Story:
https://www.pivotaltracker.com/story/show/66238286
Changes:
1. Created a new k-best haplotype search implementation in class KBestHaplotypeFinder.
2. Changed HC code to use the new implementation.
This seems to fix the original problem without causing significant changes in outputs using some empirical data test cases
3. Moved haplotype's cigar calculation code from Path to CigarUtils; need that in order to gain independence from Path in some parts of the code.
In any case that seems like a more natural location for that functionality.
The purpose of this is to be able to call SNPs that fall at the beginning of a capture region (or exon).
Before, the read threading code would only start threading from the first kmer that matched the reference. But
that means that, in the case of a SNP at the beginning of an exome, it wouldn't start threading the read until
after the SNP position - so we'd lose the SNP.
For now, this is still very experimental. It works well for RNAseq data, but does introduce FPs in normal exomes.
I know why this is and how to fix it, but it requires a much larger fix to the HC: the HC needs to pass all reads
and bases to the annotation engine (like UG does) instead of just the high quality ones. So for now, the head
merging is disabled by default.
As per reviewer comments, I moved the head and tail merging code out into their own class.
We use a "manager" to keep track of observed splits and previous reads. This can be extended/modified in the
future to try to salvage those overhangs instead of hard-clipping them and/or try other possible strategies.
Added unit tests and more integration tests.
The GATK now fails with a user error if you try to run with a reduced bam.
(I added a unit test for that; everything else here is just the removal of all traces of RR)
PairHMMLikelihoodCalculationEngine.java to fall back to LOGLESS_CACHING
in case the native library could not be loaded. Made
VECTOR_LOGLESS_CACHING as the default implementation.
2. Updated the README with Mauricio's comments
3. baseline.cc is used within the library - if the machine supports
neither AVX nor SSE4.1, the native library falls back to un-vectorized
C++ in baseline.cc.
4. pairhmm-1-base.cc: This is not part of the library, but is being
heavily used for debugging/profiling. Can I request that we keep it
there for now? In the next release, we can delete it from the
repository.
5. I agree with Mauricio about the ifdefs. I am sure you already know,
but just to reassure you the debug code is not compiled into the library
(because of the ifdefs) and will not affect performance.
Re-added import java.io.File for BamGatherFunction.
Other cleanup to resolve scala syntax warnings from intellij.
Moved Example UG script to from protected to public.
This commit consists of 2 main changes:
1. When the strand table gets too large, we normalize it down to values that are more reasonable.
2. We don't include a particular sample's contribution unless the total ref and alt counts are at least 2 each;
this is a heuristic method for dealing only with hets.
MD5s change as expected.
Hopefully we'll have a more robust implementation for GATK 3.1.
The slicePrefix method functionality was broken.
Story:
https://www.pivotaltracker.com/story/show/64595624
Changes:
1. Fixed the bug.
2. Added unit test to check on the method functionality.
3. Added a integration test to verify the bug has been fixed in a empirical data reprudible case.
Story:
https://www.pivotaltracker.com/s/projects/1007536
Changes:
1. HC's GenotypingEngine now invokes reverseAlleleTrimming on GVCF variant output lines.
2. GenotypeGVCFs also reverse trim after regenotyping as some alt. alleles are dropped (observed in real-data).
The writer was never resetting the pointer to the end of the last non-ref VariantContext that it saw.
This was fine except when it jumped to a new contig - and a lower position on that contig - where it
thought that it was still part of that previous non-ref VariantContext so wouldn't emit a reference
block. Therefore, ref blocks were missing from the beginnings of all chromosomes (except chr1).
Added unit test to cover this case.
Bug uncovered by some untrimmed alleles in the single sample pipeline output.
Notice however does not fix the untrimmed alleles in general.
Story:
https://www.pivotaltracker.com/story/show/65481104
Changes:
1. Fixed the bug itself.
2. Fixed non-working tests (sliently skipped due to exception in dataProvider).
Note that this tool is still a work in progress and very experimental, so isn't 100% stable. Most of
the features are untested (both by people and by unit/integration tests) because Chris Hartl implemented
it right before he left, and we're going to need to add tests at some point soon. I added a first
integration test in this commit, but it's just a start.
The fixes include:
1. Stop having the genotyping code strip out AD values. It doesn't make sense that it should do this so
I don't know why it was doing that at all.
Updated GenotypeGVCFs so that it doesn't need to manually recover them anymore.
This also helps CalculateGenotypePosteriors which was losing the AD values.
Updated code in LeftAlignAndTrimVariants to strip out PLs and AD, since it wasn't doing that before.
Updated the integration test for that walker to include such data.
2. Chris was calling Math.pow directly on the normalized posteriors which isn't safe.
Instead, the normalization routine itself can revert back to log scale in a safe manner so let's use it.
Also, renamed the variable to posteriorProbabilities (and not likelihoods).
3. Have CGP update the AC/AF/AN counts after fixing GTs.
After extensive detective work, Joel determined that these tests were failing
due to changes in the implementation of Math.pow() in newer versions of
Java 1.7.
All GSA members should ensure that they're using a JDK that is at least
as current as the one in the Java-1.7 dotkit on the Broad servers
(build 1.7.0_51-b13).
1. updated QualByDepth not to use AD-restricted depth if it is zero.
Added unit test this change.
2. Fixed small bug in CombineGVCFs where spanning deletions were not being treated consistently throughout.
Added test for this situation.
3. Make sure GenotypeGVCFs puts in the required headers.
Updated test files to make sure this is covered.
4. Have GenotypeGVCFs propagate up the MLEAC/AF (which were getting clobbered out).
Tests updated to account for this.
when the AD annotation is present for a given genotype then we only use its depth for QD if the variant depth > 1.
Added new unit tests for QualByDepth.
Creating new VariantContexts each time we broke up a block was very expensive because we break up
blocks so often. Also, calling into GATKVariantContextUtils.simpleMerge was really hurting performance.
MD5 changes because we no longer propogate any INFO fields (except for END) for reference blocks; the tests
have the now unused BLOCK_SIZE field that now get dropped.
Story:
https://www.pivotaltracker.com/story/show/65388246
Additional changes and notes:
1. The fix consist in forcing the output of all PLs by setting the standard flag for that '-allSitePLs'.
2. BP_RESOLUTION was handled differently to GVCF in some aspect that should be common. That has been fixed.
The library is compiled using makefile and copied into the directory:
build/java/classes/org/broadinstitute/sting/utils/pairhmm/
2. Bundled the library into StingUtils.jar. Unpacked and loaded at
runtime without the need to set java.library.path
Caveats:
Platform independence has probably been thrown out of the window.
Assumptions:
a. make command exists at /usr/bin/make
b. rsync command exists at /usr/bin/rsync
c. icc is in the PATH of the user
1. AD values now propogate up (they weren't before).
2. MIN_DP gets transferred over to DP and removed.
3. SB gets removed after FS is calculated.
Also, added a bunch of new integration tests for GenotypeGVCFs.
AC,AF,AN,FS,QD - they'll all be recomputed later.
BLOCK_SIZE and MIN_GQ were not necessary.
I also made the StrandBiasBySample annotation forced on when in gVCF mode.
It turns out that its output wasn't compatible with BCF so I patched it (and the variant jar too).
This tool will take any number of gVCFs and create a merged gVCF (as opposed to
GenotypeGVCFs which produces a standard VCF).
Added unit/integration tests and fixed up GATK docs.
New properties to disable regenerating example resources artifact when each parallel test runs under packagetest.
Moved collection of packagetest parameters from shell scripts into maven profiles.
Fixed necessity of test-utils jar by removing incorrect dependenciesToScan element during packagetests.
When building picard libraries, run clean first.
Fixed tools jar dependency in picard pom.
Integration tests properly use the ant-bridge.sh test.debug.port variable, like unit tests.
Story:
https://www.pivotaltracker.com/story/show/65048706https://www.pivotaltracker.com/story/show/65116908
Changes:
ActiveRegionTrimmer in now an argument collection and it returns not only the trimmed down active region but also the non-variant containing flanking regions
HaplotypeCaller code has been simplified significantly pushing some functionality two other classes like ActiveRegion and AssemblyResultSet.
Fixed a problem with the way the trimming was done causing some gVCF non-variant records no have conservative 0,0,0 PLs
1. Throw a user error when the input data for a given genotype does not contain PLs.
2. Add VCF header line for --dbsnp input
3. Need to check that the UG result is not null
4. Don't error out at positions with no gVCFs (which is possible when using a dbSNP rod)
Joel is working on these failures in a separate branch. Since
maven (currently! we're working on this..) won't run the whole
test suite to completion if there's a failure early on, we need
to temporarily disable these tests in order to allow group members
to run tests on their branches again.
Here are the git moved directories in case other files need to be moved during a merge:
git-mv private/java/src/ private/gatk-private/src/main/java/
git-mv private/R/scripts/ private/gatk-private/src/main/resources/
git-mv private/java/test/ private/gatk-private/src/test/java/
git-mv private/testdata/ private/gatk-private/src/test/resources/
git-mv private/scala/qscript/ private/queue-private/src/main/qscripts/
git-mv private/scala/src/ private/queue-private/src/main/scala/
git-mv protected/java/src/ protected/gatk-protected/src/main/java/
git-mv protected/java/test/ protected/gatk-protected/src/test/java/
git-mv public/java/src/ public/gatk-framework/src/main/java/
git-mv public/java/test/ public/gatk-framework/src/test/java/
git-mv public/testdata/ public/gatk-framework/src/test/resources/
git-mv public/scala/qscript/ public/queue-framework/src/main/qscripts/
git-mv public/scala/src/ public/queue-framework/src/main/scala/
git-mv public/scala/test/ public/queue-framework/src/test/scala/
Changes:
-------
<NON_REF> likelihood in variant sites is calculated as the maximum possible likelihood for an unseen alternative allele: for reach read is calculated as the second best likelihood amongst the reported alleles.
When –ERC gVCF, stand_conf_emit and stand_conf_call are forcefully set to 0. Also dontGenotype is set to false for consistency sake.
Integration test MD5 have been changed accordingly.
Additional fix:
--------------
Specially after adding the <NON_REF> allele, but also happened without that, QUAL values tend to go to 0 (very large integer number in log 10) due to underflow when combining GLs (GenotypingEngine.combineGLs). To fix that combineGLs has been substituted by combineGLsPrecise that uses the log-sum-exp trick.
In just a few cases this change results in genotype changes in integration tests but after double-checking using unit-test and difference between combineGLs and combineGLsPrecise in the affected integration test, the previous GT calls were either border-line cases and or due to the underflow.
2. Split into DebugJNILoglessPairHMM and VectorLoglessPairHMM with base
class JNILoglessPairHMM. DebugJNILoglessPairHMM can, in principle,
invoke any other child class of JNILoglessPairHMM.
3. Added more profiling code for Java parts of LoglessPairHMM
Problem:
matchToMatch transition calculation was wrong resulting in transition probabilites coming out of the Match state that added more than 1.
Reports:
https://www.pivotaltracker.com/s/projects/793457/stories/62471780https://www.pivotaltracker.com/s/projects/793457/stories/61082450
Changes:
The transition matrix update code has been moved to a common place in PairHMMModel to dry out its multiple copies.
MatchToMatch transtion calculation has been fixed and implemented in PairHMMModel.
Affected integration test md5 have been updated, there were no differences in GT fields and example differences always implied
small changes in likelihoods that is what is expected.
