotypes, a big time savings
-- We only realign reads in the reference model if the read is informative for a particular haplotype over another
-- GVCF blocks will now track and output the minimum PLs over the block

-- MD5 changes!
-- HC tests: from bug fixes in calcGenotypeLikelihoodsOfRefVsAny
-- GVCF tests: from HC changes above and adding in active region trimming
2013-09-06 16:56:34 -04:00
bradtaylor 0435bbe38f Retreived PairHMM benchmarks from archive and made improvements
PairHMMSyntheticBenchmark and PairHMMEmpirical benchmark were written to test the banded pairHMM, and were archived along with it. I returned them to the test directory for use in benchmarking the ArrayLoglessPairHMM. I commented out references to the banded pairHMM (which was left in archive), rather than removing those references entirely.

Renamed PairHMMEmpiricalBenchmark to PairHMMBandedEmpiricalBenchmark and returned it to the archive. It has a few problems for use as a general benchmark, including initializing the HMM too frequently and doing too much setup work in the 'time' method. However, since the size selection and debug printing are useful for testing the banded implementation, I decided to keep it as-is and archive it alongside with the other banded pairHMM classes. I did fix one bug that was causing the selectWorkingData function to return prematurely. As a result, the benchmark was only evaluating 4-40 pairHMM calls instead of the desired "maxRecords".

I wrote a new PairHMMEmpiricalBenchmark that simply works through a list of data, with setup work and hmm-initialization moved to its own function. This involved writing a new data read-in function in PairHMMTestData. The original was not maintaining the input data in order, the end result of which would be an over-estimate of how much caching we are able to do. The new benchmark class more closely mirrors real-world operation over large data.

It might be cleaner to fix some of the issues with the BandedEmpiricalBenchmark and use one read-in function. However, this would involve more extensive changes to:
PairHMMBandedEmpiricalBenchmark
PairHMMTestData
BandedLoglessPairHMMUnitTest

I decided against this as the banded benchmark and unit test are archived.
2013-08-28 17:23:35 -04:00
bradtaylor 3671e41b0c Add Array Logless PairHMM
A new PairHMM implementation for read/haplotype likelihood calculations. Output is the same as the LOGLESS_CACHING version.

Instead of allocating an entire (read x haplotype) matrix for each HMM state, this version stores sub-computations in 1D arrays. It also accesses intersections of the (read x haplotype) alignment in a different order, proceeding over "diagonals" if we think of the alignment as a matrix.

This implementation makes use of haplotype caching. Because arrays are overwritten, it has to explicitly store mid-process information. Knowing where to capture this info requires us to look ahead at the subsequent haplotype to be analyzed. This necessitated a signature change in the primary method for all pairHMM implementations.

We also had to adjust the classes that employ the pairHMM:
LikelihoodCalculationEngine (used by HaplotypeCaller)
PairHMMIndelErrorModel (used by indel genotyping classes)

Made the array version the default in the HaplotypeCaller and the UnifiedArgumentCollection.
The latter affects classes:
ErrorModel
GeneralPloidyIndelGenotypeLikelihoodsCalculationModel
IndelGenotypeLikelihoodsCalculationModel
... all of which use the pairHMM via PairHMMIndelErrorModel
2013-08-28 17:21:23 -04:00
Mauricio Carneiro 285ab2ac62 Better caching for the HaplotypeCaller
Problem
-------
Caching strategy is incompatible with the current sorting of the haplotypes, and is rendering the cache nearly useless.

Before the PairHMM updates, we realized that a lexicographically sorted list of haplotypes would optimize the use of the cache. This was only true until we've added the initial condition to the first row of the deletion matrix, which depends on the length of the haplotype. Because of that, every time the haplotypes differ in length, the cache has to be wiped. A lexicographic sorting of the haplotypes will put different lengths haplotypes clustered together therefore wasting *tons* of re-compute.

Solution
-------
Very simple. Sort the haplotypes by LENGTH and then in lexicographic order.
2013-08-02 01:27:29 -04:00
Mauricio Carneiro 7b731dd596 Removed native method call
and fixed indentation.
2013-07-30 13:59:58 -04:00
sathibault 71eb944e62 Adding CnyPairHMMUnitTest 2013-07-25 14:19:50 -05:00
Eric Banks b16c7ce050 A whole slew of improvements to the Haplotype Caller and related code.
1. Some minor refactorings and claenup (e.g. removing unused imports) throughout.

