We now run Smith-Waterman on the dangling tail against the corresponding reference tail.
If we can generate a reasonable, low entropy alignment then we trigger the merge to the
reference path; otherwise we abort. Also, we put in a check for low-complexity of graphs
and don't let those pass through.
Added tests for this implementation that checks exact SW results and correct edges added.
Principle is simple: when coverage is deep enough, any single-base read error will look like a rare k-mer but correct sequence will be supported by many reads to correct sequences will look like common k-mers. So, algorithm has 3 main steps:
1. K-mer graph buildup.
For each read in an active region, a map from k-mers to the number of times they have been seen is built.
2. Building correction map.
All "rare" k-mers that are sparse (by default, seen only once), get mapped to k-mers that are good (by default, seen at least 20 times but this is a CL argument), and that lie within a given Hamming distance (by default, =1). This map can be empty (i.e. k-mers can be uncorrectable).
3. Correction proposal
For each constituent k-mer of each read, if this k-mer is rare and maps to a good k-mer, get differing base positions in k-mer and add these to a list of corrections for each base in each read. Then, correct read at positions where correction proposal is unanimous and non-empty.
The algorithm defaults are chosen to be very stringent and conservative in the correction: we only try to correct singleton k-mers, we only look for good k-mers lying at Hamming distance = 1 from them, and we only correct a base in read if all correction proposals are congruent.
By default, algorithm is disabled but can be enabled in HaplotypeCaller via the -readErrorCorrect CL option. However, at this point it's about 3x-10x more expensive so it needs to be optimized if it's to be used.
Ns are treated as wildcards in the PairHMM so creating haplotypes with Ns gives them artificial advantages over other ones.
This was the cause of at least one FN where there were Ns at a SNP position.
Problem:
The sequence graphs can get very complex and it's not enough just to test that any given read has non-unique kmers.
Reads with variants can have kmers that match unique regions of the reference, and this causes cycles in the final
sequence graph. Ultimately the problem is that kmers of 10/25 may not be large enough for these complex regions.
Solution:
We continue to try kmers of 10/25 but detect whether cycles exist; if so, we do not use them. If (and only if) we
can't get usable graphs from the 10/25 kmers, then we start iterating over larger kmers until we either can generate
a graph without cycles or attempt too many iterations.
-- Reuse infrastructure for RODs for reads to implement general IntervalReferenceOrderedView so that both TraverseReads and TraverseActiveRegions can use the same underlying infrastructure
-- TraverseActiveRegions now provides a meaningful RefMetaDataTracker to ActiveRegionWalker.map
-- Cleanup misc. code as it came up
-- Resolves GSA-808: Write general utility code to do rsID allele matching, hook up to UG and HC
- Memoized MathUtil's cumulative binomial probability function.
- Reduced the default size of the read name map in reduced reads and handle its resets more efficiently.
-- Created a new annotation DepthPerSampleHC that is by default on in the HaplotypeCaller
-- The depth for the HC is the sum of the informative alleles at this site. It's not perfect (as we cannot differentiate between reads that align over the event but aren't informative vs. those that aren't even close) but it's a pretty good proxy and it matches with the AD field (i.e., sum(AD) = DP).
-- Update MD5s
-- delivers [#48240601]
-- In the case where we have multiple potential alternative alleles *and* we weren't calling all of them (so that n potential values < n called) we could end up trimming the alleles down which would result in the mismatch between the PerReadAlleleLikelihoodMap alleles and the VariantContext trimmed alleles.
-- Fixed by doing two things (1) moving the trimming code after the annotation call and (2) updating AD annotation to check that the alleles in the VariantContext and the PerReadAlleleLikelihoodMap are concordant, which will stop us from degenerating in the future.
-- delivers [#50897077]
-- Ultimately this was caused by overly aggressive merging of CommonSuffixMerger. In the case where you have this graph:
ACT [ref source] -> C
G -> ACT -> C
we would merge into
G -> ACT -> C
which would linearlize into
GACTC
Causing us to add bases to the reference source node that couldn't be recovered. The solution was to ensure that CommonSuffixMerger only operates when all nodes to be merged aren't source nodes themselves.
