diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedArgumentCollection.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedArgumentCollection.java index 9f606cdfb..93f5c0a43 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedArgumentCollection.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedArgumentCollection.java @@ -137,11 +137,11 @@ public class UnifiedArgumentCollection { @Hidden @Argument(fullName = "indelGapContinuationPenalty", shortName = "indelGCP", doc = "Indel gap continuation penalty", required = false) - public double INDEL_GAP_CONTINUATION_PENALTY = 10.0; + public byte INDEL_GAP_CONTINUATION_PENALTY = 10; @Hidden @Argument(fullName = "indelGapOpenPenalty", shortName = "indelGOP", doc = "Indel gap open penalty", required = false) - public double INDEL_GAP_OPEN_PENALTY = 45.0; + public byte INDEL_GAP_OPEN_PENALTY = 45; @Hidden @Argument(fullName = "indelHaplotypeSize", shortName = "indelHSize", doc = "Indel haplotype size", required = false) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/PairHMMIndelErrorModel.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/PairHMMIndelErrorModel.java index 890ed9e3d..171c42040 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/PairHMMIndelErrorModel.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/PairHMMIndelErrorModel.java @@ -31,7 +31,9 @@ import net.sf.samtools.CigarOperator; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.utils.Haplotype; import org.broadinstitute.sting.utils.MathUtils; +import org.broadinstitute.sting.utils.PairHMM; import org.broadinstitute.sting.utils.clipping.ReadClipper; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; @@ -41,13 +43,14 @@ import org.broadinstitute.sting.utils.variantcontext.Allele; import java.util.Arrays; import java.util.HashMap; import java.util.LinkedHashMap; +import java.util.Map; public class PairHMMIndelErrorModel { public static final int BASE_QUAL_THRESHOLD = 20; private boolean DEBUG = false; - private boolean bandedLikelihoods = false; + private boolean bandedLikelihoods = true; private static final int MAX_CACHED_QUAL = 127; @@ -60,12 +63,12 @@ public class PairHMMIndelErrorModel { private static final int START_HRUN_GAP_IDX = 4; private static final int MAX_HRUN_GAP_IDX = 20; - private static final double MIN_GAP_OPEN_PENALTY = 30.0; - private static final double MIN_GAP_CONT_PENALTY = 10.0; - private static final double GAP_PENALTY_HRUN_STEP = 1.0; // each increase in hrun decreases gap penalty by this. + private static final byte MIN_GAP_OPEN_PENALTY = 30; + private static final byte MIN_GAP_CONT_PENALTY = 10; + private static final byte GAP_PENALTY_HRUN_STEP = 1; // each increase in hrun decreases gap penalty by this. - private final double[] GAP_OPEN_PROB_TABLE; - private final double[] GAP_CONT_PROB_TABLE; + private final byte[] GAP_OPEN_PROB_TABLE; + private final byte[] GAP_CONT_PROB_TABLE; ///////////////////////////// // Private Member Variables @@ -86,42 +89,42 @@ public class PairHMMIndelErrorModel { } } - public PairHMMIndelErrorModel(double indelGOP, double indelGCP, boolean deb, boolean bandedLikelihoods) { + public PairHMMIndelErrorModel(byte indelGOP, byte indelGCP, boolean deb, boolean bandedLikelihoods) { this.DEBUG = deb; - this.bandedLikelihoods = bandedLikelihoods; + //this.bandedLikelihoods = bandedLikelihoods; // fill gap penalty table, affine naive model: - this.GAP_CONT_PROB_TABLE = new double[MAX_HRUN_GAP_IDX]; - this.GAP_OPEN_PROB_TABLE = new double[MAX_HRUN_GAP_IDX]; + this.GAP_CONT_PROB_TABLE = new byte[MAX_HRUN_GAP_IDX]; + this.GAP_OPEN_PROB_TABLE = new byte[MAX_HRUN_GAP_IDX]; - double gop = -indelGOP/10.0; - double gcp = -indelGCP/10.0; for (int i = 0; i < START_HRUN_GAP_IDX; i++) { - GAP_OPEN_PROB_TABLE[i] = gop; - GAP_CONT_PROB_TABLE[i] = gcp; + GAP_OPEN_PROB_TABLE[i] = indelGOP; + GAP_CONT_PROB_TABLE[i] = indelGCP; } double step = GAP_PENALTY_HRUN_STEP/10.0; - double maxGOP = -MIN_GAP_OPEN_PENALTY/10.0; // phred