-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
-- It's useful to know which sites have been used in the training of the model. The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.
Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
-- The PairHMM no longer allows us to create haplotypes with 0 bases. The UG indel caller used to create such haplotypes. Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes#47523579]
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble. The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.
ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls. I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.
-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all
General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly. Depreciated old call to inline constants. This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default. Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
-- old algorithm was O(kmerSize * readLen) for each read. New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph. Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
-- The previous creation algorithm used the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to the graph
add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
update edge count by 1 if kmer1 -> kmer2 already existed in the graph
-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)). This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:
for each kmer1 -> kmer2 in each read
add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap
for each kmer pair 1 and 2 in the hash counter
add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
update edge count by count from map if kmer1 -> kmer2 already existed in the graph
-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:
X -> A -> B
Y -> A -> B
So that the incoming vertices of B all have the same sequence. This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph. Fixed and unit tested
-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging. So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph. Equals here means that all vertices have equivalents in both graphs, as do all edges. If the two graphs are equal we stop simplifying. It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
-- HC now throws a UserException if this model is provided. Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5]. The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding. Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i. Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models. Allowing cycles can be re-enabled with an HC command line switch.
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes. This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype. All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension). Radically speeds up calculations when using large active region extensions. The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible. The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter. The previous error corrector was just broken (conceptually) and was disabled by default in the engine. Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so. This would introduce large deletion events at the start / end of the assemblies. Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go. Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains. The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator. For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed. Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well. Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp. In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M. The new code supports this. UnitTested and documented as well. LDMerger handles case where merging two alleles results in a no-op event. Merging CA/C + A/AA -> CAA/CAA -> no op. Handles this case by removing the two events. UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right). Here's the new algorithm:
* Compute probability that two variants are in phase with each other and that no
* compound hets exist in the population.
*
* Implemented as a likelihood ratio test of the hypothesis:
*
* x11 and x22 are the only haplotypes in the populations
*
* vs.
*
* all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
*
* Now, since we have to have both variants in the population, we exclude the x11 & x11 state. So the
* p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
*
* Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
*
* - P(x11 & x12 & x21) -- we have hom-ref and both hets
* - P(x22 & x12 & x21) -- we have hom-alt and both hets
* - P(x22 & x12) -- one haplotype is 22 and the other is het 12
* - P(x22 & x21) -- one haplotype is 22 and the other is het 21
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)
Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.
Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)
[fixes#47399227]
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm. Created unit test that reproduced the issue, and then fixed the underlying issue.
-- Only try to genotype PASSing records in the alleles file
-- Don't attempt to genotype multiple records with the same start location. Instead take the first record and throw a warning message.
* Moved to protected for packaging purposes.
* Cleaned up and removed debugging output.
* Fixed logic for epsilons so that we really only test significant differences between BAMs.
* Other small fixes (e.g. don't include low quality reduced reads in overall qual).
* Most RR integration tests now automatically run the quals test on output.
* A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".
How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.
Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter
Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31
Issue Tracker:
--------------
[fixes 47100885]
The current implementation of the PairHMM had issues with the probabilities and the state machines. Probabilities were not adding up to one because:
# Initial conditions were not being set properly
# Emission probabilities in the last row were not adding up to 1
The following commit fixes both by
# averaging all potential start locations (giving an equal prior to the state machine in it's first iteration -- allowing the read to start it's alignment anywhere in the haplotype with equal probability)
# discounting all paths that end in deletions by not adding the last row of the deletion matrix and summing over all paths ending in matches and insertions (this saves us from a fourth matrix to represent the end state)
Summarized changes:
* Fix LoglessCachingPairHMM and Log10PairHMM according to the new algorithm
* Refactor probabilities check to throw exception if we ever encounter probabilities greater than 1.