-- Added a convenient argument to the haplotype caller (captureAssemblyFailureBAM) that will write out the exact reads to a BAM file that went into a failed assembly run (going to a file called AssemblyFailure.BAM). This can be used to rerun the haplotype caller to produce the exact error, which can be hard in regions of deep coverage where the downsampler state determines the exact reads going into assembly and therefore makes running with a sub-interval not reproduce the error
-- Did some misc. cleanup of code while debugging
-- [delivers #50917729]
-- The previous implementation attempted to be robust to this, but not all cases were handled properly. Added a helper function updateInde() that bounds up the update to be in the range of the indel array, and cleaned up logic of how the method works. The previous behavior was inconsistent across read fwd/rev stand, so that the indel cigars at the end of read were put at the start of reads if the reads were in the forward strand but not if they were in the reverse strand. Everything is now consistent, as can be seen in the symmetry of the unit tests:
tests.add(new Object[]{"1D3M", false, EventType.BASE_DELETION, new int[]{0,0,0}});
tests.add(new Object[]{"1M1D2M", false, EventType.BASE_DELETION, new int[]{1,0,0}});
tests.add(new Object[]{"2M1D1M", false, EventType.BASE_DELETION, new int[]{0,1,0}});
tests.add(new Object[]{"3M1D", false, EventType.BASE_DELETION, new int[]{0,0,1}});
tests.add(new Object[]{"1D3M", true, EventType.BASE_DELETION, new int[]{1,0,0}});
tests.add(new Object[]{"1M1D2M", true, EventType.BASE_DELETION, new int[]{0,1,0}});
tests.add(new Object[]{"2M1D1M", true, EventType.BASE_DELETION, new int[]{0,0,1}});
tests.add(new Object[]{"3M1D", true, EventType.BASE_DELETION, new int[]{0,0,0}});
tests.add(new Object[]{"4M1I", false, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
tests.add(new Object[]{"3M1I1M", false, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
tests.add(new Object[]{"2M1I2M", false, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});
tests.add(new Object[]{"1M1I3M", false, EventType.BASE_INSERTION, new int[]{1,0,0,0,0}});
tests.add(new Object[]{"1I4M", false, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});
tests.add(new Object[]{"4M1I", true, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});
tests.add(new Object[]{"3M1I1M", true, EventType.BASE_INSERTION, new int[]{0,0,0,0,1}});
tests.add(new Object[]{"2M1I2M", true, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
tests.add(new Object[]{"1M1I3M", true, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
tests.add(new Object[]{"1I4M", true, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});
-- delivers #50445353
-- We now inject the given alleles into the reference haplotype and add them to the graph.
-- Those paths are read off of the graph and then evaluated with the appropriate marginalization for GGA mode.
-- This unifies how Smith-Waterman is performed between discovery and GGA modes.
-- Misc minor cleanup in several places.
The problem ultimately was that ReadUtils.readStartsWithInsertion() ignores leading hard/softclips, but
ReduceReads does not. So I refactored that method to include a boolean argument as to whether or not
clips should be ignored. Also rebased so that return type is no longer a Pair.
Added unit test to cover this situation.
-- Started by Mark. Finished up by Ryan.
-- GGA mode still respected glm argument for SNP and INDEL models, so that you would silently fail to genotype indels at all if the -glm INDEL wasn't provided, but you'd still emit the sites, so you'd see records in the VCF but all alleles would be no calls.
-- https://www.pivotaltracker.com/story/show/48924339 for more information
-- [resolves#48924339]
Problem
--------
Diagnose Targets is outputting missing intervals to stdout if the argument -missing is not provided
Solution
--------
Make it NOT default to stdout
[Delivers #50386741]
BandedHMM
---------
-- An implementation of a linear runtime, linear memory usage banded logless PairHMM. Thought about 50% faster than current PairHMM, this implementation will be superceded by the GraphHMM when it becomes available. The implementation is being archived for future reference
Useful infrastructure changes
-----------------------------
-- Split PairHMM into a N2MemoryPairHMM that allows smarter implementation to not allocate the double[][] matrices if they don't want, which was previously occurring in the base class PairHMM
-- Added functionality (controlled by private static boolean) to write out likelihood call information to a file from inside of LikelihoodCalculationEngine for using in unit or performance testing. Added example of 100kb of data to private/testdata. Can be easily read in with the PairHMMTestData class.