2. Updates to the KB assessment functionality:
   a. Exclude duplicate reads when checking to see whether there's enough coverage to make a call.
   b. Lower the threshold on FS for FPs that would easily be filtered since it's only single sample calling.

3. Make the HC consistent in how it treats the pruning factor.  As part of this I removed and archived
   the DeBruijn assembler.

4. Improvements to the likelihoods for the HC
   a. We now include a "tristate" correction in the PairHMM (just like we do with UG).  Basically, we need
      to divide e by 3 because the observed base could have come from any of the non-observed alleles.
   b. We now correct overlapping read pairs.  Note that the fragments are not merged (which we know is
      dangerous).  Rather, the overlapping bases are just down-weighted so that their quals are not more
      than Q20 (or more specifically, half of the phred-scaled PCR error rate); mismatching bases are
      turned into Q0s for now.
   c. We no longer run contamination removal by default in the UG or HC.  The exome tends to have real
      sites with off kilter allele balances and we occasionally lose them to contamination removal.

5. Improved the dangling tail merging implementation.
2013-07-12 10:09:10 -04:00
Mark DePristo e3e8631ff5 Working version of HaplotypeCaller ReferenceConfidenceModel that accounts for indels as well as SNP confidences
-- Assembly graph building now returns an object that describes whether the graph was successfully built and has variation, was succesfully built but didn't have variation, or truly failed in construction.  Fixing an annoying bug where you'd prefectly assembly the sequence into the reference graph, but then return a null graph because of this, and you'd increase your kmer because it null was also used to indicate assembly failure
--
-- Output format looks like:
20      10026072        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026073        .       A       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,119
20      10026074        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,121
20      10026075        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,119
20      10026076        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026077        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:3,0:3:9:0,9,120
20      10026078        .       C       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:5,0:5:15:0,15,217
20      10026079        .       A       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:6,0:6:18:0,18,240
20      10026080        .       G       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:6,0:6:18:0,18,268
20      10026081        .       T       <NON_REF>       .       .       .       GT:AD:DP:GQ:PL  0/0:7,0:7:21:0,21,267

We use a symbolic allele to indicate that the site is hom-ref, and because we have an ALT allele we can provide AD and PL field values.  Currently these are calculated as ref vs. any non-ref value (mismatch or insertion) but doesn't yet account properly for alignment uncertainty.
-- Can we enabled for single samples with --emitRefConfidence (-ERC).
-- This is accomplished by realigning the each read to its most likley haplotype, and then evaluting the resulting pileups over the active region interval.  The realignment is done by the HaplotypeBAMWriter, which now has a generalized interface that lets us provide a ReadDestination object so we can capture the realigned reads
-- Provide access to the more raw LocusIteratorByState constructor so we can more easily make them programmatically without constructing lots of misc. GATK data structures.  Moved the NO_DOWNSAMPLING constant from LIBSDownsamplingInfo to LocusIteratorByState so clients can use it without making LIBSDownsamplingInfo a public class.
-- Includes GVCF writer
-- Add 1 mb of WEx data to private/testdata
-- Integration tests for reference model output for WGS and WEx data
-- Emit GQ block information into VCF header for GVCF mode
-- OutputMode from StandardCallerArgumentCollection moved to UnifiedArgumentCollection as its no longer relevant for HC
-- Control max indel size for the reference confidence model from the command line.  Increase default to 10
-- Don't use out_mode in HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest
-- Unittests for ReferenceConfidenceModel
-- Unittests for new MathUtils functions
2013-07-02 15:46:38 -04:00
Mark DePristo c837d67b2f Merge pull request #273 from broadinstitute/rp_readIsPoorlyModelled
Relaxing the constraints on the readIsPoorlyModelled function.
2013-06-13 08:40:24 -07:00
Ryan Poplin f44efc27ae Relaxing the constraints on the readIsPoorlyModelled function.
-- Turns out we were aggressively throwing out borderline-good reads.
2013-06-13 11:06:23 -04:00
Ryan Poplin d5f0848bd5 HC bam writer now sets the read to MQ0 if it isn't informative
-- Makes visualization of read evidence easier in IGV.
2013-06-13 10:11:54 -04:00
Eric Banks 2f5ef6db44 New faster Smith-Waterman implementation that is edge greedy and assumes that ref and haplotype have same global start/end points.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
   * A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
     right thing for indels at the edges of the alignments.
     * Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
   * Lots of systematic testing added for this implementation.
   * NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
2013-05-13 09:36:39 -04:00
Eric Banks b53336c2d0 Added hidden mode for BQSR to force all read groups to be the same one.
* Very useful for debugging sample-specific issues
 * This argument got lost in the transition from BQSR v1 to v2
 * Added unit test to cover this case
2013-05-06 19:09:10 -04:00
Eric Banks ba2c3b57ed Extended the allele-biased down-sampling functionality to handle reduced reads.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.