2. Wrapped _mm_empty() with ifdef SIMD_TYPE_SSE
3. OpenMP disabled
4. Added code for initializing PairHMM's data inside initializePairHMM -
not used yet
SSE compilation warning.
2. Added code to dynamically select between AVX, SSE4.2 and normal C++ (in
that order)
3. Created multiple files to compile with different compilation flags:
avx_function_prototypes.cc is compiled with -xAVX while
sse_function_instantiations.cc is compiled with -xSSE4.2 flag.
4. Added jniClose() and support in Java (HaplotypeCaller,
PairHMMLikelihoodCalculationEngine) to call this function at the end of
the program.
5. Removed debug code, kept assertions and profiling in C++
6. Disabled OpenMP for now.
In unifying the arguments it was clear that the values were inconsistent throughout the code, so now there's a
single value that is intended to be more liberal in what it allows in (in an attempt to increase sensitivity).
Very little code actually changes here, but just about every md5 in the HC integration tests are different (as
expected). Added another integration test for the new argument.
To be used by David R to test his per-branch QC framework: does this commit make the HC look better against the KB?
1. Moved computeLikelihoods from PairHMM to native implementation
2. Disabled debug - debug code still left (hopefully, not part of
bytecode)
3. Added directory PairHMM_JNI in the root which holds the C++
library that contains the PairHMM AVX implementation. See
PairHMM_JNI/JNI_README first
It didn't completely work before (it was hard-coded for a particular long-lost data set) but it should work now.
Since I thought that it might prove useful to others, I moved it to protected and added integration tests.
GERALDINE: NEW TOOL ALERT!
The code comments very clearly state that INFO fields shouldn't be propagated into the output,
but someone must have accidentally changed it afterwards. This is just a simple one-line fix
to make sure the code adhered to the comments.
Delivers #63333488.
-Added docs for ERC mode in HC
-Move RecalibrationPerformance walker since to private since it is experimental and unsupported
-Updated VR docs and restored percentBad/numBad (but @Hidden) to enable deprecation alert if users try to use them
-Improved error msg for conflict between per-interval aggregation and -nt
-Minor clean up in exception docs
-Added Toy Walkers category for devs and dev supercat (to build out docs for developers)
-Added more detailed info to GenotypeConcordance doc based on Chris forum post
-Added system to include min/max argument values in gatkdocs (build gatkdocs with 'ant gatkdocs' to test it, see engine and DoC args for in situ examples)
-Added tentative min/max argument annotations to DepthOfCoverage and CommandLineGATK arguments (and improved docs while at it)
-Added gotoDev annotation to GATKDocumentedFeature to track who is the go-to person in GSA for questions & issues about specific walkers/tools (now discreetly indicated in each gatkdoc)
It is true that indels of length > 1 have higher QUALS than those of length = 1. But for the HC those
QUALS are not that much higher, and it doesn't continue scaling up as the indels get larger. So we no
longer normalize by indel length (which massively over-penalizes larger events and effectively drops their
QD to 0).
For the UG the previous normalization also wasn't perfect. Now we divide the indel length by a factor
of 3 to make sure that QD is consistent over the range of indel lengths.
Integration tests change because QD is different for indels.
Also, got permission from Valentin to archive a failing test that no longer applies.
Thanks to Kurt on the GATK forum for pointing this all out.
To do this I have added a RodBindingCollection which can represent either a VCF or a
file of VCFs. Note that e.g. SelectVariants allows a list of RodBindingCollections so
that one can intermix VCFs and VCF lists.
For VariantContext tags with a list, by default the tags for the -V argument are applied
unless overridden by the individual line. In other words, any given line can have either
one token (the file path) or two tokens (the new tags and the file path). For example:
foo.vcf
VCF,name=bar bar.vcf
Note that a VCF list file name must end with '.list'.
Added this functionality to CombineVariants, CombineReferenceCalculationVariants, and VariantRecalibrator.
-- New -a argument in the VQSR for specifying additional data to be used in the clustering
-- New NA12878KB walker which creates ROC curves by partitioning the data along VQSLOD and calculating how many KB TP/FP's are called.
For example, this tool can be used for processing bowtie RNA-seq data.
Each read with k N-cigar elemments is plit to k+1 reads. The split is done by hard clipping the bases rest of the bases.
In order to do it, few changes were introduced to some other clipping methods:
- make a segnificant change in ClippingOp.hardClip() that prevent the spliting of read with cigar: 1M2I1N1M3I.
- change getReadCoordinateForReferenceCoordinate in ReadUtil to recognize Ns
create unitTests for that walker:
- change ReadClipperTestUtils to be more general in order to use its code and avoid code duplication
- move some useful methods from ReadClipperTestUtils to CigarUtils
create integration test for that class
small change in a comment in FullProcessingPipeline
last commit:
Address review comments:
- move to protected under walkers/rnaseq
- change the read splitting methods to be more readable and more efficiant
- change (minor changes) some methods in ReadClipper to allow the changes in split reads
- add (minor change) one method to CigarUtils to allow the changes in split reads
- change ReadUtils.getReadCoordinateForReferenceCoordinate to include possible N in the cigar
- address the rest of the review comments (minor changes)
- fix ReadUtilsUnitTest.testReadWithNs acoording to the defult behaviour of getReadCoordinateForReferenceCoordinate (in case of refernce index that fall into deletion, return the read index of the base before the deletion).
- add another test to ReadUtilsUnitTest.testReadWithNs
- Allow the user to print the split positions (not working proparly currently)
This is a tool that we use internally validate the ReduceReads development. I think it should be
private. There is no need to improve docs.
[delivers #54703398]
Basically, it does 3 things (as opposed to having to call into 3 separate walkers):
1. merge the records at any given position into a single one with all alleles and appropriate PLs
2. re-genotype the record using the exact AF calculation model
3. re-annotate the record using the VariantAnnotatorEngine
In the course of this work it became clear that we couldn't just use the simpleMerge() method used
by CombineVariants; combining HC-based gVCFs is really a complicated process. So I added a new
utility method to handle this merging and pulled any related code out of CombineVariants. I tried
to clean up a lot of that code, but ultimately that's out of the scope of this project.
Added unit tests for correctness testing.
Integration tests cannot be used yet because the HC doesn't output correct gVCFs.
Renamed it CalculateGenotypePosteriors.
Also, moved the utility code to a proper utility class instead of where Chris left it.
No actual code modifications made in this commit.
In general, test classes cannot use 3rd-party libraries that are not
also dependencies of the GATK proper without causing problems when,
at release time, we test that the GATK jar has been packaged correctly
with all required dependencies.
If a test class needs to use a 3rd-party library that is not a GATK
dependency, write wrapper methods in the GATK utils/* classes, and
invoke those wrapper methods from the test class.
Previously, we would strip out the PLs and AD values since they were no longer accurate. However, this is not ideal because
then that information is just lost and 1) users complain on the forum and post it as a bug and 2) it gives us problems in both
the current and future (single sample) calling pipelines because we subset samples/alleles all the time and lose info.
Now the PLs and AD get correctly selected down.
While I was in there I also refactored some related code in subsetDiploidAlleles(). There were no real changes there - I just
broke it out into smaller chunks as per our best practices.
Added unit tests and updated integration tests.
Addressed reviews.
To active this feature add '--likelihoodCalculationEngine GraphBased' to the HC command line.
New HC Options (both Advanced and Hidden):
==========================================
--likelihoodCalculationEngine PairHMM/GraphBased/Random (default PairHMM)
Specifies what engine should be used to generate read vs haplotype likelihoods.
PairHMM : standard full-PairHMM approach.
GraphBased : using the assembly graph to accelarate the process.
Random : generate random likelihoods - used for benchmarking purposes only.
--heterogeneousKmerSizeResolution COMBO_MIN/COMBO_MAX/MAX_ONLY/MIN_ONLY (default COMBO_MIN)
It idicates how to merge haplotypes produced using different kmerSizes.
Only has effect when used in combination with (--likelihooCalculationEngine GraphBased)
COMBO_MIN : use the smallest kmerSize with all haplotypes.
COMBO_MAX : use the larger kmerSize with all haplotypes.
MIN_ONLY : use the smallest kmerSize with haplotypes assembled using it.
MAX_ONLY : use the larger kmerSize with haplotypes asembled using it.
Major code changes:
===================
* Introduce multiple likelihood calculation engines (before there was just one).
* Assembly results from different kmerSies are now packed together using the AssemblyResultSet class.
* Added yet another PairHMM implementation with a different API in order to spport
local PairHMM calculations, (e.g. a segment of the read vs a segment of the haplotype).
Major components:
================
* FastLoglessPairHMM: New pair-hmm implemtation using some heuristic to speed up partial PairHMM calculations
* GraphBasedLikelihoodCalculationEngine: delegates onto GraphBasedLikelihoodCalculationEngineInstance the exectution
of the graph-based likelihood approach.
* GraphBasedLikelihoodCalculationEngineInstance: one instance per active-region, implements the graph traversals
to calcualte the likelihoods using the graph as an scafold.
* HaplotypeGraph: haplotype threading graph where build from the assembly haplotypes. This structure is the one
used by GraphBasedLikelihoodCalculationEngineInstance to do its work.
* ReadAnchoring and KmerSequenceGraphMap: contain information as how a read map on the HaplotypeGraph that is
used by GraphBasedLikelihoodCalcuationEngineInstance to do its work.
Remove mergeCommonChains from HaplotypeGraph creation
Fixed bamboo issues with HaplotypeGraphUnitTest
Fixed probrems with HaplotypeCallerIntegrationTest
Fixed issue with GraphLikelihoodVsLoglessAccuracyIntegrationTest
Fixed ReadThreadingLikelihoodCalculationEngine issues
Moved event-block iteration outside GraphBased*EngineInstance
Removed unecessary parameter from ReadAnchoring constructor.
Fixed test problem
Added a bit more documentation to EventBlockSearchEngine
Fixing some private - protected dependency issues
Further refactoring making GraphBased*Instance and HaplotypeGraph slimmer. Addressed last pull request commit comments
Fixed FastLoglessPairHMM public -> protected dependency
Fixed probrem with HaplotypeGraph unit test
Adding Graph-based likelihood ratio calculation to HC
To active this feature add '--likelihoodCalculationEngine GraphBased' to the HC command line.
New HC Options (both Advanced and Hidden):
==========================================
--likelihoodCalculationEngine PairHMM/GraphBased/Random (default PairHMM)
Specifies what engine should be used to generate read vs haplotype likelihoods.
PairHMM : standard full-PairHMM approach.
GraphBased : using the assembly graph to accelarate the process.
Random : generate random likelihoods - used for benchmarking purposes only.
--heterogeneousKmerSizeResolution COMBO_MIN/COMBO_MAX/MAX_ONLY/MIN_ONLY (default COMBO_MIN)
It idicates how to merge haplotypes produced using different kmerSizes.
Only has effect when used in combination with (--likelihooCalculationEngine GraphBased)
COMBO_MIN : use the smallest kmerSize with all haplotypes.
COMBO_MAX : use the larger kmerSize with all haplotypes.
MIN_ONLY : use the smallest kmerSize with haplotypes assembled using it.
MAX_ONLY : use the larger kmerSize with haplotypes asembled using it.
Major code changes:
===================
* Introduce multiple likelihood calculation engines (before there was just one).
* Assembly results from different kmerSies are now packed together using the AssemblyResultSet class.
* Added yet another PairHMM implementation with a different API in order to spport
local PairHMM calculations, (e.g. a segment of the read vs a segment of the haplotype).