* Rename LoglessCachingPairHMM to LoglessPairHMM (this is the default implementation in the HC now)
* Rename matrices to matchMatrix, insertionMatrix and deletionMatrix for clarity
* Rename metric lengths to read and haplotype lengths for clarity
* Rename private methods to initializePriors (distance) and initializeProbabilities (constants) for clarity
* Eliminate first row constants (because they're not used anyway!) and directly assign initial conditions in the deletionMatrix
* Remove unnecessary parameters from updateCell()
* Fix the expected probabilities coming from the exact model in PairHMMUnitTest
* Neatify PairHMM class (removed unused methods) and PairHMMUnitTest (removed unused variables)
* Update MD5s: Probabilities have changed according to the new PairHMM model and as expected HC and UG integration tests have new MD5s.
[fix 47164949]
-- These new algorithms are more powerful than the restricted diamond merging algoriths, in that they can merge nodes with multiple incoming and outgoing edges. Together the splitter + merger algorithms will correctly merge many more cases than the original headless and tailless diamond merger.
-- Refactored haplotype caller infrastructure into graphs package, code cleanup
-- Cleanup new merging / splitting algorithms, with proper docs and unit tests
-- Fix bug in zipping of linear chains. Because the multiplicity can be 0, protect ourselves with a max function call
-- Fix BaseEdge.max unit test
-- Add docs and some more unit tests
-- Move error correct from DeBruijnGraph to DeBruijnAssembler
-- Replaced uses of System.out.println with logger.info
-- Don't make multiplicity == 0 nodes look like they should be pruned
-- Fix toString of Path
-- Previous algorithms were applying pruneGraph inappropriately on the raw sequence graph (where each vertex is a single base). This results in overpruning of the graph, as prunegraph really relied on the zipping of linear chains (and the sharing of weight this provides) to avoid over-pruning the graph. Probably we should think hard about this. This commit fixes this logic, so we zip the graph between pruning
-- In this process ID's a fundamental problem with how we were trimming away vertices that occur on a path from the reference source to sink. In fact, we were leaving in any vertex that happened to be accessible from source, any vertices in cycles, and any vertex that wasn't the absolute end of a chain going to a sink. The new algorithm fixes all of this, using a BaseGraphIterator that's a general approach to walking the base graph. Other routines that use the same traversal idiom refactored to use this iterator. Added unit tests for all of these capabilities.
-- Created new BaseGraphIterator, which abstracts common access patterns to graph, and use this where appropriate
-- This new functionality allows the client to make decisions about how to handle non-informative reads, rather than having a single enforced constant that isn't really appropriate for all users. The previous functionality is maintained now and used by all of the updated pieces of code, except the BAM writers, which now emit reads to display to their best allele, regardless of whether this is particularly informative or not. That way you can see all of your data realigned to the new HC structure, rather than just those that are specifically informative.
-- This all makes me concerned that the informative thresholding isn't appropriately used in the annotations themselves. There are many cases where nearby variation makes specific reads non-informative about one event, due to not being informative about the second. For example, suppose you have two SNPs A/B and C/D that are in the same active region but separated by more than the read length of the reads. All reads would be non-informative as no read provides information about the full combination of 4 haplotypes, as they reads only span a single event. In this case our annotations will all fall apart, returning their default values. Added a JIRA to address this (should be discussed in group meeting)
-- Though not intended, it was possible to create reference graphs with cycles in the case where you started the graph with a homopolymer of length > the kmer. The previous test would fail to catch this case. Now its not possible
-- Lots of code cleanup and refactoring in this push. Split the monolithic createGraphFromSequences into simple calls to addReferenceKmersToGraph and addReadKmersToGraph which themselves share lower level functions like addKmerPairFromSeqToGraph.
-- Fix performance problem with reduced reads and the HC, where we were calling add kmer pair for each count in the reduced read, instead of just calling it once with a multiplicity of count.
-- Refactor addKmersToGraph() to use things like addOrUpdateEdge, now the code is very clear
-- The previous version would generate graphs that had no reference bases at all in the situation where the reference haplotype was < the longer read length, which would cause the kmer size to exceed the reference haplotype length. Now return immediately with a null graph when this occurs as opposed to continuing and eventually causing an error