Commit Graph

662 Commits (067d24957bdc8b283ea39b7d8693dd9ebb37188e)

Author SHA1 Message Date
Mark DePristo 067d24957b Select the haplotypes we move forward for genotyping per sample, not pooled
-- The previous algorithm would compute the likelihood of each haplotype pooled across samples.  This has a tendency to select "consensus" haplotypes that are reasonably good across all samples, while missing the true haplotypes that each sample likes.  The new algorithm computes instead the most likely pair of haplotypes among all haplotypes for each sample independently, contributing 1 vote to each haplotype it selects.  After all N samples have been run, we sort the haplotypes by their counts, and take 2 * nSample + 1 haplotypes or maxHaplotypesInPopulation, whichever is smaller.
-- After discussing with Mauricio our view is that the algorithmic complexity of this approach is no worse than the previous approach, so it should be equivalently fast.
-- One potential improvement is to use not hard counts for the haplotypes, but this would radically complicate the current algorithm so it wasn't selected.
-- For an example of a specific problem caused by this, see https://jira.broadinstitute.org/browse/GSA-871.
-- Remove old pooled likelihood model.  It's worse than the current version in both single and multiple samples:

1000G EUR samples:

10Kb
per sample: 7.17 minutes
pooled: 7.36 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                    50               0               5              8                        1
per_sample  INDELS                   6               0               7              2                        1
pooled      SNPS                    49               0               6              8                        1
pooled      INDELS                   5               0               8              2                        1

100 kb
per sample: 140.00 minutes
pooled: 145.27 minutes

Name        VariantType  TRUE_POSITIVE  FALSE_POSITIVE  FALSE_NEGATIVE  TRUE_NEGATIVE  CALLED_NOT_IN_DB_AT_ALL
per_sample  SNPS                   144               0              22             28                        1
per_sample  INDELS                  28               1              16              9                       11
pooled      SNPS                   143               0              23             28                        1
pooled      INDELS                  27               1              17              9                       11

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I private/testdata/AFR.structural.indels.bam -L 20:8187565-8187800 -L 20:18670537-18670730 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 8 seconds
haplotypes from pools: 8 seconds

java -Xmx2g -jar dist/GenomeAnalysisTK.jar -T HaplotypeCaller -I /Users/depristo/Desktop/broadLocal/localData/phaseIII.4x.100kb.bam -L 20:10,000,000-10,001,000 -R ~/Desktop/broadLocal/localData/human_g1k_v37.fasta -o /dev/null -debug

haplotypes from samples: 173.32 seconds
haplotypes from pools: 167.12 seconds
2013-04-16 09:42:03 -04:00
Mark DePristo 5a74a3190c Improvements to the VariantRecalibrator R plots
-- VariantRecalibrator now emits plots with denormlized values (original values) instead of their normalized (x - mu / sigma) which helps to understand the distribution of values that are good and bad
2013-04-16 09:09:51 -04:00
Mark DePristo 564fe36d22 VariantRecalibrator's VQSR.vcf now contains NEG/POS labels
-- It's useful to know which sites have been used in the training of the model.  The recal_file emitted by VR now contains VCF info field annotations labeling each site that was used in the positive or negative training models with POSITIVE_TRAINING_SITE and/or NEGATIVE_TRAINING_SITE
-- Update MD5s, which all changed now that the recal file and the resulting applied vcfs all have these pos / neg labels
2013-04-16 09:09:47 -04:00
Mauricio Carneiro 9bfa5eb70f Quick optimization to the PairHMM
Problem
--------
the logless HMM scale factor (to avoid double under-flows) was 10^300. Although this serves the purpose this value results in a complex mantissa that further complicates cpu calculations.

Solution
---------
initialize with 2^1020 (2^1023 is the max value), and adjust the scale factor accordingly.
2013-04-14 23:25:33 -04:00
Mark DePristo 3144eae51c UnifiedGenotyper bugfix: don't create haplotypes with 0 bases
-- The PairHMM no longer allows us to create haplotypes with 0 bases.  The UG indel caller used to create such haplotypes.  Now we assign -Double.MAX_VALUE likelihoods to such haplotypes.
-- Add integration test to cover this case, along with private/testdata BAM
-- [Fixes #47523579]
2013-04-13 14:57:55 -04:00
Mauricio Carneiro f11c8d22d4 Updating java 7 md5's to java 6 md5's 2013-04-13 08:21:48 -04:00
Mark DePristo b32457be8d Merge pull request #163 from broadinstitute/mc_hmm_caching_again
Fix another caching issue with the PairHMM
2013-04-12 12:34:49 -07:00
Mauricio Carneiro 403f9de122 Fix another caching issue with the PairHMM
The Problem
----------
Some read x haplotype pairs were getting very low likelihood when caching is on. Turning it off seemed to give the right result.