Major components:
================
* FastLoglessPairHMM: New pair-hmm implemtation using some heuristic to speed up partial PairHMM calculations
* GraphBasedLikelihoodCalculationEngine: delegates onto GraphBasedLikelihoodCalculationEngineInstance the exectution
of the graph-based likelihood approach.
* GraphBasedLikelihoodCalculationEngineInstance: one instance per active-region, implements the graph traversals
to calcualte the likelihoods using the graph as an scafold.
* HaplotypeGraph: haplotype threading graph where build from the assembly haplotypes. This structure is the one
used by GraphBasedLikelihoodCalculationEngineInstance to do its work.
* ReadAnchoring and KmerSequenceGraphMap: contain information as how a read map on the HaplotypeGraph that is
used by GraphBasedLikelihoodCalcuationEngineInstance to do its work.
Remove mergeCommonChains from HaplotypeGraph creation
Fixed bamboo issues with HaplotypeGraphUnitTest
Fixed probrems with HaplotypeCallerIntegrationTest
Fixed issue with GraphLikelihoodVsLoglessAccuracyIntegrationTest
Fixed ReadThreadingLikelihoodCalculationEngine issues
Moved event-block iteration outside GraphBased*EngineInstance
Removed unecessary parameter from ReadAnchoring constructor.
Fixed test problem
Added a bit more documentation to EventBlockSearchEngine
Fixing some private - protected dependency issues
Further refactoring making GraphBased*Instance and HaplotypeGraph slimmer. Addressed last pull request commit comments
Fixed FastLoglessPairHMM public -> protected dependency
Fixed probrem with HaplotypeGraph unit test
-- For very large whole genome datasets with over 2M variants overlapping the training data randomly downsample the training set that gets used to build the Gaussian mixture model.
-- Annotations are ordered by the difference in means between known and novel instead of by their standard deviation.
-- Removed the training set quality score threshold.
-- Now uses 2 gaussians by default for the negative model.
-- Num bad argument has been removed and the cutoffs are now chosen by the model itself by looking at the LOD scores.
-- Model plots are now generated much faster.
-- Stricter threshold for determining model convergence.
-- All VQSR integration tests change because of these changes to the model.
-- Add test for downsampling of training data.
For reads with high MQs (greater than max byte) the MQ was being treated as negative and failing
the min MQ filter.
Added unit test.
Delivers PT#61567540.
His code was excessively clipping reads because it was looking at their cigar string instead of just
the read length. This meant that it was basically impossible to call large deletions in UG even with
perfect evidence in the reads (as reported by Craig D).
Integration tests change because (IMO after looking at sites in IGV) reads with indels similar to the one
being genotyped used to be given too much likelihood and now give less.
Added unit tests for new methods.
CalculatePosteriors enables the user to calculate genotype likelihood posteriors (and set genotypes accordingly) given one or more panels containing allele counts (for instance, calculating NA12878 genotypes based on 1000G EUR frequencies). The uncertainty in allele frequency is modeled by a Dirichlet distribution (parameters being the observed allele counts across each allele), and the genotype state is modeled by assuming independent draws (Hardy-Weinberg Equilibrium). This leads to the Dirichlet-Multinomial distribution.
Currently this is implemented only for ploidy=2. It should be straightforward to generalize. In addition there's a parameter for "EM" that currently does nothing but throw an exception -- another extension of this method is to run an EM over the Maximum A-Posteriori (MAP) allele count in the input sample as follows:
while not converged:
* AC = [external AC] + [sample AC]
* Prior = DirichletMultinomial[AC]
* Posteriors = [sample GL + Prior]
* sample AC = MLEAC(Posteriors)
This is more useful for large callsets with small panels than for small callsets with large panels -- the latter of these being the more common usecase.
Fully unit tested.
Reviewer (Eric) jumped in to address many of his own comments plus removed public->protected dependencies.
There was already a note in the code about how wrong the implementation was.
The bad code was causing a single-node graph to get cleaned up into nothing when pruning tails.
Delivers PT #61069820.
Motivation:
The API was different between the regular PairHMM and the FPGA-implementation
via CnyPairHMM. As a result, the LikelihoodCalculationEngine had
to use account for this. The goal is to change the API to be the same
for all implementations, and make it easier to access.
PairHMM
PairHMM now accepts a list of reads and a map of alleles/haplotpes and returns a PerReadAlleleLikelihoodMap.
Added a new primary method that loops the reads and haplotypes, extracts qualities,
and passes them to the computeReadLikelihoodGivenHaplotypeLog10 method.
Did not alter that method, or its subcompute method, at all.
PairHMM also now handles its own (re)initialization, so users don't have to worry about that.
CnyPairHMM
Added that same new primary access method to this FPGA class.
Method overrides the default implementation in PairHMM. Walks through a list of reads.
Individual-read quals and the full haplotype list are fed to batchAdd(), as before.
However, instead of waiting for every read to get added, and then walking through the reads
again to extract results, we just get the haplotype-results array for each read as soon as it
is generated, and pack it into a perReadAlleleLikelihoodMap for return.
The main access method is now the same no matter whether the FPGA CnyPairHMM is used or not.
LikelihoodCalculationEngine
The functionality to loop through the reads and haplotypes and get individual log10-likelihoods
was moved to the PairHMM, and so removed from here. However, this class does need to retain
the ability to pre-process the reads, and post-process the resulting likelihoods map.
Those features were separated from running the HMM and refactored into their own methods
Commented out the (unused) system for finding best N haplotypes for genotyping.
PairHMMIndelErrorModel
Similar changes were made as to the LCE. However, in this case the haplotypes are modified
based on each individual read, so the read-list we feed into the HMM only has one read.
-- We use the RegenotypeVariants walker to recompute the qual field. (instead of the discussed idea of adding this functionality to CombineVariants)
-- QualByDepth will now be recomputed even if the stratified contexts are missing. This greatly improves the QD estimate for this pipeline. Doesn't work for multi-allelics since the qual can't be recomputed.
Making the usage more clear since the parameter is being used over and over to define baited
regions. Updated the headers accordingly and made it more readable.
Quick fix the missing column header in the QualifyMissingIntervals
report.
Adding a QScript for the tool as well as a few minor updates to the
GATKReportGatherer.
* add a length of the overlaping interval metric as per CSER request
* standardized the distance metrics to be positive when fully overlapping and the longest off-target tail (as a negative number) when not overlapping
* add gatkdocs to the tool (finally!)
* add a new column to do what I have been doing manually for every project, understand why we got no usable coverage in that interval
* add unit tests -- this tool is now public, we need tests.
* slightly better docs -- in an effort to produce better docs for this tool
most people don't care about excessive coverage (unless you're very
particular about your analysis). Therefore the best possible default
value for this is Integer.maxValue so it doesn't get in the way.
Itemized Changes:
* change maximumCoverage threshold to Integer.maxValue
[delivers #57353620]
-- Adding changes to CombineVariants to work with the Reference Model mode of the HaplotypeCaller.
-- Added -combineAnnotations mode to CombineVariants to merge the info field annotations by taking the median
-- Added new StrandBiasBySample genotype annotation for use in computing strand bias from single sample input vcfs
-- Bug fixes to calcGenotypeLikelihoodsOfRefVsAny, used in isActive() as well as the reference model
-- Added active region trimming capabilities to the reference model mode, not perfect yet, turn off with --dontTrimActiveRegions
-- We only realign reads in the reference model if there are non-reference haplotypes, a big time savings
-- We only realign reads in the reference model if the read is informative for a particular haplotype over another
-- GVCF blocks will now track and output the minimum PLs over the block
-- MD5 changes!
-- HC tests: from bug fixes in calcGenotypeLikelihoodsOfRefVsAny
-- GVCF tests: from HC changes above and adding in active region trimming
PairHMMSyntheticBenchmark and PairHMMEmpirical benchmark were written to test the banded pairHMM, and were archived along with it. I returned them to the test directory for use in benchmarking the ArrayLoglessPairHMM. I commented out references to the banded pairHMM (which was left in archive), rather than removing those references entirely.
Renamed PairHMMEmpiricalBenchmark to PairHMMBandedEmpiricalBenchmark and returned it to the archive. It has a few problems for use as a general benchmark, including initializing the HMM too frequently and doing too much setup work in the 'time' method. However, since the size selection and debug printing are useful for testing the banded implementation, I decided to keep it as-is and archive it alongside with the other banded pairHMM classes. I did fix one bug that was causing the selectWorkingData function to return prematurely. As a result, the benchmark was only evaluating 4-40 pairHMM calls instead of the desired "maxRecords".
I wrote a new PairHMMEmpiricalBenchmark that simply works through a list of data, with setup work and hmm-initialization moved to its own function. This involved writing a new data read-in function in PairHMMTestData. The original was not maintaining the input data in order, the end result of which would be an over-estimate of how much caching we are able to do. The new benchmark class more closely mirrors real-world operation over large data.
It might be cleaner to fix some of the issues with the BandedEmpiricalBenchmark and use one read-in function. However, this would involve more extensive changes to:
PairHMMBandedEmpiricalBenchmark
PairHMMTestData
BandedLoglessPairHMMUnitTest
I decided against this as the banded benchmark and unit test are archived.
Returned Logless Caching implementation to the default in all cases. Changing to the array version will await performance benchmarking
Refactored many pieces of functionality in ArrayLoglessPairHMM into their own methods.
A new PairHMM implementation for read/haplotype likelihood calculations. Output is the same as the LOGLESS_CACHING version.
Instead of allocating an entire (read x haplotype) matrix for each HMM state, this version stores sub-computations in 1D arrays. It also accesses intersections of the (read x haplotype) alignment in a different order, proceeding over "diagonals" if we think of the alignment as a matrix.
This implementation makes use of haplotype caching. Because arrays are overwritten, it has to explicitly store mid-process information. Knowing where to capture this info requires us to look ahead at the subsequent haplotype to be analyzed. This necessitated a signature change in the primary method for all pairHMM implementations.
We also had to adjust the classes that employ the pairHMM:
LikelihoodCalculationEngine (used by HaplotypeCaller)
PairHMMIndelErrorModel (used by indel genotyping classes)
Made the array version the default in the HaplotypeCaller and the UnifiedArgumentCollection.
The latter affects classes:
ErrorModel
GeneralPloidyIndelGenotypeLikelihoodsCalculationModel
IndelGenotypeLikelihoodsCalculationModel
... all of which use the pairHMM via PairHMMIndelErrorModel
-This was a dependency of the test suite, but not the GATK proper,
which caused problems when running the test suite on the packaged
GATK jar at release time
-Use GATKVCFUtils.readVCF() instead
* Refactoring implementations of readHeader(LineReader) -> readActualHeader(LineIterator), including nullary implementations where applicable.
* Galvanizing fo generic types.
* Test fixups, mostly to pass around LineIterators instead of LineReaders.
* New rev of tribble, which incorporates a fix that addresses a problem with TribbleIndexedFeatureReader reading a header twice in some instances.
* New rev of sam, to make AbstractIterator visible (was moved from picard -> sam in Tribble API refactor).
There is now a command-line option to set the model to use in the HC.
Incorporated Ryan's current (unmerged) branch in for most of these changes.
Because small changes to the math can have drastic effects, I decided not to let users tweak
the calculations themselves. Instead they can select either NONE, CONSERVATIVE (the default),
or AGGRESSIVE.
Note that any base insertion/deletion qualities from BQSR are still used.