Added lots of unit tests for new functionality.
2013-04-26 11:23:17 -04:00
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Mauricio Carneiro 0de6f55660 PairHMM rework
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
   # Initial conditions were not being set properly
   # Emission probabilities in the last row were not adding up to 1

The following commit fixes both by
   # averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
   # discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)

Summarized changes:
   * Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
   * Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
   * Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
   * Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
   * Rename metric lengths to read and haplotype lengths for clarity
   * Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
   * Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
   * Remove unnecessary parameters from updateCell()
   * Fix the expected probabilities coming from the exact model in PairHMMUnitTest
   * Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
   * Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.

[fix 47164949]
2013-03-30 10:50:06 -04:00
Mark DePristo ad04fdb233 PerReadAlleleLikelihoodMap getMostLikelyAllele returns an MostLikelyAllele objects now
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users.  The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not.  That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves.  There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second.  For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads.   All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event.  In this case our annotations will all fall apart, returning their default values.  Added a JIRA to address this (should be discussed in group meeting)
2013-03-26 14:27:13 -04:00
Mark DePristo 42d3919ca4 Expanded functionality for writing BAMs from HaplotypeCaller
-- The new code includes a new mode to write out a BAM containing reads realigned to the called haplotypes from the HC, which can be easily visualized in IGV.
-- Previous functionality maintained, with bug fixes
-- Haplotype BAM writing code now lives in utils
-- Created a base class that includes most of the functionality of writing reads realigned to haplotypes onto haplotypes.
-- Created two subclasses, one that writes all haplotypes (previous functionality) and a CalledHaplotypeBAMWriter that will only write reads aligned to the actually called haplotypes
-- Extended PerReadAlleleLikelihoodMap.getMostLikelyAllele to optionally restrict set of alleles to consider best
-- Massive increase in unit tests in AlignmentUtils, along with several new powerful functions for manipulating cigars
-- Fix bug in SWPairwiseAlignment that produces cigar elements with 0 size, and are now fixed with consolidateCigar in AlignmentUtils
-- HaplotypeCaller now tracks the called haplotypes in the GenotypingEngine, and returns this information to the HC for use in visualization.
-- Added extensive docs to HaplotypeCaller on how to use this capability
-- BUGFIX -- don't modify the read bases in GATKSAMRecord in LikelihoodCalculationEngine in the HC
-- Cleaned up SWPairwiseAlignment.  Refactored out the big main and supplementary static methods.  Added a unit test with a bug TODO to fix what seems to be an edge case bug in SW
-- Integration test to make sure we can actually write a BAM for each mode.  This test only ensures that the code runs and doesn't exception out.  It doesn't actually enforce any MD5s
-- HaplotypeBAMWriter also left aligns indels in the reads, as SW can return a random placement of a read against the haplotype.  Calls leftAlign to make the alignments more clear, with unit test of real read to cover this case
-- Writes out haplotypes for both all haplotype and called haplotype mode
-- Haplotype writers now get the active region call, regardless of whether an actual call was made.  Only emitting called haplotypes is moved down to CalledHaplotypeBAMWriter
2013-03-03 12:07:29 -05:00
David Roazen 6466463d5a Merged bug fix from Stable into Unstable 2013-02-26 21:54:54 -05:00
David Roazen 12a3d7ecad Fix licenses on files modified in 2.4-1 2013-02-26 21:53:17 -05:00
David Roazen a53b4a7521 Merged bug fix from Stable into Unstable 2013-02-26 21:41:13 -05:00
David Roazen 65d31ba4ad Fix runtime public -> protected dependencies in the test suite
-replace unnecessary uses of the UnifiedGenotyper by public integration tests
 with PrintReads