Solution
--------
The HaplotypeCaller only initializes the PairHMM once and then feed it with a set of reads and haplotypes. The PairHMM always caches the matrix when the previous haplotype length is the same as the current one. This is not true when the read has changed. This commit adds another condition to zero the haplotype start index when the read changes.

Summarized Changes
------------------
   * Added the recacheReadValue check to flush the matrix (hapStartIndex = 0)
   * Updated related MD5's

Bamboo link: http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL9
2013-04-12 14:52:45 -04:00
Mark DePristo 0e627bce93 Slight update to Path SW parameters.
-- Decreasing the match value means that we no longer think that ACTG vs. ATCG is best modeled by 1M1D1M1I1M, since we don't get so much value for the middle C match that we can pay two gap open penalties to get it.
2013-04-12 12:43:52 -04:00
Mark DePristo 50cdffc61f Slightly improved Smith-Waterman parameter values for HaplotypeCaller Path comparisons
Key improvement
---------------
-- The haplotype caller was producing unstable calls when comparing the following two haplotypes:

ref:               ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

in which the alt and ref haplotypes differ in having indel at both the start and end of the bubble.  The previous parameter values used in the Path algorithm were set so that such haplotype comparisons would result in the either the above alignment or the following alignment depending on exactly how many GA units were present in the bubble.

ref: ACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
alt: TGTGTGTGTGTGTGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

The number of elements could vary depending on how the graph was built, and resulted in real differences in the calls between BWA mem and BWA-SW calls.  I added a few unit tests for this case, and found a set of SW parameter values with lower gap-extension penalties that significantly favor the first alignment, which is the right thing to do, as we really don't mind large indels in the haplotypes relative to having lots of mismatches.

-- Expanded the unit tests in both SW and KBestPaths to look at complex events like this, and to check as well somewhat sysmatically that we are finding many types of expected mutational events.
-- Verified that this change doesn't alter our calls on 20:10,000,000-11,000,000 at all

General code cleanup
--------------------
-- Move Smith-Waterman to its own package in utils
-- Refactored out SWParameters class in SWPairwiseAlignment, and made constructors take either a named parameter set or a Parameter object directly.  Depreciated old call to inline constants.  This makes it easier to group all of the SW parameters into a single object for callers
-- Update users of SW code to use new Parameter class
-- Also moved haplotype bam writers to protected so they can use the Path SW parameter, which is protected
-- Removed the storage of the SW scoring matrix in SWPairwiseAligner by default.  Only the SWPairwiseAlignmentMain test program needs this, so added a gross protected static variable that enables its storage
2013-04-11 18:22:55 -04:00
Ryan Poplin a507381a33 Updating BQSR RecalibrationEngine to work correctly with empty BQSR tables.
-- Previously would crash when a scatter/gather interval contained no usable data.
-- Added unit test to cover this case.
2013-04-11 16:27:59 -04:00
Mark DePristo fb86887bf2 Fast algorithm for determining which kmers are good in a read
-- old algorithm was O(kmerSize * readLen) for each read.  New algorithm is O(readLen)
-- Added real unit tests for the addKmersFromReads to the graph.  Using a builder is great because we can create a MockBuilder that captures all of the calls, and then verify that all of the added kmers are the ones we'd expect.
2013-04-11 09:54:22 -04:00
Mark DePristo bf42be44fc Fast DeBruijnGraph creation using the kmer counter
-- The previous creation algorithm used the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to the graph
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check)
  update edge count by 1 if kmer1 -> kmer2 already existed in the graph

-- This algorithm had O(reads * kmers / read * (getEdge cost + addEdge cost)).  This is actually pretty expensive because get and add edges is expensive in jgrapht.
-- The new approach uses the following algorithm:

for each kmer1 -> kmer2 in each read
  add kmers 1 and 2 to a kmer counter, that counts kmer1+kmer2 in a fast hashmap

for each kmer pair 1 and 2 in the hash counter
  add edge kmer1 -> kmer2 in the graph, if it's not present (does check) with multiplicity count from map
  update edge count by count from map if kmer1 -> kmer2 already existed in the graph