Also, note that the repeat unit x repeat length approach gave very poor results against the KB,
so it is not included as an option here.
- Make -rod required
- Document that contaminationFile is currently not functional with HC
- Document liftover process more clearly
- Document VariantEval combinations of ST and VE that are incompatible
- Added a caveat about using MVLR from HC and UG.
- Added caveat about not using -mte with -nt
- Clarified masking options
- Fixed docs based on Erics comments
-- When provided, this argument causes us to only emit the selected samples into the VCF. No INFO field annotations (AC for example) or other features are modified. It's current primary use is for efficiently evaluating joint calling.
-- Add integration test for onlyEmitSamples
-- The previous approach in VQSR was to build a GMM with the same max. number of Gaussians for the positive and negative models. However, we usually have many more positive sites than negative, so we'd prefer to use a more detailed GMM for the positive model and a less well defined model using few sites for the negative model.
-- Now the maxGaussians argument only applies to the positive model
-- This update builds a GMM for the negative model with a default 4 max gaussians (though this can be controlled via command line parameter)
-- Removes the percentBadVariants argument. The only way to control how many variants are included in the negative model is with minNumBad
-- Reduced the minNumBad argument default to 1000 from 2500
-- Update MD5s for VQSR. md5s changed significantly due to underlying changes in the default GMM model. Only sites with NEGATIVE_TRAINING_LABELs and the resulting VQSLOD are different, as expected.
-- minNumBad is now numBad
-- Plot all negative training points as well, since this significantly changes our view of the GMM PDF
-- In the case where there's some variation to assembly and evaluate but the resulting haplotypes don't result in any called variants, the reference model would exception out with "java.lang.IllegalArgumentException: calledHaplotypes must contain the refHaplotype". Now we detect this case and emit the standard no variation output.
-- [delivers #54625060]
Problem
-------
Caching strategy is incompatible with the current sorting of the haplotypes, and is rendering the cache nearly useless.
Before the PairHMM updates, we realized that a lexicographically sorted list of haplotypes would optimize the use of the cache. This was only true until we've added the initial condition to the first row of the deletion matrix, which depends on the length of the haplotype. Because of that, every time the haplotypes differ in length, the cache has to be wiped. A lexicographic sorting of the haplotypes will put different lengths haplotypes clustered together therefore wasting *tons* of re-compute.
Solution
-------
Very simple. Sort the haplotypes by LENGTH and then in lexicographic order.
1. Removing old legacy code that was capping the positional depth for reduced reads to 127.
Unfortunately this cap affectively performs biased down-sampling and throws off e.g. FS numbers.
Added end to end unit test that depth counts in RR can be higher than max byte.
Some md5s change in the RR tests because depths are now (correctly) no longer capped at 127.
2. Down-sampling in ReduceReads was not safe as it could remove het compressed consensus reads.
Refactored it so that it can only remove non-consensus reads.
Now only filtered reads are unstranded. All consensus reads have strand, so that we
emit 2 consensus reads in general now: one for each strand.
This involved some refactoring of the sliding window which cleaned it up a lot.
Also included is a bug fix:
insertions downstream of a variant region weren't triggering a stop to the compression.
So, compromise solution is to go back to having biallelic PLs but emit a new FORMAT field, called APL, which has the 10 values, but all other statistics and regular PLs are computed as before.
Note that integration test had to be disabled, as the BCF2 codec apparently doesn't support writing into genotype fields other than PL,DP,AD,GQ,FT and GT.
Problem
-------
Qualify Missing Intervals only accepted GATK formatted interval files for it's coding sequence and bait parameters.
Solution
-------
There is no reason for such limitation, I erased all the code that did the parsing and used IntervalUtils to parse it (therefore, now it handles any type of interval file that the GATK can handle).
ps: Also added an average depth column to the output
- Added integration test to show that providing a contamination value and providing same value via a file results in the same VCF
- overrode default contamination value in test
1. Some minor refactorings and claenup (e.g. removing unused imports) throughout.
2. Updates to the KB assessment functionality:
a. Exclude duplicate reads when checking to see whether there's enough coverage to make a call.
b. Lower the threshold on FS for FPs that would easily be filtered since it's only single sample calling.
3. Make the HC consistent in how it treats the pruning factor. As part of this I removed and archived
the DeBruijn assembler.
4. Improvements to the likelihoods for the HC
a. We now include a "tristate" correction in the PairHMM (just like we do with UG). Basically, we need
to divide e by 3 because the observed base could have come from any of the non-observed alleles.
b. We now correct overlapping read pairs. Note that the fragments are not merged (which we know is
dangerous). Rather, the overlapping bases are just down-weighted so that their quals are not more
than Q20 (or more specifically, half of the phred-scaled PCR error rate); mismatching bases are
turned into Q0s for now.
c. We no longer run contamination removal by default in the UG or HC. The exome tends to have real
sites with off kilter allele balances and we occasionally lose them to contamination removal.
5. Improved the dangling tail merging implementation.
-- Assembly graph building now returns an object that describes whether the graph was successfully built and has variation, was succesfully built but didn't have variation, or truly failed in construction. Fixing an annoying bug where you'd prefectly assembly the sequence into the reference graph, but then return a null graph because of this, and you'd increase your kmer because it null was also used to indicate assembly failure
--
-- Output format looks like:
20 10026072 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,120
20 10026073 . A <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,119
20 10026074 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,121
20 10026075 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,119
20 10026076 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,120
20 10026077 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:3,0:3:9:0,9,120
20 10026078 . C <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:5,0:5:15:0,15,217
20 10026079 . A <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:6,0:6:18:0,18,240
20 10026080 . G <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:6,0:6:18:0,18,268
20 10026081 . T <NON_REF> . . . GT:AD:DP:GQ:PL 0/0:7,0:7:21:0,21,267
We use a symbolic allele to indicate that the site is hom-ref, and because we have an ALT allele we can provide AD and PL field values. Currently these are calculated as ref vs. any non-ref value (mismatch or insertion) but doesn't yet account properly for alignment uncertainty.
-- Can we enabled for single samples with --emitRefConfidence (-ERC).
-- This is accomplished by realigning the each read to its most likley haplotype, and then evaluting the resulting pileups over the active region interval. The realignment is done by the HaplotypeBAMWriter, which now has a generalized interface that lets us provide a ReadDestination object so we can capture the realigned reads
-- Provide access to the more raw LocusIteratorByState constructor so we can more easily make them programmatically without constructing lots of misc. GATK data structures. Moved the NO_DOWNSAMPLING constant from LIBSDownsamplingInfo to LocusIteratorByState so clients can use it without making LIBSDownsamplingInfo a public class.
-- Includes GVCF writer
-- Add 1 mb of WEx data to private/testdata
-- Integration tests for reference model output for WGS and WEx data
-- Emit GQ block information into VCF header for GVCF mode
-- OutputMode from StandardCallerArgumentCollection moved to UnifiedArgumentCollection as its no longer relevant for HC
-- Control max indel size for the reference confidence model from the command line. Increase default to 10
-- Don't use out_mode in HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest
-- Unittests for ReferenceConfidenceModel
-- Unittests for new MathUtils functions
-- The previous code would adapter clip before reverting soft clips, so because we only clip the adapter when it's actually aligned (i.e., not in the soft clips) we were actually not removing bases in the adapter unless at least 1 bp of the adapter was aligned to the reference. Terrible.
-- Removed the broken logic of determining whether a read adaptor is too long.
-- Doesn't require isProperPairFlag to be set for a read to be adapter clipped
-- Update integration tests for new adapter clipping code
I "fixed" this once before but instead of testing with unit tests I used integration tests.
Bad decision.
The proper fix is in now, with a bonafide unit test included.
Previous fixes and tests only covered trailing soft-clips. Now that up front
hard-clipping is working properly though, we were failing on those in the tool.
Added a patch for this as well as a separate test independent of the soft-clips
to make sure that it's working properly.
This time we don't accidentally drop reads (phew), but this bug does cause us not to
update the alignment start of the mate. Fixed and added unit test to cover it.
-- Added experimental LikelihoodRankSum, which required slightly more detailed access to the information managed by the base class, so added an overloaded getElementForRead also provides access to the MostLikelyAllele class
-- Added base class default implementation of getElementForPileupElement() which returns null, indicating that the pileup version isn't supported.
-- Added @Override to many of the RankSum classes for safety's sake
-- Updates to GeneralCallingPipeline: annotate sites with dbSNP IDs,
-- R script to assess the value of annotations for VQSR
-- The VR, when the model is bad, may evaluate log10sumlog10 where some of the values in the vector are NaN. This case is now trapped in VR and handled as previously -- indicating that the model has failed and evaluation continues.
-- Currently we don't support writing a BAM file from the haplotype caller when nct is enabled. Check in initialize if this is the case, and throw a UserException
-- Previous version emitted command lines that look like:
##HaplotypeCaller="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] ..."
the new version provides additional information on when the GATK was run and the GATK version in a nicer format:
##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="analysis_type=HaplotypeCaller input_file=[private/testdata/reduced.readNotFullySpanningDeletion.bam] read_buffer_size=null phone_home=AWS ...">
-- Additionally, the command line options are emitted sequentially in the file, so you can see a running record of how a VCF was produced, such as this example from the integration test:
##GATKCommandLine=<ID=HaplotypeCaller,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:09:01 EDT 2013",Epoch=1371740941197,CommandLineOptions="lots of stuff">
##GATKCommandLine=<ID=SelectVariants,Version=2.5-206-gbc7be2b,Date="Thu Jun 20 11:16:23 EDT 2013",Epoch=1371741383277,CommandLineOptions="lots of stuff">
-- Removed the ProtectedEngineFeaturesIntegrationTest
-- Actual unit tests for these features!
Improved AnalyzeCovariates (AC) integration test.
Renamed AC test files ending with .grp to .table
Implementation:
* Removed RECAL_PDF/CSV_FILE from RecalibrationArgumentCollection (RAC). Updated rest of the code accordingly.
* Fixed BQSRIntegrationTest to work with new changes
Implemtation details:
* Added tool class *.AnalyzeCovariates
* Added convenient addAll method to Utils to be able to add elements of an array.
* Added parameter comparison methods to RecalibrationArgumentCollection class in order to verify that multiple imput recalibration report are compatible and comparable.
* Modified the BQSR.R script to handle up to 3 different recalibration tables (-BQSR, -before and -after) and removed some irrelevant arguments (or argument values) from the output.
* Added an integration test class.
-- Changed default HMM model.
-- Removed check.
-- Changed md5's: PL's in the high 100s change by a point or two due to new implementation.
-- Resulting performance improvement is about 30 to 50% less runtime when using -glm INDEL.
-- numPruningSamples allows one to specify that the minPruning factor must be met by this many samples for a path to be considered good (e.g. seen twice in three samples). By default this is just one sample.
-- adding unit test to test this new functionality
-- When doing cross-species comparisons and studying population history and ancient DNA data, having SOME measure of confidence is needed at every single site that doesn't depend on the reference base, even in a naive per-site SNP mode. Old versions of GATK provided GQ and some wrong PL values at reference sites but these were wrong. This commit addresses this need by adding a new UG command line argument, -allSitePLs, that, if enabled will:
a) Emit all 3 ALT snp alleles in the ALT column.
b) Emit all corresponding 10 PL values.
It's up to the user to process these PL values downstream to make sense of these. Note that, in order to follow VCF spec, the QUAL field in a reference call when there are non-null ALT alleles present will be zero, so QUAL will be useless and filtering will need to be done based on other fields.