-- PairHMM now tracks the number of possible cell evaluations, and the LoglessCachingPairHMM updates the nCellsEvaluated so we can see how many cells are saved by the caching calculation.
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion. This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element. New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set. Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
Bug fixes and missing interval functionality for Diagnose Targets
While the code seems fine, the complex parts of it are untested. This is probably fine for now, but private code can have a tendency to creep into the codebase once accepted. I would have preferred that unit test OR a big comment stating that the code is untested (and thus broken by Mark's rule).
It is with these cavets that I accept the pull request.
Problem
------
Diagnose Targets identifies holes in the coverage of a targetted experiment, but it only reports them doesn't list the actual missing loci
Solution
------
This commit implements an optional intervals file output listing the exact loci that did not pass filters
Itemized changes
--------------
* Cache callable statuses (to avoid recalculation)
* Add functionality to output missing intervals
* Implement new tool to qualify the missing intervals (QualifyMissingIntervals) by gc content, size, type of missing coverage and origin (coding sequence, intron, ...)
Problem
-------
When the interval had no reads, it was being sent to the VCF before the intervals that just got processed, therefore violating the sort order of the VCF.
Solution
--------
Use a linked hash map, and make the insertion and removal all happen in one place regardless of having reads or not. Since the input is ordered, the output has to be ordered as well.
Itemized changes
--------------
* Clean up code duplication in LocusStratification and SampleStratification
* Add number of uncovered sites and number of low covered sites to the VCF output.
* Add new VCF format fields
* Fix outputting multiple status when threshold is 0 (ratio must be GREATER THAN not equal to the threshold to get reported)
[fixes#48780333]
[fixes#48787311]
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
-- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
-- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
* bitset could legitimately be in an unfinished state but we were trying to access it without finalizing.
* added --cancer_mode argument per Mark's suggestion to force the user to explicitly enable multi-sample mode.
* tests were easiest to implement as integration tests (this was a really complicated case).
Problem
-------
The DeBruijn assembler was too slow. The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp). This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.
Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers. The algorithm operates as follows:
identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
for each base in the sequence from the starting vertex kmer:
look at the existing outgoing nodes of current vertex V. If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
If no matching next vertex exists, find a unique vertex with kmer K. If one exists, merge the sequence into this vertex, and continue
If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue
This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size. This allows us to assemble well with even very short kmers.
This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:
-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples. This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor. This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization. This change is essential for us to get good variants from our paths when the kmer size is small. It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation. Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary. This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler
Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations. This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate. Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
* This is emerging now because BWA-MEM produces lots of reads that are not primary alignments
* The ConstrainedMateFixingManager class used by IndelRealigner was mis-adjusting SAM flags because it
was getting confused by these secondary alignments
* Added unit test to cover this case
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly. Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.
The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly. Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).
Also:
1. counts are now maintained as ints whenever possible. Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
-- Added check to see if read spans beyond reference window MINUS padding and event length. This guarantees that read will always be contained in haplotype.
-- Changed md5's that happen when long reads from old 454 data have their likelihoods changed because of the extra base clipping.
Use case:
The default AF priors used (infinite sites model, neutral variation) is appropriate in the case where the reference allele is ancestral, and the called allele is a derived allele.
Most of the times this is true but in several population studies and in ancient DNA analyses this might introduce reference biases, and in some other cases it's hard to ascertain what the ancestral allele is (normally requiring to look up homologous chimp sequence).
Specifying no prior is one solution, but this may introduce a lot of artifactual het calls in shallower coverage regions.
With this option, users can specify what the prior for each AC should be according to their needs, subject to the restrictions documented in the code and in GATK docs.
-- Updated ancient DNA single sample calling script with filtering options and other cleanups.
-- Added integration test. Removed old -noPrior syntax.
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.
Added lots of unit tests for new functionality.
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions. Then we get the
best of both worlds. As a note, coverage refers to just the individual base counts and not the entire pileup.
2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.
3. Each consensus keeps track of its own number of softclipped bases. There was no reason that that number
should be shared between them.
4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now. Don't lose that
information. Maybe we'll decide to change this in the future, but for now we are conservative.
5. Also implemented various small performance optimizations based on profiling.
Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
Calling everything statistics was very confusing. Diagnose Targets stratifies the data three ways: Interval, Sample and Locus. Each stratification then has it's own set of metrics (plugin system) to calculate -- LocusMetric, SampleMetric, IntervalMetric.