-- This algorithm ensures that we add very much fewer edges
-- Additionally, created a fast kmer class that lets us create kmers from larger byte[]s of bases without cutting up the byte[] itself.
-- Overall runtimes are greatly reduced using this algorith
2013-04-10 17:10:59 -04:00
Ryan Poplin 850be5e9da Bug fix in SWPairwiseAlignment.
-- When the alignments are sufficiently apart from each other all the scores in the sw matrix could be negative which screwed up the max score calculation since it started at zero.
2013-04-10 16:04:37 -04:00
Mark DePristo b115e5c582 Critical bugfix for CommonSuffixSplitter to avoid infinite loops
-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:

X -> A -> B
Y -> A -> B

So that the incoming vertices of B all have the same sequence.  This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph.  Fixed and unit tested

-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging.  So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph.  Equals here means that all vertices have equivalents in both graphs, as do all edges.  If the two graphs are equal we stop simplifying.  It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
2013-04-09 16:19:26 -04:00
Mark DePristo 51954ae3e5 HaplotypeCaller doesn't support EXACT_GENERAL_PLOIDY model
-- HC now throws a UserException if this model is provided.  Documented this option as not being supported in the HC in the docs for EXACT_GENERAL_PLOIDY
2013-04-09 15:18:42 -04:00
Mark DePristo 33ecec535d Turn off the LD merging code by default
-- It's just too hard to interpret the called variation when we merge variants via LD.
-- Can now be turned on with -mergeVariantsViaLD
-- Update MD5s
2013-04-09 10:08:06 -04:00
Mark DePristo 21410690a2 Address reviewer comments 2013-04-08 12:48:20 -04:00
Mark DePristo caf15fb727 Update MD5s to reflect new HC algorithms and parameter values 2013-04-08 12:48:16 -04:00
Mark DePristo 6d22485a4c Critical bugfix to ReduceRead functionality of the GATKSAMRecord
-- The function getReducedCounts() was returning the undecoded reduced read tag, which looks like [10, 5, -1, -5] when the depths were [10, 15, 9, 5].  The only function that actually gave the real counts was getReducedCount(int i) which did the proper decoding.  Now GATKSAMRecord decodes the tag into the proper depths vector so that getReduceCounts() returns what one reasonably expects it to, and getReduceCount(i) merely looks up the value at i.  Added unit test to ensure this behavior going forward.
-- Changed the name of setReducedCounts() to setReducedCountsTag as this function assumes that counts have already been encoded in the tag way.
2013-04-08 12:47:50 -04:00
Mark DePristo 5a54a4155a Change key Haplotype default parameter values
-- Extension increased to 200 bp
-- Min prune factor defaults to 0
-- LD merging enabled by default for complex variants, only when there are 10+ samples for SNP + SNP merging
-- Active region trimming enabled by default
2013-04-08 12:47:50 -04:00
Mark DePristo 3a19266843 Fix residual merge conflicts 2013-04-08 12:47:50 -04:00
Mark DePristo 9c7a35f73f HaplotypeCaller no longer creates haplotypes that involve cycles in the SeqGraph
-- The kbest paths algorithm now takes an explicit set of starting and ending vertices, which is conceptually cleaner and works for either the cycle or no-cycle models.  Allowing cycles can be re-enabled with an HC command line switch.
2013-04-08 12:47:50 -04:00
Mark DePristo 5545c629f5 Rename Utils to GraphUtils to avoid conflicts with the sting.Utils class; fix broken unit test in SharedVertexSequenceSplitterUnitTest 2013-04-08 12:47:49 -04:00
Mark DePristo 15461567d7 HaplotypeCaller no longer uses reads with poor likelihoods w.r.t. any haplotype
-- The previous likelihood calculation proceeds as normal, but after each read has been evaluated against each haplotype we go through the read / allele / likelihoods map and eliminate all reads that have poor fit to any of the haplotypes.  This functionality stops us from making a particular type of error in the HC, where we have a haplotype that's very far from the reference allele but not the right true haplotype.  All of the reads that are slightly closer to this FP haplotype than the reference previously generated enormous likelihoods in favor of this FP haplotype because they were closer to it than the reference, even if each read had many mismatches w.r.t. the FP haplotype (and so the FP haplotype was a bad model for the true underlying haplotype).
2013-04-08 12:47:49 -04:00
Mark DePristo 9b5c55a84a LikelihoodCalculationEngine will now only use reads longer than the minReadLength, which is currently fixed at 20 bp 2013-04-08 12:47:49 -04:00
Mark DePristo af593094a2 Major improvements to HC that trims down active regions before genotyping