-- Tweaks and fixes to processing pipelines for Reich lab.
1. Have the RMSMappingQuality annotation take into account the fact that reduced reads represent multiple reads.
2. The rank sume tests should not be using reduced reads (because they do not represent distinct observations).
3. Fixed a massive bug in the BaseQualityRankSumTest annotation! It was not using the base qualities but rather
the read likelihoods?!
Added a unit test for Rank Sum Tests to prove that the distributions are correctly getting assigned appropriate p-values.
Also, and just as importantly, the test shows that using reduced reads in the rank sum tests skews the results and
makes insignificant distributions look significant (so it can falsely cause the filtering of good sites).
Also included in this commit is a massive refactor of the RankSumTest class as requested by the reviewer.
-- Previous version created FILTERs for each possible alt allele when that site was set to monomorphic by BEAGLE. So if you had a A/C SNP in the original file and beagle thought it was AC=0, then you'd get a record with BGL_RM_WAS_A in the FILTER field. This obviously would cause problems for indels, as so the tool was blowing up in this case. Now beagle sets the filter field to BGL_SET_TO_MONOMORPHIC and sets the info field annotation OriginalAltAllele to A instead. This works in general with any type of allele.
-- Here's an example output line from the previous and current versions:
old: 20 64150 rs7274499 C . 3041.68 BGL_RM_WAS_A AN=566;DB;DP=1069;Dels=0.00;HRun=0;HaplotypeScore=238.33;LOD=3.5783;MQ=83.74;MQ0=0;NumGenotypesChanged=1;OQ=1949.35;QD=10.95;SB=-6918.88
new: 20 64062 . G . 100.39 BGL_SET_TO_MONOMORPHIC AN=566;DP=1108;Dels=0.00;HRun=2;HaplotypeScore=221.59;LOD=-0.5051;MQ=85.69;MQ0=0;NumGenotypesChanged=1;OQ=189.66;OriginalAltAllele=A;QD=15.81;SB=-6087.15
-- update MD5s to reflect these changes
-- [delivers #50847721]
-- Now table looks like:
Name VariantType AssessmentType Count
variant SNPS TRUE_POSITIVE 1220
variant SNPS FALSE_POSITIVE 0
variant SNPS FALSE_NEGATIVE 1
variant SNPS TRUE_NEGATIVE 150
variant SNPS CALLED_NOT_IN_DB_AT_ALL 0
variant SNPS HET_CONCORDANCE 100.00
variant SNPS HOMVAR_CONCORDANCE 99.63
variant INDELS TRUE_POSITIVE 273
variant INDELS FALSE_POSITIVE 0
variant INDELS FALSE_NEGATIVE 15
variant INDELS TRUE_NEGATIVE 79
variant INDELS CALLED_NOT_IN_DB_AT_ALL 2
variant INDELS HET_CONCORDANCE 98.67
variant INDELS HOMVAR_CONCORDANCE 89.58
-- Rewrite / refactored parts of subsetDiploidAlleles in GATKVariantContextUtils to have a BEST_MATCH assignment method that does it's best to simply match the genotype after subsetting to a set of alleles. So if the original GT was A/B and you subset to A/B it remains A/B but if you subset to A/C you get A/A. This means that het-alt B/C genotypes become A/B and A/C when subsetting to bi-allelics which is the convention in the KB. Add lots of unit tests for this functions (from 0 previously)
-- BadSites in Assessment now emits TP sites with discordant genotypes with the type GENOTYPE_DISCORDANCE and tags the expected genotype in the info field as ExpectedGenotype, such as this record:
20 10769255 . A ATGTG 165.73 . ExpectedGenotype=HOM_VAR;SupportingCallsets=ebanks,depristo,CEUTrio_best_practices;WHY=GENOTYPE_DISCORDANCE GT:AD:DP:GQ:PL 0/1:1,9:10:6:360,0,6
Indicating that the call was a HET but the expected result was HOM_VAR
-- Forbid subsetting of diploid genotypes to just a single allele.
-- Added subsetToRef as a separate specific function. Use that in the DiploidExactAFCalc in the case that you need to reduce yourself to ref only. Preserves DP in the genotype field when this is possible, so a few integration tests have changed for the UG
-- Merging overlapping fragments turns out to be a bad idea. In the case where you can safely merge the reads you only gain a small about of overlapping kmers, so the potential gains are relatively small. That's in contrast to the very large danger of merging reads inappropriately, such as when the reads only overlap in a repetitive region, and you artificially construct reads that look like the reference but actually may carry a larger true insertion w.r.t. the reference. Because this problem isn't limited to repetitive sequeuence, but in principle could occur in any sequence, it's just not safe to do this merging. Best to leave haplotype construction to the assembly graph.
We now run Smith-Waterman on the dangling tail against the corresponding reference tail.
If we can generate a reasonable, low entropy alignment then we trigger the merge to the
reference path; otherwise we abort. Also, we put in a check for low-complexity of graphs
and don't let those pass through.
Added tests for this implementation that checks exact SW results and correct edges added.
Principle is simple: when coverage is deep enough, any single-base read error will look like a rare k-mer but correct sequence will be supported by many reads to correct sequences will look like common k-mers. So, algorithm has 3 main steps:
1. K-mer graph buildup.
For each read in an active region, a map from k-mers to the number of times they have been seen is built.
2. Building correction map.
All "rare" k-mers that are sparse (by default, seen only once), get mapped to k-mers that are good (by default, seen at least 20 times but this is a CL argument), and that lie within a given Hamming distance (by default, =1). This map can be empty (i.e. k-mers can be uncorrectable).
3. Correction proposal
For each constituent k-mer of each read, if this k-mer is rare and maps to a good k-mer, get differing base positions in k-mer and add these to a list of corrections for each base in each read. Then, correct read at positions where correction proposal is unanimous and non-empty.
The algorithm defaults are chosen to be very stringent and conservative in the correction: we only try to correct singleton k-mers, we only look for good k-mers lying at Hamming distance = 1 from them, and we only correct a base in read if all correction proposals are congruent.
By default, algorithm is disabled but can be enabled in HaplotypeCaller via the -readErrorCorrect CL option. However, at this point it's about 3x-10x more expensive so it needs to be optimized if it's to be used.
Ns are treated as wildcards in the PairHMM so creating haplotypes with Ns gives them artificial advantages over other ones.
This was the cause of at least one FN where there were Ns at a SNP position.
Problem:
The sequence graphs can get very complex and it's not enough just to test that any given read has non-unique kmers.
Reads with variants can have kmers that match unique regions of the reference, and this causes cycles in the final
sequence graph. Ultimately the problem is that kmers of 10/25 may not be large enough for these complex regions.
Solution:
We continue to try kmers of 10/25 but detect whether cycles exist; if so, we do not use them. If (and only if) we
can't get usable graphs from the 10/25 kmers, then we start iterating over larger kmers until we either can generate
a graph without cycles or attempt too many iterations.
-- Reuse infrastructure for RODs for reads to implement general IntervalReferenceOrderedView so that both TraverseReads and TraverseActiveRegions can use the same underlying infrastructure
-- TraverseActiveRegions now provides a meaningful RefMetaDataTracker to ActiveRegionWalker.map
-- Cleanup misc. code as it came up
-- Resolves GSA-808: Write general utility code to do rsID allele matching, hook up to UG and HC
-- Variants will be considered matching if they have the same reference allele and at least 1 common alternative allele. This matching algorithm determines how rsID are added back into the VariantContext we want to annotate, and as well determining the overlap FLAG attribute field.
-- Updated VariantAnnotator and VariantsToVCF to use this class, removing its old stale implementation
-- Added unit tests for this VariantOverlapAnnotator class
-- Removed GATKVCFUtils.rsIDOfFirstRealVariant as this is now better to use VariantOverlapAnnotator
-- Now requires strict allele matching, without any option to just use site annotation.
The previous behavior is to process reads with N CIGAR operators as they are despite that many of the tools do not actually support such operator and results become unpredictible.
Now if the there is some read with the N operator, the engine returns a user exception. The error message indicates what is the problem (including the offending read and mapping position) and give a couple of alternatives that the user can take in order to move forward:
a) ask for those reads to be filtered out (with --filter_reads_with_N_cigar or -filterRNC)
b) keep them in as before (with -U ALLOW_N_CIGAR_READS or -U ALL)
Notice that (b) does not have any effect if (a) is enacted; i.e. filtering overrides ignoring.
Implementation:
* Added filterReadsWithMCigar argument to MalformedReadFilter with the corresponding changes in the code to get it to work.
* Added ALLOW_N_CIGAR_READS unsafe flag so that N cigar containing reads can be processed as they are if that is what the user wants.
* Added ReadFilterTest class commont parent for ReadFilter test cases.
* Refactor ReadGroupBlackListFilterUnitTest to extend ReadFilterTest and push up some functionality to that class.
* Modified MalformedReadFilterUnitTest to extend ReadFilterTest and to test the new filter functionality.
* Added AllowNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALLOW_N_CIGAR_READS flag is used.
* Added UnsafeNCigarMalformedReadFilterUnittest to check on the behavior when the unsafe ALL flag is used.
* Updated a broken test case in UnifiedGenotyperIntegrationTest resulting from the new behavior.
* Updated EngineFeaturesIntegrationTest testdata to be compliant with new behavior
- Memoized MathUtil's cumulative binomial probability function.
- Reduced the default size of the read name map in reduced reads and handle its resets more efficiently.
-- Created a new annotation DepthPerSampleHC that is by default on in the HaplotypeCaller
-- The depth for the HC is the sum of the informative alleles at this site. It's not perfect (as we cannot differentiate between reads that align over the event but aren't informative vs. those that aren't even close) but it's a pretty good proxy and it matches with the AD field (i.e., sum(AD) = DP).
-- Update MD5s
-- delivers [#48240601]
-- In the case where we have multiple potential alternative alleles *and* we weren't calling all of them (so that n potential values < n called) we could end up trimming the alleles down which would result in the mismatch between the PerReadAlleleLikelihoodMap alleles and the VariantContext trimmed alleles.
-- Fixed by doing two things (1) moving the trimming code after the annotation call and (2) updating AD annotation to check that the alleles in the VariantContext and the PerReadAlleleLikelihoodMap are concordant, which will stop us from degenerating in the future.
-- delivers [#50897077]
-- Ultimately this was caused by overly aggressive merging of CommonSuffixMerger. In the case where you have this graph:
ACT [ref source] -> C
G -> ACT -> C
we would merge into
G -> ACT -> C
which would linearlize into
GACTC
Causing us to add bases to the reference source node that couldn't be recovered. The solution was to ensure that CommonSuffixMerger only operates when all nodes to be merged aren't source nodes themselves.
-- Added a convenient argument to the haplotype caller (captureAssemblyFailureBAM) that will write out the exact reads to a BAM file that went into a failed assembly run (going to a file called AssemblyFailure.BAM). This can be used to rerun the haplotype caller to produce the exact error, which can be hard in regions of deep coverage where the downsampler state determines the exact reads going into assembly and therefore makes running with a sub-interval not reproduce the error
-- Did some misc. cleanup of code while debugging
-- [delivers #50917729]
-- Ultimately this was caused by an underlying bug in the reverting of soft clipped bases in the read clipper. The read clipper would fail to properly set the alignment start for reads that were 100% clipped before reverting, such as 10H2S5H => 10H2M5H. This has been fixed and unit tested.