Metrics are generalized by the Metric interface. (for generic access)
Stratifications are generalized by the AbstractStratification abstract class. (to aggressively limit code duplication)
-- In case there are no informative bases in a pileup but pileup isn't empty (like when all bases have Q < min base quality) the GLs were still computed (but were all zeros) and fed to the exact model. Now, mimic case of diploid Gl computation where GLs are only added if # good bases > 0
-- I believe general case where only non-informative GLs are fed into AF calc model is broken and yields bogus QUAL, will investigate separately.
* Make most classes final, others package local
* Move to diagnostics.diagnosetargets package
* Aggregate statistics and walker classes on the same package for simplified visibility.
* Make status list a LinkedList instead of a HashSet
A plugin enabled implementation of DiagnoseTargets
Summarized Changes:
-------------------
* move argument collection into Thresholder object
* make thresholder object private member of all statistics classes
* rework the logic of the mate pairing thresholds
* update unit and integration tests to reflect the new behavior
* Implements Locus Statistic plugins
* Extend Locus Statistic plugins to determine sample status
* Export all common plugin functionality into utility class
* Update tests accordingly
[fixes#48465557]
* remove interval statistic low_median_coverage -- it is already captured by low coverage and coverage gaps.
* add gatkdocs to all the parameters
* clean up the logic on callable status a bit (still need to be re-worked into a plugin system)
* update integration tests
This is not really feasible with the current mandate of this walker. We would have to traverse by reference and that would make the runtime much higher, and we are not really interested in the status 99% of the time anyway. There are other walkers that can report this, and just this, status more cheaply.
[fixes#48442663]
Problem
-------
Diagnose targets is outputting both LOW_MEDIAN_COVERAGE and NO_READS when no reads are covering the interval
Solution
--------
Only allow low median coverage check if there are reads
[fixes#48442675]
Problem
-------
Diagnose targets was skipping intervals when they were not covered by any reads.
Solution
--------
Rework the interval iteration logic to output all intervals as they're skipped over by the traversal, as well as adding a loop on traversal done to finish outputting intervals past the coverage of teh BAM file.
Summarized Changes
------------------
* Outputs all intervals it iterates over, even if uncovered
* Outputs leftover intervals in the end of the traversal
* Updated integration tests
[fixes#47813825]
-- The problem is that the common suffix splitter could eliminate the reference source vertex when there's an incoming node that contains all of the reference source vertex bases and then some additional prefix bases. In this case we'd eliminate the reference source vertex. Fixed by checking for this condition and aborting the simplification
-- Update MD5s, including minor improvements
-- Reduce the min read length to 10 bp in the filterNonPassingReads in the HC. Now that we filter out reads before genotyping, we have to be more tolerant of shorter, but informative, reads, in order to avoid a few FNs in shallow read data
-- Reduce the min usable base qual to 8 by default in the HC. In regions with low coverage we sometimes throw out our only informative kmers because we required a contiguous run of bases with >= 16 QUAL. This is a bit too aggressive of a requirement, so I lowered it to 8.
-- Together with the previous commit this results in a significant improvement in the sensitivity and specificity of the caller
NA12878 MEM chr20:10-11
Name VariantType TRUE_POSITIVE FALSE_POSITIVE FALSE_NEGATIVE TRUE_NEGATIVE CALLED_NOT_IN_DB_AT_ALL
branch SNPS 1216 0 2 194 0
branch INDELS 312 2 13 71 7
master SNPS 1214 0 4 194 1
master INDELS 309 2 16 71 10
-- Update MD5s in the integration tests to reflect these two new changes
* Moved redundant code out of UGEngine
* Added overloaded methods that assume p=0.5 for speed efficiency
* Added unit test for the binomialCumulativeProbability method
The Problem:
Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
regions in an exome) causes RR (with default settings) to consider it a variant region. This
seriously hurts compression performance.
The Solution:
1. We now use a probabilistic model for determining whether we can create a consensus (in other
words, whether we can error correct a site) instead of the old ratio threshold. We calculate
the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
2. We also allow het compression globally, not just at known sites. So if we cannot create a
consensus at a given site then we try to perform het compression; and if we cannot perform het
compression that we just don't reduce the variant region. This way very wonky regions stay
uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
locus get het compressed.