-- Trims down active regions and associated reads and haplotypes to a smaller interval based on the events actually in the haplotypes within the original active region (without extension).  Radically speeds up calculations when using large active region extensions.  The ActiveRegion.trim algorithm does the best job it can of trimming an active region down to a requested interval while ensuring the resulting active region has a region (and extension) no bigger than the original while spanning as much of the requested extend as possible.  The trimming results in an active region that is a subset of the previous active region based on the position and types of variants found among the haplotypes
-- Retire error corrector, archive old code and repurpose subsystem into a general kmer counter.  The previous error corrector was just broken (conceptually) and was disabled by default in the engine.  Now turning on error correction throws a UserException. Old part of the error corrector that counts kmers was extracted and put into KMerCounter.java
-- Add final simplify graph call after we prune away the non-reference paths in DeBruijnAssembler
2013-04-08 12:47:49 -04:00
Mark DePristo 4d389a8234 Optimizations for HC infrastructure
-- outgoingVerticesOf and incomingVerticesOf return a list not a set now, as the corresponding values must be unique since our super directed graph doesn't allow multiple edges between vertices
-- Make DeBruijnGraph, SeqGraph, SeqVertex, and DeBruijnVertex all final
-- Cache HashCode calculation in BaseVertex
-- Better docs before the pruneGraph call
2013-04-08 12:47:49 -04:00
Mark DePristo e916998784 Bugfix for head and tail merging code in SeqGraph
-- The previous version of the head merging (and tail merging to a lesser degree) would inappropriately merge source and sinks without sufficient evidence to do so.  This would introduce large deletion events at the start / end of the assemblies.  Refcatored code to require 20 bp of overlap in the head or tail nodes, as well as unit tested functions to support this.
2013-04-08 12:47:48 -04:00
Mark DePristo 2aac9e2782 More efficient ZipLinearChains algorithm
-- Goes through the graph looking for chains to zip, accumulates the vertices of the chains, and then finally go through and updates the graph in one big go.  Vastly more efficient than the previous version, but unfortunately doesn't actually work now
-- Also incorporate edge weight propagation into SeqGraph zipLinearChains.  The edge weights for all incoming and outgoing edges are now their previous value, plus the sum of the internal chain edges / n such edges
2013-04-08 12:47:48 -04:00
Mark DePristo f1d772ac25 LD-based merging algorithm for nearby events in the haplotypes
-- Moved R^2 LD haplotype merging system to the utils.haplotype package
-- New LD merging only enabled with HC argument.
-- EventExtractor and EventExtractorUnitTest refactors so we can test the block substitution code without having to enabled it via a static variable
-- A few misc. bug fixes in LDMerger itself
-- Refactoring of Haplotype event splitting and merging code
-- Renamed EventExtractor to EventMap
-- EventMap has a static method that computes the event maps among n haplotypes
-- Refactor Haplotype score and base comparators into their own classes and unit tested them
-- Refactored R^2 based LD merging code into its own class HaplotypeR2Calculator and unit tested much of it.
-- LDMerger now uses the HaplotypeR2Calculator, which cleans up the code a bunch and allowed me to easily test that code with a MockHaplotypeR2Calculator.  For those who haven't seen this testing idiom, have a look, and very useful
-- New algorithm uses a likelihood-ratio test to compute the probability that only the phased haplotypes exist in the population.
-- Fixed fundamental bug in the way the previous R^2 implementation worked
-- Optimizations for HaplotypeLDCalculator: only compute the per sample per haplotype summed likelihoods once, regardless of how many calls there are
-- Previous version would enter infinite loop if it merged two events but the second event had other low likelihood events in other haplotypes that didn't get removed.  Now when events are removed they are removed from all event maps, regardless of whether the haplotypes carry both events
-- Bugfixes for EventMap in the HaplotypeCaller as well.  Previous version was overly restrictive, requiring that the first event to make into a block substitution was a snp.  In some cases we need to merge an insertion with a deletion, such as when the cigar is 10M2I3D4M.  The new code supports this.  UnitTested and documented as well.  LDMerger handles case where merging two alleles results in a no-op event.  Merging CA/C + A/AA -> CAA/CAA -> no op.  Handles this case by removing the two events.  UnitTested
-- Turn off debugging output for the LDMerger in the HaplotypeCaller unless -debug was enabled
-- This new version does a much more specific test (that's actually right).  Here's the new algorithm:

     * Compute probability that two variants are in phase with each other and that no
     * compound hets exist in the population.
     *
     * Implemented as a likelihood ratio test of the hypothesis:
     *
     * x11 and x22 are the only haplotypes in the populations
     *
     * vs.
     *
     * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population.
     *
     * Now, since we have to have both variants in the population, we exclude the x11 & x11 state.  So the
     * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22).
     *
     * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are:
     *
     * - P(x11 & x12 & x21) -- we have hom-ref and both hets
     * - P(x22 & x12 & x21) -- we have hom-alt and both hets
     * - P(x22 & x12) -- one haplotype is 22 and the other is het 12
     * - P(x22 & x21) -- one haplotype is 22 and the other is het 21
2013-04-08 12:47:48 -04:00
Mark DePristo 67cd407854 The GenotypingEngine now uses the samples from the mapping of Samples -> PerReadAllele likelihoods instead of passing around a redundant list of samples 2013-04-08 12:47:47 -04:00
Mark DePristo 0310499b65 System to merge multiple nearby alleles into block substitutions
-- Block substitution algorithm that merges nearby events based on distance.
-- Also does some cleanup of GenotypingEngine
2013-04-08 12:47:47 -04:00
Mark DePristo bff13bb5c5 Move Haplotype class to its own package in utils 2013-04-08 12:47:47 -04:00
Mauricio Carneiro ebe2edbef3 Fix caching indices in the PairHMM
Problem:
--------
PairHMM was generating positive likelihoods (even after the re-work of the model)

Solution:
---------
The caching idices were never re-initializing the initial conditions in the first position of the deletion matrix. Also the match matrix was being wrongly initialized (there is not necessarily a match in the first position). This commit fixes both issues on both the Logless and the Log10 versions of the PairHMM.

Summarized Changes:
------------------
* Redesign the matrices to have only 1 col/row of padding instead of 2.
* PairHMM class now owns the caching of the haplotype (keeps track of last haplotypes, and decides where the caching should start)
* Initial condition (in the deletionMatrix) is now updated every time the haplotypes differ in length (this was wrong in the previous version)
* Adjust the prior and probability matrices to be one based (logless)
* Update Log10PairHMM to work with prior and probability matrices as well
* Move prior and probability matrices to parent class
* Move and rename padded lengths to parent class to simplify interface and prevent off by one errors in new implementations
* Simple cleanup of PairHMMUnitTest class for a little speedup
* Updated HC and UG integration test MD5's because of the new initialization (without enforcing match on first base).
* Create static indices for the transition probabilities (for better readability)