-move NanoSchedulerIntegrationTest to protected, since it's completely dependent
 on the UnifiedGenotyper
2013-02-26 21:19:12 -05:00
Eric Banks 396b7e0933 Fixed the intermittent PairHMM unit test failure.
The issue here is that the OptimizedLikelihoodTestProvider uses the same basic underlying class as the
BasicLikelihoodTestProvider and we were using the BasicTestProvider functionality to pull out tests of
that class; so if the optimized tests were run first we were unintentionally running those same tests
again with the basic ones (but expecting different results).
2013-02-25 15:05:13 -05:00
Eric Banks 7519484a38 Refactored PairHMM.initialize to first take haplotype max length and then the read max length so that it is consistent with other PairHMM methods. 2013-02-25 15:04:23 -05:00
Mark DePristo 9e28d1e347 Cleanup and unit tests for QualityUtils
-- Fixed a few conversion bugs with edge case quals (ones that were very high)
-- Fixed a critical bug in the conversion of quals that was causing near capped quals to fall below their actual value.  Will undoubtedly need to fix md5s
-- More precise prob -> qual calculations for very high confidence events in phredScaleCorrectRate, trueProbToQual, and errorProbToQual.  Very likely to improve accuracy of many calculations in the GATK
-- Added errorProbToQual and trueProbToQual calculations that accept an integer cap, and perform the (tricky) conversion from int to byte correctly.
-- Full docs and unit tests for phredScaleCorrectRate and phredScaleErrorRate.
-- Renamed probToQual to trueProbToQual
-- Added goodProbability and log10OneMinusX to MathUtils
-- Went through the GATK and cleaned up many uses of QualityUtils
-- Cleanup constants in QualityUtils
-- Added full docs for all of the constants
-- Rename MAX_QUAL_SCORE to MAX_SAM_QUAL_SCORE for clarity
-- Moved MAX_GATK_USABLE_Q_SCORE to RecalDatum, as it's s BQSR specific feature
-- Convert uses of QualityUtils.errorProbToQual(1-x) to QualityUtils.trueProbToQual(x)
-- Cleanup duplicate quality score routines in MathUtils.  Moved and renamed MathUtils.log10ProbabilityToPhredScale => QualityUtils.phredScaleLog10ErrorRate. Removed 3 routines from MathUtils, and remapped their usages into the better routines in QualityUtils
2013-02-16 07:31:37 -08:00
Mark DePristo e40d83f00e Final version of PairHMMs with correct edge conditions
-- Uses 1/N for N potential start sites as the probability of starting at any one of the potential start sites
-- Add flag that says to use the original edge condition, respected by all subclasses.  This brings the new code back to the original state, but with all of the cleanup I've done
-- Only test configurations where the read length <= haplotype length.  I think this is actually the contract, but we'll talk about this tomorrow
-- Fix egregious bug with the myLog10SumLog10 function doing the exact opposite of the requested arguments, so that doExact really meant don't do exact
-- PairHMM now exposes computeReadLikelihoodGivenHaplotypeLog10 but subclasses must overload subComputeReadLikelihoodGivenHaplotypeLog10.  This protected function does the work, and the public function will do argument and result QC
-- Have to be more tolerant of reference (approximate) HMM.  All unit tests from the original HMM implementations pass now
-- Added locs of docs
-- Generalize unit tests with multiple equivalent matches of read to haplotype
-- Added runtime argument checking for initial and computeReadLikelihoodGivenHaplotypeLog10
-- Functions to dumpMatrices for debugging
-- Fix nasty bug (without original unit tests) in LoglessPairHMM
-- Max read and haplotype lengths only worked in previous code if they were exactly equal to the provided read and haplotype sizes.  Fixed bug.  Added unit test to ensure this doesn't break again.
-- Added dupString(string, n) method to Utils
-- Added TODOs for next commit.  Need to compute number of potential start sites not in initialize but in the calc routine since this number depends not on the max sizes but the actual read sizes
-- Unit tests for the hapStartIndex functionality of PairHMM
-- Moved computeFirstDifferingPosition to PairHMM, and added unit tests
-- Added extensive unit tests for the hapStartIndex functionality of computeReadLikelihoodGivenHaplotypeLog10
-- Still TODOs left in the code that I'll fix up
-- Logless now compute constants, if they haven't been yet initialized, even if you forgot to say so