Details:
1. -minvar is now deprecated in favor of -min_pvalue.
2. Added integration test for bad pvalue input.
3. -known argument still works to force het compression only at known sites; if it's not included
then we allow het compression anywhere. Added unit tests for this.
4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
Before finalizing het compression, we now check for insertions or other variant regions (usually due
to multi-allelics) which can render a region incompressible (and we back out if we find one). We
were checking for excessive softclips before, but now we add these tests too.
5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
out instead of backing out all of them.
6. We no longer create a mini read at the stop of the variant window for het compression. Instead, we
allow it to be part of the next global consensus.
7. The coverage test is no longer run systematically on all integration tests because the quals test
supercedes it. The systematic quals test is now much stricter in order to catch bugs and edge cases
(very useful!).
8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
for a consensus was affected by good and bad bases/reads).
9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
with insertions from a header.
Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples. This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes. The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects. After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model. It's worse than the current version in both single and multiple samples:
1000G EUR samples:
10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes
Name VariantType TRUE_POSITIVE FALSE_POSITIVE FALSE_NEGATIVE TRUE_NEGATIVE CALLED_NOT_IN_DB_AT_ALL
per_sample SNPS 50 0 5 8 1
per_sample INDELS 6 0 7 2 1
pooled SNPS 49 0 6 8 1
pooled INDELS 5 0 8 2 1
100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes
Name VariantType TRUE_POSITIVE FALSE_POSITIVE FALSE_NEGATIVE TRUE_NEGATIVE CALLED_NOT_IN_DB_AT_ALL
per_sample SNPS 144 0 22 28 1
per_sample INDELS 28 1 16 9 11
pooled SNPS 143 0 23 28 1
pooled INDELS 27 1 17 9 11
java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug
haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds
java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug
haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
-- It's useful to know which sites have been used in the training of the model. The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.
Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
-- The PairHMM no longer allows us to create haplotypes with 0 bases. The UG indel caller used to create such haplotypes. Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes#47523579]
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble. The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls. I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.
-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all
General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly. Depreciated old call to inline constants. This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default. Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
-- Ensure that BQSR works properly for an Ion Torrent BAM. (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
-- old algorithm was O(kmerSize * readLen) for each read. New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph. Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
-- The previous creation algorithm used the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to the graph
add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
update edge count by 1 if kmer1 -> kmer2 already existed in the graph
-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)). This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap
for each kmer pair 1 and 2 in the hash counter
add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
update edge count by count from map if kmer1 -> kmer2 already existed in the graph
-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:
X -> A -> B
Y -> A -> B
So that the incoming vertices of B all have the same sequence. This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph. Fixed and unit tested
-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging. So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph. Equals here means that all vertices have equivalents in both graphs, as do all edges. If the two graphs are equal we stop simplifying. It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
-- HC now throws a UserException if this model is provided. Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5]. The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding. Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i. Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models. Allowing cycles can be re-enabled with an HC command line switch.
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes. This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype. All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension). Radically speeds up calculations when using large active region extensions. The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible. The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter. The previous error corrector was just broken (conceptually) and was disabled by default in the engine. Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so. This would introduce large deletion events at the start / end of the assemblies. Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go. Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains. The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator. For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed. Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well. Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp. In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M. The new code supports this. UnitTested and documented as well. LDMerger handles case where merging two alleles results in a no-op event. Merging CA/C + A/AA -> CAA/CAA -> no op. Handles this case by removing the two events. UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right). Here's the new algorithm:
* Compute probability that two variants are in phase with each other and that no
* compound hets exist in the population.
*
* Implemented as a likelihood ratio test of the hypothesis:
*
* x11 and x22 are the only haplotypes in the populations
*
* vs.
*
* all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
*
* Now, since we have to have both variants in the population, we exclude the x11 & x11 state. So the
* p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
*
* Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
*
* - P(x11 & x12 & x21) -- we have hom-ref and both hets
* - P(x22 & x12 & x21) -- we have hom-alt and both hets
* - P(x22 & x12) -- one haplotype is 22 and the other is het 12
* - P(x22 & x21) -- one haplotype is 22 and the other is het 21