to log prob - double maxGCP = -MIN_GAP_CONT_PENALTY/10.0; // phred to log prob + // initialize gop and gcp to their default values + byte gop = indelGOP; + byte gcp = indelGCP; + // all of the following is computed in QUal-space for (int i=START_HRUN_GAP_IDX; i < MAX_HRUN_GAP_IDX; i++) { - gop += step; - if (gop > maxGOP) - gop = maxGOP; + gop -= GAP_PENALTY_HRUN_STEP; + if (gop < MIN_GAP_OPEN_PENALTY) + gop = MIN_GAP_OPEN_PENALTY; - gcp += step; - if(gcp > maxGCP) - gcp = maxGCP; + gcp -= step; + if(gcp < MIN_GAP_CONT_PENALTY) + gcp = MIN_GAP_CONT_PENALTY; GAP_OPEN_PROB_TABLE[i] = gop; GAP_CONT_PROB_TABLE[i] = gcp; } } - static private void getContextHomopolymerLength(final byte[] refBytes, int[] hrunArray) { + static private void getContextHomopolymerLength(final byte[] refBytes, final int[] hrunArray) { // compute forward hrun length, example: // AGGTGACCCCCCTGAGAG // 001000012345000000 @@ -155,7 +158,7 @@ public class PairHMMIndelErrorModel { private void updateCell(final int indI, final int indJ, final int X_METRIC_LENGTH, final int Y_METRIC_LENGTH, byte[] readBases, byte[] readQuals, byte[] haplotypeBases, - double[] currentGOP, double[] currentGCP, double[][] matchMetricArray, double[][] XMetricArray, double[][] YMetricArray) { + byte[] currentGOP, byte[] currentGCP, double[][] matchMetricArray, double[][] XMetricArray, double[][] YMetricArray) { if (indI > 0 && indJ > 0) { final int im1 = indI -1; final int jm1 = indJ - 1; @@ -168,20 +171,20 @@ public class PairHMMIndelErrorModel { matchMetricArray[indI][indJ] = pBaseRead + MathUtils.approximateLog10SumLog10(new double[]{matchMetricArray[im1][jm1], XMetricArray[im1][jm1], YMetricArray[im1][jm1]}); - final double c1 = indJ == Y_METRIC_LENGTH-1 ? END_GAP_COST : currentGOP[jm1]; - final double d1 = indJ == Y_METRIC_LENGTH-1 ? END_GAP_COST : currentGCP[jm1]; + final double c1 = indJ == Y_METRIC_LENGTH-1 ? END_GAP_COST : -(double)currentGOP[im1]/10.0; + final double d1 = indJ == Y_METRIC_LENGTH-1 ? END_GAP_COST : -(double)currentGCP[im1]/10.0; XMetricArray[indI][indJ] = MathUtils.approximateLog10SumLog10(matchMetricArray[im1][indJ] + c1, XMetricArray[im1][indJ] + d1); // update Y array - final double c2 = indI == X_METRIC_LENGTH-1 ? END_GAP_COST : currentGOP[jm1]; - final double d2 = indI == X_METRIC_LENGTH-1 ? END_GAP_COST : currentGCP[jm1]; + final double c2 = indI == X_METRIC_LENGTH-1 ? END_GAP_COST : -(double)currentGOP[im1]/10.0; + final double d2 = indI == X_METRIC_LENGTH-1 ? END_GAP_COST : -(double)currentGCP[im1]/10.0; YMetricArray[indI][indJ] = MathUtils.approximateLog10SumLog10(matchMetricArray[indI][jm1] + c2, YMetricArray[indI][jm1] + d2); } } private double computeReadLikelihoodGivenHaplotypeAffineGaps(byte[] haplotypeBases, byte[] readBases, byte[] readQuals, - double[] currentGOP, double[] currentGCP, int indToStart, + byte[] currentGOP, byte[] currentGCP, int indToStart, double[][] matchMetricArray, double[][] XMetricArray, double[][] YMetricArray) { final int X_METRIC_LENGTH = readBases.length+1; @@ -349,8 +352,9 @@ public class PairHMMIndelErrorModel { } - private void fillGapProbabilities(int[] hrunProfile, - double[] contextLogGapOpenProbabilities, double[] contextLogGapContinuationProbabilities) { + private void fillGapProbabilities(final int[] hrunProfile, + final byte[] contextLogGapOpenProbabilities, + final byte[] contextLogGapContinuationProbabilities) { // fill based on lookup table for (int i = 0; i < hrunProfile.length; i++) { if (hrunProfile[i] >= MAX_HRUN_GAP_IDX) { @@ -372,27 +376,8 @@ public class PairHMMIndelErrorModel { final int readCounts[] = new int[pileup.getNumberOfElements()]; int readIdx=0; - LinkedHashMap gapOpenProbabilityMap = new LinkedHashMap(); - LinkedHashMap gapContProbabilityMap = new LinkedHashMap(); - - // will context dependent probabilities based on homopolymer run. Probabilities are filled based on total complete haplotypes. - // todo -- refactor into separate function - for (Allele a: haplotypeMap.keySet()) { - Haplotype haplotype = haplotypeMap.get(a); - byte[] haplotypeBases = haplotype.getBases(); - double[] contextLogGapOpenProbabilities = new double[haplotypeBases.length]; - double[] contextLogGapContinuationProbabilities = new double[haplotypeBases.length]; - - // get homopolymer length profile for current haplotype - int[] hrunProfile = new int[haplotypeBases.length]; - getContextHomopolymerLength(haplotypeBases,hrunProfile); - fillGapProbabilities(hrunProfile, contextLogGapOpenProbabilities, contextLogGapContinuationProbabilities); - - gapOpenProbabilityMap.put(a,contextLogGapOpenProbabilities); - gapContProbabilityMap.put(a,contextLogGapContinuationProbabilities); - - } + PairHMM pairHMM = new PairHMM(bandedLikelihoods); for (PileupElement p: pileup) { // > 1 when the read is a consensus read representing multiple independent observations readCounts[readIdx] = p.getRepresentativeCount(); @@ -408,12 +393,27 @@ public class PairHMMIndelErrorModel { else { // System.out.format("%d %s\n",p.getRead().getAlignmentStart(), p.getRead().getClass().getName()); GATKSAMRecord read = ReadClipper.hardClipAdaptorSequence(p.getRead()); + if (read.isEmpty()) continue; - if(ReadUtils.is454Read(read)) { + if (read.getUnclippedEnd() > ref.getWindow().getStop()) + read = ReadClipper.hardClipByReferenceCoordinatesRightTail(read, ref.getWindow().getStop()); + + if (read.isEmpty()) continue; - } + + if (read.getUnclippedStart() < ref.getWindow().getStart()) + read = ReadClipper.hardClipByReferenceCoordinatesLeftTail (read, ref.getWindow().getStart()); + + if (read.isEmpty()) + continue; + // hard-clip low quality ends - this may introduce extra H elements in CIGAR string + read = ReadClipper.hardClipLowQualEnds(read,(byte)BASE_QUAL_THRESHOLD ); + + if (read.isEmpty()) + continue; + // get bases of candidate haplotypes that overlap with reads final int trailingBases = 3; @@ -469,54 +469,56 @@ public class PairHMMIndelErrorModel { unclippedReadBases = read.getReadBases(); unclippedReadQuals = read.getBaseQualities(); - // Do a stricter base clipping than provided by CIGAR string, since this one may be too conservative, - // and may leave a string of Q2 bases still hanging off the reads. - for (int i=numStartSoftClippedBases; i < unclippedReadBases.length; i++) { - if (unclippedReadQuals[i] < BASE_QUAL_THRESHOLD) - numStartClippedBases++; - else - break; + final int extraOffset = Math.abs(eventLength); - } - for (int i=unclippedReadBases.length-numEndSoftClippedBases-1; i >= 0; i-- ){ - if (unclippedReadQuals[i] < BASE_QUAL_THRESHOLD) - numEndClippedBases++; - else - break; - } + /** + * Compute genomic locations that candidate haplotypes will span. + * Read start and stop locations (variables readStart and readEnd) are the original unclipped positions from SAMRecord, + * adjusted by hard clips from Cigar string and by qual-based soft-clipping performed above. + * We will propose haplotypes that overlap the read with some padding. + * True read start = readStart + numStartClippedBases - ReadUtils.getFirstInsertionOffset(read) + * Last term is because if a read starts with an insertion then these bases are not accounted for in readStart. + * trailingBases is a padding constant(=3) and we additionally add abs(eventLength) to both sides of read to be able to + * differentiate context between two haplotypes + */ + long startLocationInRefForHaplotypes = Math.max(readStart + numStartClippedBases - trailingBases - ReadUtils.getFirstInsertionOffset(read)-extraOffset, 0); + long stopLocationInRefForHaplotypes = readEnd -numEndClippedBases + trailingBases + ReadUtils.getLastInsertionOffset(read)+extraOffset; - int extraOffset = Math.abs(eventLength); + if (DEBUG) + System.out.format("orig Start:%d orig stop: %d\n", startLocationInRefForHaplotypes, stopLocationInRefForHaplotypes); - long start = Math.max(readStart + numStartClippedBases - trailingBases - ReadUtils.getFirstInsertionOffset(read)-extraOffset, 