-- General: the likelihood penalty for potential start sites is now properly computed against the actual read and reference bases, not the maximum.  This involved moving some initialize() code into the computeLikelihoods function.  That's ok because all of the potential log10 functions are actually going to cached versions, so the slowdown is minimal
-- Added some unit tests to ensure that common errors (providing haplotypes too long, reads too long, not initializing the HMM) are captured as errors
2013-02-09 19:19:22 -05:00
Mark DePristo 09595cdeb9 Remove ExactPairHMM and OriginalPairHMM, everyone just uses Log10PairHMM with appropriate arguments 2013-02-09 13:06:54 -05:00
Mark DePristo 2d802e17a4 Delete the CachingPairHMM 2013-02-09 13:06:54 -05:00
Mark DePristo 7dcafe8b81 Preliminary version of LoglessCachingPairHMM that avoids positive likelihoods
-- Would have been squashed but could not because of subsequent deletion of Caching and Exact/Original PairHMMs
-- Actual working unit tests for PairHMMUnitTest
-- Fixed incorrect logic in how I compared hmm results to the theoretical and exact results
-- PairHMM has protected variables used throughout the subclasses
2013-02-09 13:06:54 -05:00
Mark DePristo 7fb620dce7 Generalize and fixup ContigComparator
-- Now uses a SAMSequenceDictionary to do the comparison of contigs (which is the right way to do it)
-- Added unit tests
2013-02-09 09:52:13 -05:00
David Roazen e7e76ed76e Replace org.broadinstitute.variant with jar built from the Picard repo
The migration of org.broadinstitute.variant into the Picard repo is
complete. This commit deletes the org.broadinstitute.variant sources
from our repo and replaces it with a jar built from a checkout of the
latest Picard-public svn revision.
2013-02-05 17:24:25 -05:00
Ryan Poplin cb2dd470b6 Moving the random number generator over to using GenomeAnalysisEngine.getRandomGenerator in the logless versus exact pair hmm unit test. We don't believe this will fix the problem with the non-deterministic test failures but it will give us more information the next time it fails. 2013-02-05 12:56:20 -05:00
Guillermo del Angel 971ded341b Swap java Random generator for GATK one to ensure test determinism 2013-02-04 10:57:34 -05:00
Guillermo del Angel f31bf37a6f First step in better BQSR unit tests for covariates (not done yet): more test coverage in basic covariates, test logging several read groups/read lengths and more combinations simultaneously.
Add basic Javadocs headers for PerReadAlleleLikehoodMap.
2013-02-03 15:31:30 -05:00
Guillermo del Angel a520058ef6 Add option to specify maximum STR length to RepeatCovariates from command line to ease testing 2013-02-01 13:51:31 -05:00
Ryan Poplin 85dabd321f Adding unit tests for hierarchicalBayesianQualityEstimate function 2013-01-30 13:26:07 -05:00
Ryan Poplin 07fe3dd1ef Merge branch 'master' of github.com:broadinstitute/gsa-unstable 2013-01-30 13:19:24 -05:00
David Roazen 9985f82a7a Move BaseUtils back to the GATK by request, along with associated utility methods 2013-01-30 13:09:44 -05:00
Ryan Poplin 2967776458 The Empirical quality column in the recalibration report can't be compared in the BQSRGatherer because the value is calculated using the Bayesian estimate with different priors. This value should never be used from a recalibration report anyway except during plotting. 2013-01-30 12:28:14 -05:00
Mauricio Carneiro 29fd536c28 Updating licenses manually
Please check that your commit hook is properly pointing at ../../private/shell/pre-commit

Conflicts:
	public/java/test/org/broadinstitute/variant/VariantBaseTest.java
2013-01-29 17:27:53 -05:00
David Roazen a536e1da84 Move some VCF/VariantContext methods back to the GATK based on feedback
-Moved some of the more specialized / complex VariantContext and VCF utility
 methods back to the GATK.

-Due to this re-shuffling, was able to return things like the Pair class back
 to the GATK as well.
2013-01-29 16:56:55 -05:00
Guillermo del Angel 1d5b29e764 Unit tests for repeat covariates: generate 100 random reads consisting of tandem repeat units of random content and size, and check that covariates match expected values at all positions in reads.
Fixed corner case where value of covariate at border between 2 tandem repeats of different length/content wasn't consistent
2013-01-29 15:23:02 -05:00