-- Update 1 ReduceReads MD5, which was due to cases where we were clipping away all of the MATCH part of the read, leaving a cigar like 50H11S and the revert soft clips was failing to properly revert the bases.
-- delivers #50655421
-- The previous implementation attempted to be robust to this, but not all cases were handled properly. Added a helper function updateInde() that bounds up the update to be in the range of the indel array, and cleaned up logic of how the method works. The previous behavior was inconsistent across read fwd/rev stand, so that the indel cigars at the end of read were put at the start of reads if the reads were in the forward strand but not if they were in the reverse strand. Everything is now consistent, as can be seen in the symmetry of the unit tests:
tests.add(new Object[]{"1D3M", false, EventType.BASE_DELETION, new int[]{0,0,0}});
tests.add(new Object[]{"1M1D2M", false, EventType.BASE_DELETION, new int[]{1,0,0}});
tests.add(new Object[]{"2M1D1M", false, EventType.BASE_DELETION, new int[]{0,1,0}});
tests.add(new Object[]{"3M1D", false, EventType.BASE_DELETION, new int[]{0,0,1}});
tests.add(new Object[]{"1D3M", true, EventType.BASE_DELETION, new int[]{1,0,0}});
tests.add(new Object[]{"1M1D2M", true, EventType.BASE_DELETION, new int[]{0,1,0}});
tests.add(new Object[]{"2M1D1M", true, EventType.BASE_DELETION, new int[]{0,0,1}});
tests.add(new Object[]{"3M1D", true, EventType.BASE_DELETION, new int[]{0,0,0}});
tests.add(new Object[]{"4M1I", false, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
tests.add(new Object[]{"3M1I1M", false, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
tests.add(new Object[]{"2M1I2M", false, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});
tests.add(new Object[]{"1M1I3M", false, EventType.BASE_INSERTION, new int[]{1,0,0,0,0}});
tests.add(new Object[]{"1I4M", false, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});
tests.add(new Object[]{"4M1I", true, EventType.BASE_INSERTION, new int[]{0,0,0,0,0}});
tests.add(new Object[]{"3M1I1M", true, EventType.BASE_INSERTION, new int[]{0,0,0,0,1}});
tests.add(new Object[]{"2M1I2M", true, EventType.BASE_INSERTION, new int[]{0,0,0,1,0}});
tests.add(new Object[]{"1M1I3M", true, EventType.BASE_INSERTION, new int[]{0,0,1,0,0}});
tests.add(new Object[]{"1I4M", true, EventType.BASE_INSERTION, new int[]{0,1,0,0,0}});
-- delivers #50445353
-- We now inject the given alleles into the reference haplotype and add them to the graph.
-- Those paths are read off of the graph and then evaluated with the appropriate marginalization for GGA mode.
-- This unifies how Smith-Waterman is performed between discovery and GGA modes.
-- Misc minor cleanup in several places.
The problem ultimately was that ReadUtils.readStartsWithInsertion() ignores leading hard/softclips, but
ReduceReads does not. So I refactored that method to include a boolean argument as to whether or not
clips should be ignored. Also rebased so that return type is no longer a Pair.
Added unit test to cover this situation.
-Throw a UserException if a Locus or ActiveRegion walker is run with -dcov < 200,
since low dcov values can result in problematic downsampling artifacts for locus-based
traversals.
-Read-based traversals continue to have no minimum for -dcov, since dcov for read traversals
controls the number of reads per alignment start position, and even a dcov value of 1 might
be safe/desirable in some circumstances.
-Also reorganize the global downsampling defaults so that they are specified as annotations
to the Walker, LocusWalker, and ActiveRegionWalker classes rather than as constants in the
DownsamplingMethod class.
-The default downsampling settings have not been changed: they are still -dcov 1000
for Locus and ActiveRegion walkers, and -dt NONE for all other walkers.
-- Started by Mark. Finished up by Ryan.
-- GGA mode still respected glm argument for SNP and INDEL models, so that you would silently fail to genotype indels at all if the -glm INDEL wasn't provided, but you'd still emit the sites, so you'd see records in the VCF but all alleles would be no calls.
-- https://www.pivotaltracker.com/story/show/48924339 for more information
-- [resolves#48924339]
Problem
--------
Diagnose Targets is outputting missing intervals to stdout if the argument -missing is not provided
Solution
--------
Make it NOT default to stdout
[Delivers #50386741]
BandedHMM
---------
-- An implementation of a linear runtime, linear memory usage banded logless PairHMM. Thought about 50% faster than current PairHMM, this implementation will be superceded by the GraphHMM when it becomes available. The implementation is being archived for future reference
Useful infrastructure changes
-----------------------------
-- Split PairHMM into a N2MemoryPairHMM that allows smarter implementation to not allocate the double[][] matrices if they don't want, which was previously occurring in the base class PairHMM
-- Added functionality (controlled by private static boolean) to write out likelihood call information to a file from inside of LikelihoodCalculationEngine for using in unit or performance testing. Added example of 100kb of data to private/testdata. Can be easily read in with the PairHMMTestData class.
-- PairHMM now tracks the number of possible cell evaluations, and the LoglessCachingPairHMM updates the nCellsEvaluated so we can see how many cells are saved by the caching calculation.
-- Previous version took a Collection<GATKSAMRecord> to remove, and called ArrayList.removeAll() on this collection to remove reads from the ActiveRegion. This can be very slow when there are lots of reads, as ArrayList.removeAll ultimately calls indexOf() that searches through the list calling equals() on each element. New version takes a set, and uses an iterator on the list to remove() from the iterator any read that is in the set. Given that we were already iterating over the list of reads to update the read span, this algorithm is actually simpler and faster than the previous one.
-- Update HaplotypeCaller filterReadsInRegion to use a Set not a List.
-- Expanded the unit tests a bit for ActiveRegion.removeAll
-- [Delivers #49876703]
-- Add integration test and test file
-- Update SymbolicAlleles combine variant tests, which was turning unfiltered records into PASS!
Bug fixes and missing interval functionality for Diagnose Targets
While the code seems fine, the complex parts of it are untested. This is probably fine for now, but private code can have a tendency to creep into the codebase once accepted. I would have preferred that unit test OR a big comment stating that the code is untested (and thus broken by Mark's rule).
It is with these cavets that I accept the pull request.
Problem
------
Diagnose Targets identifies holes in the coverage of a targetted experiment, but it only reports them doesn't list the actual missing loci
Solution
------
This commit implements an optional intervals file output listing the exact loci that did not pass filters
Itemized changes
--------------
* Cache callable statuses (to avoid recalculation)
* Add functionality to output missing intervals
* Implement new tool to qualify the missing intervals (QualifyMissingIntervals) by gc content, size, type of missing coverage and origin (coding sequence, intron, ...)
Problem
-------
When the interval had no reads, it was being sent to the VCF before the intervals that just got processed, therefore violating the sort order of the VCF.
Solution
--------
Use a linked hash map, and make the insertion and removal all happen in one place regardless of having reads or not. Since the input is ordered, the output has to be ordered as well.
Itemized changes
--------------
* Clean up code duplication in LocusStratification and SampleStratification
* Add number of uncovered sites and number of low covered sites to the VCF output.
* Add new VCF format fields
* Fix outputting multiple status when threshold is 0 (ratio must be GREATER THAN not equal to the threshold to get reported)
[fixes#48780333]
[fixes#48787311]
-- Made CountReadsInActiveRegions Nano schedulable, confirming identical results for linear and nano results
-- Made Haplotype NanoScheduled, requiring misc. changes in the map/reduce type so that the map() function returns a List<VariantContext> and reduce actually prints out the results to disk
-- Tests for NanoScheduling
-- CountReadsInActiveRegionsIntegrationTest now does NCT 1, 2, 4 with CountReadsInActiveRegions
-- HaplotypeCallerParallelIntegrationTest does NCT 1,2,4 calling on 100kb of PCR free data
-- Some misc. code cleanup of HaplotypeCaller
-- Analysis scripts to assess performance of nano scheduled HC
-- In order to make the haplotype caller thread safe we needed to use an AtomicInteger for the class-specific static ID counter in SeqVertex and MultiDebrujinVertex, avoiding a race condition where multiple new Vertex() could end up with the same id.
* This version inherits from the original SW implementation so it can use the same matrix creation method.
* A bunch of refactoring was done to the original version to clean it up a bit and to have it do the
right thing for indels at the edges of the alignments.
* Enum added for the overhang strategy to use; added implementation for the INDEL version of this strategy.
* Lots of systematic testing added for this implementation.
* NOT HOOKED UP TO HAPLOTYPE CALLER YET. Committing so that people can play around with this for now.
* bitset could legitimately be in an unfinished state but we were trying to access it without finalizing.
* added --cancer_mode argument per Mark's suggestion to force the user to explicitly enable multi-sample mode.
* tests were easiest to implement as integration tests (this was a really complicated case).
Problem
-------
The DeBruijn assembler was too slow. The cause of the slowness was the need to construct many kmer graphs (from max read length in the interval to 11 kmer, in increments of 6 bp). This need to build many kmer graphs was because the assembler (1) needed long kmers to assemble through regions where a shorter kmer was non-unique in the reference, as we couldn't split cycles in the reference (2) shorter kmers were needed to be sensitive to differences from the reference near the edge of reads, which would be lost often when there was chain of kmers of longer length that started before and after the variant.
Solution
--------
The read threading assembler uses a fixed kmer, in this implementation by default two graphs with 10 and 25 kmers. The algorithm operates as follows:
identify all non-unique kmers of size K among all reads and the reference
for each sequence (ref and read):
find a unique starting position of the sequence in the graph by matching to a unique kmer, or starting a new source node if non exist
for each base in the sequence from the starting vertex kmer:
look at the existing outgoing nodes of current vertex V. If the base in sequence matches the suffix of outgoing vertex N, read the sequence to N, and continue
If no matching next vertex exists, find a unique vertex with kmer K. If one exists, merge the sequence into this vertex, and continue
If a merge vertex cannot be found, create a new vertex (note this vertex may have a kmer identical to another in the graph, if it is not unique) and thread the sequence to this vertex, and continue
This algorithm has a key property: it can robustly use a very short kmer without introducing cycles, as we will create paths through the graph through regions that aren't unique w.r.t. the sequence at the given kmer size. This allows us to assemble well with even very short kmers.
This commit includes many critical changes to the haplotype caller to make it fast, sensitive, and accurate on deep and shallow WGS and exomes, the key changes are highlighted below:
-- The ReadThreading assembler keeps track of the maximum edge multiplicity per sample in the graph, so that we prune per sample, not across all samples. This change is essential to operate effectively when there are many deep samples (i.e., 100 exomes)
-- A new pruning algorithm that will only prune linear paths where the maximum edge weight among all edges in the path have < pruningFactor. This makes pruning more robust when you have a long chain of bases that have high multiplicity at the start but only barely make it back into the main path in the graph.
-- We now do a global SmithWaterman to compute the cigar of a Path, instead of the previous bubble-based SmithWaterman optimization. This change is essential for us to get good variants from our paths when the kmer size is small. It also ensures that we produce a cigar from a path that only depends only the sequence of bases in the path, unlike the previous approach which would depend on both the bases and the way the path was decomposed into vertices, which depended on the kmer size we used.
-- Removed MergeHeadlessIncomingSources, which was introducing problems in the graphs in some cases, and just isn't the safest operation. Since we build a kmer graph of size 10, this operation is no longer necessary as it required a perfect match of 10 bp to merge anyway.