0); - long stop = readEnd -numEndClippedBases + trailingBases + ReadUtils.getLastInsertionOffset(read)+extraOffset; - - // Variables start and stop are coordinates (inclusive) where we want to get the haplotype from. int readLength = read.getReadLength()-numStartSoftClippedBases-numEndSoftClippedBases; // check if start of read will be before start of reference context - if (start < ref.getWindow().getStart())// read starts before haplotype: read will have to be cut - start = ref.getWindow().getStart(); - + if (startLocationInRefForHaplotypes < ref.getWindow().getStart()) { + // read starts before haplotype: read will have to be cut + //numStartClippedBases += ref.getWindow().getStart() - startLocationInRefForHaplotypes; + startLocationInRefForHaplotypes = ref.getWindow().getStart(); + } // check also if end of read will go beyond reference context - if (stop > ref.getWindow().getStop()) - stop = ref.getWindow().getStop(); + if (stopLocationInRefForHaplotypes > ref.getWindow().getStop()) { + //numEndClippedBases += stopLocationInRefForHaplotypes - ref.getWindow().getStop(); + stopLocationInRefForHaplotypes = ref.getWindow().getStop(); + } - // if there's an insertion in the read, the read stop position will be less than start + read length, + // if there's an insertion in the read, the read stop position will be less than start + read legnth, // but we want to compute likelihoods in the whole region that a read might overlap - if (stop <= start + readLength) { - stop = start + readLength-1; + if (stopLocationInRefForHaplotypes <= startLocationInRefForHaplotypes + readLength) { + stopLocationInRefForHaplotypes = startLocationInRefForHaplotypes + readLength-1; } // ok, we now figured out total number of clipped bases on both ends. // Figure out where we want to place the haplotype to score read against - /* - if (DEBUG) - System.out.format("numStartClippedBases: %d numEndClippedBases: %d WinStart:%d WinStop:%d start: %d stop: %d readLength: %d\n", - numStartClippedBases, numEndClippedBases, ref.getWindow().getStart(), ref.getWindow().getStop(), start, stop, read.getReadLength()); - */ + + if (DEBUG) + System.out.format("numStartClippedBases: %d numEndClippedBases: %d WinStart:%d WinStop:%d start: %d stop: %d readLength: %d\n", + numStartClippedBases, numEndClippedBases, ref.getWindow().getStart(), ref.getWindow().getStop(), startLocationInRefForHaplotypes, stopLocationInRefForHaplotypes, read.getReadLength()); LinkedHashMap readEl = new LinkedHashMap(); + /** + * Check if we'll end up with an empty read once all clipping is done + */ if (numStartClippedBases + numEndClippedBases >= unclippedReadBases.length) { int j=0; for (Allele a: haplotypeMap.keySet()) { @@ -537,67 +539,81 @@ public class PairHMMIndelErrorModel { // initialize path metric and traceback memories for likelihood computation double[][] matchMetricArray = null, XMetricArray = null, YMetricArray = null; byte[] previousHaplotypeSeen = null; - double[] previousGOP = null; - double[] previousGCP = null; - int startIdx; + int startIndexInHaplotype = 0; + final byte[] contextLogGapOpenProbabilities = new byte[readBases.length]; + final byte[] contextLogGapContinuationProbabilities = new byte[readBases.length]; + + // get homopolymer length profile for current haplotype + int[] hrunProfile = new int[readBases.length]; + getContextHomopolymerLength(readBases,hrunProfile); + fillGapProbabilities(hrunProfile, contextLogGapOpenProbabilities, contextLogGapContinuationProbabilities); + + for (Allele a: haplotypeMap.keySet()) { - Haplotype haplotype = haplotypeMap.get(a); - if (stop > haplotype.getStopPosition()) - stop = haplotype.getStopPosition(); - if (start < haplotype.getStartPosition()) - start = haplotype.getStartPosition(); + if (stopLocationInRefForHaplotypes > haplotype.getStopPosition()) + stopLocationInRefForHaplotypes = haplotype.getStopPosition(); - // cut haplotype bases - long indStart = start - haplotype.getStartPosition(); - long