[fixes #47399227]
2013-04-08 11:05:12 -04:00
Eric Banks 6253ba164e Using --keepOriginalAC in SelectVariants was causing it to emit bad VCFs
* This occurred when one or more alleles were lost from the record after selection
  * Discussed here: http://gatkforums.broadinstitute.org/discussion/comment/4718#Comment_4718
  * Added some integration tests for --keepOriginalAC (there were none before)
2013-04-05 00:53:28 -04:00
Eric Banks 7897d52f32 Don't allow users to specify keys and IDs that contain angle brackets or equals signs (not allowed in VCF spec).
* As reported here: http://gatkforums.broadinstitute.org/discussion/comment/4270#Comment_4270
  * This was a commit into the variant.jar; the changes here are a rev of that jar and handling of errors in VF
  * Added integration test to confirm failure with User Error
  * Removed illegal header line in KB test VCF that was causing related tests to fail.
2013-04-05 00:52:32 -04:00
Ryan Poplin 8a93bb687b Critical bug fix for the case of duplicate map calls in ActiveRegionWalkers with exome interval lists.
-- When consecutive intervals were within the bandpass filter size the ActiveRegion traversal engine would create
duplicate active regions.
-- Now when flushing the activity profile after we jump to a new interval we remove the extra states which are outside
of the current interval.
-- Added integration test which ensures that the output VCF contains no duplicate records. Was failing test before this commit.
2013-04-03 13:15:30 -04:00
Mark DePristo bb42c90f2b Use LinkedHashSets in incoming and outgoing vertex functions in BaseGraph
-- Using a LinkedHashSet changed the md5 for HCTestComplexVariants.
2013-04-02 17:58:20 -04:00
David Roazen b4b58a3968 Fix unprintable character in a comment from the BaseEdge class
Compiler warnings about this were starting to get to me...
2013-04-02 14:24:23 -04:00
Mark DePristo c191d7de8c Critical bugfix for CommonSuffixSplitter
-- Graphs with cycles from the bottom node to one of the middle nodes would introduce an infinite cycle in the algorithm.  Created unit test that reproduced the issue, and then fixed the underlying issue.
2013-04-02 09:22:33 -04:00
Ryan Poplin a58a3e7e1e Merge pull request #134 from broadinstitute/mc_phmm_experiments
PairHMM rework
2013-04-01 12:10:43 -07:00
Ryan Poplin f65206e758 Two changes to HC GGA mode to make it more like the UG.
-- Only try to genotype PASSing records in the alleles file
-- Don't attempt to genotype multiple records with the same start location. Instead take the first record and throw a warning message.
2013-04-01 10:20:23 -04:00
Mark DePristo 7c83efc1b9 Merge pull request #135 from broadinstitute/mc_pgtag_fix
Fixing @PG tag uniqueness issue
2013-03-31 11:36:40 -07:00
Eric Banks 7dd58f671f Merge pull request #132 from broadinstitute/gda_filter_unmasked_sites
Added small feature to VariantFiltration to filter sites outside of a gi...
2013-03-31 06:27:26 -07:00
Guillermo del Angel 9686e91a51 Added small feature to VariantFiltration to filter sites outside of a given mask:
-- Sometimes it's desireable to specify a set of "good" regions and filter out other stuff (like say an alignability mask or a "good regions" mask). But by default, the -mask argument in VF will only filter sites inside a particular mask. New argument -filterNotInMask will reverse default logic and filter outside of a given mask.
-- Added integration test, and made sure we also test with a BED rod.
2013-03-31 08:48:16 -04:00
Eric Banks 8e2094d2af Updated AssessReducedQuals and applied it systematically to all ReduceReads integration tests.
* Moved to protected for packaging purposes.
  * Cleaned up and removed debugging output.
  * Fixed logic for epsilons so that we really only test significant differences between BAMs.
  * Other small fixes (e.g. don't include low quality reduced reads in overall qual).
  * Most RR integration tests now automatically run the quals test on output.
    * A few are disabled because we expect them to fail in various locations (e.g. due to downsampling).
2013-03-31 00:27:14 -04:00
Mauricio Carneiro ec475a46b1 Fixing @PG tag uniqueness issue
The Problem:
------------
the SAM spec does not allow multiple @PG tags with the same id. Our @PG tag writing routines were allowing that to happen with the boolean parameter "keep_all_pg_records".

How this fixes it:
------------------
This commit removes that option from all the utility functions and cleans up the code around the classes that used these methods off-spec.

Summarized changes:
-------------------
* Remove keep_all_pg_records option from setupWriter utility methos in Util
* Update all walkers to now replace the last @PG tag of the same walker (if it already exists)
* Cleanup NWaySamFileWriter now that it doesn't need to keep track of the keep_all_pg_records variable
* Simplify the multiple implementations to setupWriter

Bamboo:
-------
http://gsabamboo.broadinstitute.org/browse/GSAUNSTABLE-PARALLEL31

Issue Tracker:
--------------
[fixes 47100885]
2013-03-30 20:31:33 -04:00
Mauricio Carneiro 68bf470524 making LoglessPairHMM final 2013-03-30 20:00:45 -04:00
Guillermo del Angel 6b8bed34d0 Big bad bug fix: feature added to LeftAlignAndTrimVariants to left align multiallelic records didn't work.
-- Corrected logic to pick biallelic vc to left align.
-- Added integration test to make sure this feature is tested and feature to trim bases is also tested.
2013-03-30 19:31:28 -04:00