-- The old DebruijnAssembler is still available with a command line option
-- The number of paths we take forward from the each assembly graph is now capped at a factor per sample, so that we allow 128 paths for a single sample up to 10 x nSamples as necessary. This is an essential change to make the system work well for large numbers of samples.
-- Add a global mismapping parameter to the HC likelihood calculation: The phredScaledGlobalReadMismappingRate reflects the average global mismapping rate of all reads, regardless of their mapping quality. This term effects the probability that a read originated from the reference haploytype, regardless of its edit distance from the reference, in that the read could have originated from the reference haplotype but from another location in the genome. Suppose a read has many mismatches from the reference, say like 5, but has a very high mapping quality of 60. Without this parameter, the read would contribute 5 * Q30 evidence in favor of its 5 mismatch haplotype compared to reference, potentially enough to make a call off that single read for all of these events. With this parameter set to Q30, though, the maximum evidence against the reference that this (and any) read could contribute against reference is Q30. -- Controllable via a command line argument, defaulting to Q60 rate. Results from 20:10-11 mb for branch are consistent with the previous behavior, but this does help in cases where you have rare very divergent haplotypes
-- Reduced ActiveRegionExtension from 200 bp to 100 bp, which is a performance win and the large extension is largely unnecessary with the short kmers used with the read threading assembler
Infrastructure changes / improvements
-------------------------------------
-- Refactored BaseGraph to take a subclass of BaseEdge, so that we can use a MultiSampleEdge in the ReadThreadingAssembler
-- Refactored DeBruijnAssembler, moving common functionality into LocalAssemblyEngine, which now more directly manages the subclasses, requiring them to only implement a assemble() method that takes ref and reads and provides a List<SeqGraph>, which the LocalAssemblyEngine takes forward to compute haplotypes and other downstream operations. This allows us to have only a limited amount of code that differentiates the Debruijn and ReadThreading assemblers
-- Refactored active region trimming code into ActiveRegionTrimmer class
-- Cleaned up the arguments in HaplotypeCaller, reorganizing them and making arguments @Hidden and @Advanced as appropriate. Renamed several arguments now that the read threading assembler is the default
-- LocalAssemblyEngineUnitTest reads in the reference sequence from b37, and assembles with synthetic reads intervals from 10-11 mbs with only the reference sequence as well as artificial snps, deletions, and insertions.
-- Misc. updates to Smith Waterman code. Added generic interface to called not surpisingly SmithWaterman, making it easier to have alternative implementations.
-- Many many more unit tests throughout the entire assembler, and in random utilities
* This is emerging now because BWA-MEM produces lots of reads that are not primary alignments
* The ConstrainedMateFixingManager class used by IndelRealigner was mis-adjusting SAM flags because it
was getting confused by these secondary alignments
* Added unit test to cover this case
Only try to clip adaptors when both reads of the pair are on opposite strands
-- Read pairs that have unusual alignments, such as two reads both oriented like:
<-----
<-----
where previously having their adaptors clipped as though the standard calculation of the insert size was meaningful, which it is not for such oddly oriented pairs. This caused us to clip extra good bases from reads.
-- Update MD5s due change in adaptor clipping, which add some coverage in some places
Output didn't "mix-up" the genotypes, it outputed the same HET vs HET (e.g.) 3 times rather than the combinations of HET vs {HET, HOM, HOM_REF}, etc.
This was only a problem in the text, _not_ the actual numbers, which were outputted correctly.
- Updated MD5's after looking at diffs to verify that the change is what I expected.
-Changes in Java 7 related to comparators / sorting produce a large number
of innocuous differences in our test output. Updating expectations now
that we've moved to using Java 7 internally.
-Also incorporate Eric's fix to the GATKSAMRecordUnitTest to prevent
intermittent failures.
RR counts are represented as offsets from the first count, but that wasn't being done
correctly when counts are adjusted on the fly. Also, we were triggering the expensive
conversion and writing to binary tags even when we weren't going to write the read
to disk.
The code has been updated so that unconverted counts are passed to the GATKSAMRecord
and it knows how to encode the tag correctly. Also, there are now methods to write
to the reduced counts array without forcing the conversion (and methods that do force
the conversion).
Also:
1. counts are now maintained as ints whenever possible. Only the GATKSAMRecord knows
about the internal encoding.
2. as discussed in meetings today, we updated the encoding so that it can now handle
a range of values that extends to 255 instead of 127 (and is backwards compatible).
3. tests have been moved from SyntheticReadUnitTest to GATKSAMRecordUnitTest accordingly.
-- Added check to see if read spans beyond reference window MINUS padding and event length. This guarantees that read will always be contained in haplotype.
-- Changed md5's that happen when long reads from old 454 data have their likelihoods changed because of the extra base clipping.
-- The previous version of the read clipping operations wouldn't modify the reduced reads counts, so hardClipToRegion would result in a read with, say, 50 bp of sequence and base qualities but 250 bp of reduced read counts. Updated the hardClip operation to handle reduce reads, and added a unit test to make sure this works properly. Also had to update GATKSAMRecord.emptyRead() to set the reduced count to new byte[0] if the template read is a reduced read
-- Update md5s, where the new code recovers a TP variant with count 2 that was missed previously
Use case:
The default AF priors used (infinite sites model, neutral variation) is appropriate in the case where the reference allele is ancestral, and the called allele is a derived allele.
Most of the times this is true but in several population studies and in ancient DNA analyses this might introduce reference biases, and in some other cases it's hard to ascertain what the ancestral allele is (normally requiring to look up homologous chimp sequence).
Specifying no prior is one solution, but this may introduce a lot of artifactual het calls in shallower coverage regions.
With this option, users can specify what the prior for each AC should be according to their needs, subject to the restrictions documented in the code and in GATK docs.
-- Updated ancient DNA single sample calling script with filtering options and other cleanups.
-- Added integration test. Removed old -noPrior syntax.
-Do not throw an exception when parsing snpEff output files
generated by not-officially-supported versions of snpEff,
PROVIDED that snpEff was run with -o gatk
-Requested by the snpEff author
-Relevant integration tests updated/expanded
Note that this works only in the case of pileups (i.e. coming from UG);
allele-biased down-sampling for RR just cannot work for haplotypes.
Added lots of unit tests for new functionality.
-- The previous version was unclipping soft clipped bases, and these were sometimes adaptor sequences. If the two reads successfully merged, we'd lose all of the information necessary to remove the adaptor, producing a very high quality read that matched reference. Updated the code to first clip the adapter sequences from the incoming fragments
-- Update MD5s
1. Using cumulative binomial probability was not working at high coverage sites (because p-values quickly
got out of hand) so instead we use a hybrid system for determining significance: at low coverage sites
use binomial prob and at high coverage sites revert to using the old base proportions. Then we get the
best of both worlds. As a note, coverage refers to just the individual base counts and not the entire pileup.
2. Reads were getting lost because of the comparator being used in the SlidingWindow. When read pairs had
the same alignment end position the 2nd one encountered would get dropped (but added to the header!). We
now use a PriorityQueue instead of a TreeSet to allow for such cases.
3. Each consensus keeps track of its own number of softclipped bases. There was no reason that that number
should be shared between them.
4. We output consensus filtered (i.e. low MQ) reads whenever they are present for now. Don't lose that
information. Maybe we'll decide to change this in the future, but for now we are conservative.
5. Also implemented various small performance optimizations based on profiling.
Added unit tests to cover these changes; systematic assessment now tests against low MQ reads too.
Calling everything statistics was very confusing. Diagnose Targets stratifies the data three ways: Interval, Sample and Locus. Each stratification then has it's own set of metrics (plugin system) to calculate -- LocusMetric, SampleMetric, IntervalMetric.
Metrics are generalized by the Metric interface. (for generic access)
Stratifications are generalized by the AbstractStratification abstract class. (to aggressively limit code duplication)
-- In case there are no informative bases in a pileup but pileup isn't empty (like when all bases have Q < min base quality) the GLs were still computed (but were all zeros) and fed to the exact model. Now, mimic case of diploid Gl computation where GLs are only added if # good bases > 0
-- I believe general case where only non-informative GLs are fed into AF calc model is broken and yields bogus QUAL, will investigate separately.
* Make most classes final, others package local
* Move to diagnostics.diagnosetargets package
* Aggregate statistics and walker classes on the same package for simplified visibility.
* Make status list a LinkedList instead of a HashSet
A plugin enabled implementation of DiagnoseTargets
Summarized Changes:
-------------------
* move argument collection into Thresholder object
* make thresholder object private member of all statistics classes
* rework the logic of the mate pairing thresholds
* update unit and integration tests to reflect the new behavior
* Implements Locus Statistic plugins
* Extend Locus Statistic plugins to determine sample status
* Export all common plugin functionality into utility class
* Update tests accordingly
[fixes#48465557]
* remove interval statistic low_median_coverage -- it is already captured by low coverage and coverage gaps.
* add gatkdocs to all the parameters
* clean up the logic on callable status a bit (still need to be re-worked into a plugin system)
* update integration tests
This is not really feasible with the current mandate of this walker. We would have to traverse by reference and that would make the runtime much higher, and we are not really interested in the status 99% of the time anyway. There are other walkers that can report this, and just this, status more cheaply.
[fixes#48442663]
Problem
-------
Diagnose targets is outputting both LOW_MEDIAN_COVERAGE and NO_READS when no reads are covering the interval
Solution
--------
Only allow low median coverage check if there are reads
[fixes#48442675]
Problem
-------
Diagnose targets was skipping intervals when they were not covered by any reads.
Solution
--------
Rework the interval iteration logic to output all intervals as they're skipped over by the traversal, as well as adding a loop on traversal done to finish outputting intervals past the coverage of teh BAM file.
Summarized Changes
------------------
* Outputs all intervals it iterates over, even if uncovered
* Outputs leftover intervals in the end of the traversal
* Updated integration tests
[fixes#47813825]
-- The problem is that the common suffix splitter could eliminate the reference source vertex when there's an incoming node that contains all of the reference source vertex bases and then some additional prefix bases. In this case we'd eliminate the reference source vertex. Fixed by checking for this condition and aborting the simplification
-- Update MD5s, including minor improvements
-- Reduce the min read length to 10 bp in the filterNonPassingReads in the HC. Now that we filter out reads before genotyping, we have to be more tolerant of shorter, but informative, reads, in order to avoid a few FNs in shallow read data
-- Reduce the min usable base qual to 8 by default in the HC. In regions with low coverage we sometimes throw out our only informative kmers because we required a contiguous run of bases with >= 16 QUAL. This is a bit too aggressive of a requirement, so I lowered it to 8.
-- Together with the previous commit this results in a significant improvement in the sensitivity and specificity of the caller
NA12878 MEM chr20:10-11
Name VariantType TRUE_POSITIVE FALSE_POSITIVE FALSE_NEGATIVE TRUE_NEGATIVE CALLED_NOT_IN_DB_AT_ALL
branch SNPS 1216 0 2 194 0
branch INDELS 312 2 13 71 7
master SNPS 1214 0 4 194 1
master INDELS 309 2 16 71 10
-- Update MD5s in the integration tests to reflect these two new changes
* Moved redundant code out of UGEngine
* Added overloaded methods that assume p=0.5 for speed efficiency
* Added unit test for the binomialCumulativeProbability method
The Problem:
Exomes seem to be more prone to base errors and one error in 20x coverage (or below, like most
regions in an exome) causes RR (with default settings) to consider it a variant region. This
seriously hurts compression performance.
The Solution:
1. We now use a probabilistic model for determining whether we can create a consensus (in other
words, whether we can error correct a site) instead of the old ratio threshold. We calculate
the cumulative binomial probability of seeing the given ratio and trigger consensus creation if
that pvalue is lower than the provided threshold (0.01 by default, so rather conservative).
2. We also allow het compression globally, not just at known sites. So if we cannot create a
consensus at a given site then we try to perform het compression; and if we cannot perform het
compression that we just don't reduce the variant region. This way very wonky regions stay
uncompressed, regions with one errorful read get fully compressed, and regions with one errorful
locus get het compressed.
Details:
1. -minvar is now deprecated in favor of -min_pvalue.
2. Added integration test for bad pvalue input.
3. -known argument still works to force het compression only at known sites; if it's not included
then we allow het compression anywhere. Added unit tests for this.
4. This commit includes fixes to het compression problems that were revealed by systematic qual testing.
Before finalizing het compression, we now check for insertions or other variant regions (usually due
to multi-allelics) which can render a region incompressible (and we back out if we find one). We
were checking for excessive softclips before, but now we add these tests too.
5. We now allow het compression on some but not all of the 4 consensus reads: if creating one of the
consensuses is not possible (e.g. because of excessive softclips) then we just back that one consensus
out instead of backing out all of them.
6. We no longer create a mini read at the stop of the variant window for het compression. Instead, we
allow it to be part of the next global consensus.
7. The coverage test is no longer run systematically on all integration tests because the quals test
supercedes it. The systematic quals test is now much stricter in order to catch bugs and edge cases
(very useful!).
8. Each consensus (both the normal and filtered) keep track of their own mapping qualities (before the MQ
for a consensus was affected by good and bad bases/reads).
9. We now completely ignore low quality bases, unless they are the only bases present in a pileup.
This way we preserve the span of reads across a region (needed for assembly). Min base qual moved to Q15.
10.Fixed long-standing bug where sliding window didn't do the right thing when removing reads that start
with insertions from a header.
Note that this commit must come serially before the next commit in which I am refactoring the binomial prob
code in MathUtils (which is failing and slow).
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples. This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes. The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects. After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model. It's worse than the current version in both single and multiple samples:
1000G EUR samples:
10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes
Name VariantType TRUE_POSITIVE FALSE_POSITIVE FALSE_NEGATIVE TRUE_NEGATIVE CALLED_NOT_IN_DB_AT_ALL
per_sample SNPS 50 0 5 8 1
per_sample INDELS 6 0 7 2 1
pooled SNPS 49 0 6 8 1
pooled INDELS 5 0 8 2 1
100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes
Name VariantType TRUE_POSITIVE FALSE_POSITIVE FALSE_NEGATIVE TRUE_NEGATIVE CALLED_NOT_IN_DB_AT_ALL
per_sample SNPS 144 0 22 28 1
per_sample INDELS 28 1 16 9 11
pooled SNPS 143 0 23 28 1
pooled INDELS 27 1 17 9 11
java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug
haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds
java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug
haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
-- It's useful to know which sites have been used in the training of the model. The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.
Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
-- The PairHMM no longer allows us to create haplotypes with 0 bases. The UG indel caller used to create such haplotypes. Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes#47523579]
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.
Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.
Summarized Changes
------------------
* Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
* Updated related MD5's
Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble. The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls. I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.
-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all
General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly. Depreciated old call to inline constants. This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default. Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
-- Ensure that BQSR works properly for an Ion Torrent BAM. (Added integration test and bam)
-- Improve the error message when a unknown platform is found (integration test added)
-- old algorithm was O(kmerSize * readLen) for each read. New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph. Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
-- The previous creation algorithm used the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to the graph
add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
update edge count by 1 if kmer1 -> kmer2 already existed in the graph
-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)). This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap
for each kmer pair 1 and 2 in the hash counter
add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
update edge count by count from map if kmer1 -> kmer2 already existed in the graph
-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:
X -> A -> B
Y -> A -> B
So that the incoming vertices of B all have the same sequence. This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph. Fixed and unit tested
-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging. So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph. Equals here means that all vertices have equivalents in both graphs, as do all edges. If the two graphs are equal we stop simplifying. It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
-- HC now throws a UserException if this model is provided. Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5]. The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding. Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i. Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models. Allowing cycles can be re-enabled with an HC command line switch.
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes. This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype. All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension). Radically speeds up calculations when using large active region extensions. The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible. The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter. The previous error corrector was just broken (conceptually) and was disabled by default in the engine. Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so. This would introduce large deletion events at the start / end of the assemblies. Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go. Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains. The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator. For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed. Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well. Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp. In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M. The new code supports this. UnitTested and documented as well. LDMerger handles case where merging two alleles results in a no-op event. Merging CA/C + A/AA -> CAA/CAA -> no op. Handles this case by removing the two events. UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right). Here's the new algorithm:
* Compute probability that two variants are in phase with each other and that no
* compound hets exist in the population.
*
* Implemented as a likelihood ratio test of the hypothesis:
*
* x11 and x22 are the only haplotypes in the populations
*
* vs.
*
* all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
*
* Now, since we have to have both variants in the population, we exclude the x11 & x11 state. So the
* p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
*
* Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
*
* - P(x11 & x12 & x21) -- we have hom-ref and both hets
* - P(x22 & x12 & x21) -- we have hom-alt and both hets
* - P(x22 & x12) -- one haplotype is 22 and the other is het 12
* - P(x22 & x21) -- one haplotype is 22 and the other is het 21
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)
Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.
Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)
[fixes#47399227]
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
* This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
* Added integration test to confirm failure with User Error
* Removed illegal header line in KB test VCF that was causing related tests to fail.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm. Created unit test that reproduced the issue, and then fixed the underlying issue.
-- Only try to genotype PASSing records in the alleles file
-- Don't attempt to genotype multiple records with the same start location. Instead take the first record and throw a warning message.
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
* Moved to protected for packaging purposes.
* Cleaned up and removed debugging output.
* Fixed logic for epsilons so that we really only test significant differences between BAMs.
* Other small fixes (e.g. don't include low quality reduced reads in overall qual).
* Most RR integration tests now automatically run the quals test on output.
* A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".
How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.
Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter
Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31
Issue Tracker:
--------------
[fixes 47100885]
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
# Initial conditions were not being set properly
# Emission probabilities in the last row were not adding up to 1
The following commit fixes both by
# averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
# discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)
Summarized changes:
* Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
* Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
* Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
* Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
* Rename metric lengths to read and haplotype lengths for clarity
* Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
* Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
* Remove unnecessary parameters from updateCell()
* Fix the expected probabilities coming from the exact model in PairHMMUnitTest
* Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
* Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.
[fix 47164949]
that are tested), resulting in slightly different numbers of calls to the RNG, and ultimately
different sets of selected variants.
This commits updates the md5 values for the validation site selector integration test to reflect
these new random subsets of variants that are selected.
-- Added ability to trim common bases in front of indels before left-aligning. Otherwise, records may not be left-aligned if they have common bases, as they will be mistaken by complext records.
-- Added ability to split multiallelic records and then left align them, otherwise we miss a lot of good left-aligneable indels.
-- Motivated by this, renamed walker to LeftAlignAndTrimVariants.
-- Code refactoring, cleanup and bring up to latest coding standards.
-- Added unit testing to make sure left alignment is performed correctly for all offsets.
-- Changed phase 3 HC script to new syntax. Add command line options, more memory and reduce alt alleles because jobs keep crashing.
Currently, the multi-allelic test is covering the following case:
Eval A T,C
Comp A C
reciprocate this so that the reverse can be covered.
Eval A C
Comp A T,C
And furthermore, modify ConcordanceMetrics to more properly handle the situation where multiple alternate alleles are available in the comp. It was possible for an eval C/C sample to match a comp T/T sample, so long as the C allele were also present in at least one other comp sample.
This comes from the fact that "truth" reference alleles can be paired with *any* allele also present in the truth VCF, while truth het/hom var sites are restricted to having to match only the alleles present in the genotype. The reason that truth ref alleles are special case is as follows, imagine:
Eval: A G,T 0/0 2/0 2/2 1/1
Comp: A C,T 0/0 1/0 0/0 0/0
Even though the alt allele of the comp is a C, the assessment of genotypes should be as follows:
Sample1: ref called ref
Sample2: alleles don't match (the alt allele of the comp was not assessed in eval)
Sample3: ref called hom-var
Sample4: alleles don't match (the alt allele of the eval was not assessed in comp)
Before this change, Sample2 was evaluated as "het called het" (as the T allele in eval happens to also be in the comp record, just not in the comp sample). Thus: apply current
logic to comp hom-refs, and the more restrictive logic ("you have to match an allele in the comp genotype") when the comp is not reference.
Also in this commit,major refactoring and testing for MathUtils. A large number of methods were not used at all in the codebase, these methods were removed:
- dotProduct(several types). logDotProduct is used extensively, but not the real-space version.
- vectorSum
- array shuffle, random subset
- countOccurances (general forms, the char form is used in the codebase)
- getNMaxElements
- array permutation
- sorted array permutation
- compare floats
- sum() (for integer arrays and lists).
Final keyword was extensively added to MathUtils.
The ratio() and percentage() methods were revised to error out with non-positive denominators, except in the case of 0/0 (which returns 0.0 (ratio), or 0.0% (percentage)). Random sampling code was updated to make use of the cleaner implementations of generating permutations in MathUtils (allowing the array permutation code to be retired).
The PaperGenotyper still made use of one of these array methods, since it was the only walker it was migrated into the genotyper itself.
In addition, more extensive tests were added for
- logBinomialCoefficient (Newton's identity should always hold)
- logFactorial
- log10sumlog10 and its approximation
All unit tests pass
-- These new algorithms are more powerful than the restricted diamond merging algoriths, in that they can merge nodes with multiple incoming and outgoing edges. Together the splitter + merger algorithms will correctly merge many more cases than the original headless and tailless diamond merger.
-- Refactored haplotype caller infrastructure into graphs package, code cleanup
-- Cleanup new merging / splitting algorithms, with proper docs and unit tests
-- Fix bug in zipping of linear chains. Because the multiplicity can be 0, protect ourselves with a max function call
-- Fix BaseEdge.max unit test
-- Add docs and some more unit tests
-- Move error correct from DeBruijnGraph to DeBruijnAssembler
-- Replaced uses of System.out.println with logger.info
-- Don't make multiplicity == 0 nodes look like they should be pruned
-- Fix toString of Path
-- Previous algorithms were applying pruneGraph inappropriately on the raw sequence graph (where each vertex is a single base). This results in overpruning of the graph, as prunegraph really relied on the zipping of linear chains (and the sharing of weight this provides) to avoid over-pruning the graph. Probably we should think hard about this. This commit fixes this logic, so we zip the graph between pruning
-- In this process ID's a fundamental problem with how we were trimming away vertices that occur on a path from the reference source to sink. In fact, we were leaving in any vertex that happened to be accessible from source, any vertices in cycles, and any vertex that wasn't the absolute end of a chain going to a sink. The new algorithm fixes all of this, using a BaseGraphIterator that's a general approach to walking the base graph. Other routines that use the same traversal idiom refactored to use this iterator. Added unit tests for all of these capabilities.
-- Created new BaseGraphIterator, which abstracts common access patterns to graph, and use this where appropriate