indStop = stop - haplotype.getStartPosition(); + if (startLocationInRefForHaplotypes < haplotype.getStartPosition()) + startLocationInRefForHaplotypes = haplotype.getStartPosition(); + + final long indStart = startLocationInRefForHaplotypes - haplotype.getStartPosition(); + final long indStop = stopLocationInRefForHaplotypes - haplotype.getStartPosition(); double readLikelihood; if (DEBUG) System.out.format("indStart: %d indStop: %d WinStart:%d WinStop:%d start: %d stop: %d readLength: %d C:%s\n", - indStart, indStop, ref.getWindow().getStart(), ref.getWindow().getStop(), start, stop, read.getReadLength(), read.getCigar().toString()); + indStart, indStop, ref.getWindow().getStart(), ref.getWindow().getStop(), startLocationInRefForHaplotypes, stopLocationInRefForHaplotypes, read.getReadLength(), read.getCigar().toString()); + if (indStart < 0 || indStop >= haplotype.getBases().length || indStart > indStop) { // read spanned more than allowed reference context: we currently can't deal with this - readLikelihood =0; + throw new ReviewedStingException("BUG! bad read clipping"); +// readLikelihood =0; } else { final byte[] haplotypeBases = Arrays.copyOfRange(haplotype.getBases(), (int)indStart, (int)indStop); - if (matchMetricArray == null) { - final int X_METRIC_LENGTH = readBases.length+1; - final int Y_METRIC_LENGTH = haplotypeBases.length+1; + final int X_METRIC_LENGTH = readBases.length+1; + final int Y_METRIC_LENGTH = haplotypeBases.length+1; + if (matchMetricArray == null) { + //no need to reallocate arrays for each new haplotype, as length won't change matchMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH]; XMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH]; YMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH]; + } - final double[] currentContextGOP = Arrays.copyOfRange(gapOpenProbabilityMap.get(a), (int)indStart, (int)indStop); - final double[] currentContextGCP = Arrays.copyOfRange(gapContProbabilityMap.get(a), (int)indStart, (int)indStop); + + pairHMM.initializeArrays(matchMetricArray, XMetricArray, YMetricArray, X_METRIC_LENGTH); + + /* if (previousHaplotypeSeen == null) - startIdx = 0; - else { - final int s1 = computeFirstDifferingPosition(haplotypeBases, previousHaplotypeSeen); - final int s2 = computeFirstDifferingPosition(currentContextGOP, previousGOP); - final int s3 = computeFirstDifferingPosition(currentContextGCP, previousGCP); - startIdx = Math.min(Math.min(s1, s2), s3); - } + startIndexInHaplotype = 0; + else + startIndexInHaplotype = 0; //computeFirstDifferingPosition(haplotypeBases, previousHaplotypeSeen); + previousHaplotypeSeen = haplotypeBases.clone(); - previousGOP = currentContextGOP.clone(); - previousGCP = currentContextGCP.clone(); + */ + readLikelihood = pairHMM.computeReadLikelihoodGivenHaplotype(haplotypeBases, readBases, readQuals, + contextLogGapOpenProbabilities, contextLogGapOpenProbabilities, contextLogGapContinuationProbabilities, + startIndexInHaplotype, matchMetricArray, XMetricArray, YMetricArray); + /* double r2 = computeReadLikelihoodGivenHaplotypeAffineGaps(haplotypeBases, readBases, readQuals, contextLogGapOpenProbabilities, + contextLogGapContinuationProbabilities, 0, matchMetricArray, XMetricArray, YMetricArray); - readLikelihood = computeReadLikelihoodGivenHaplotypeAffineGaps(haplotypeBases, readBases, readQuals, - currentContextGOP, currentContextGCP, startIdx, matchMetricArray, XMetricArray, YMetricArray); - - if (DEBUG) { + if (readLikelihood > 0) { + int k=0; + } + */ if (DEBUG) { System.out.println("H:"+new String(haplotypeBases)); System.out.println("R:"+new String(readBases)); System.out.format("L:%4.2f\n",readLikelihood); - System.out.format("StPos:%d\n", startIdx); + // System.out.format("Lorig:%4.2f\n",r2); + System.out.format("StPos:%d\n", startIndexInHaplotype); } } readEl.put(a,readLikelihood); diff --git a/public/java/src/org/broadinstitute/sting/utils/PairHMM.java b/public/java/src/org/broadinstitute/sting/utils/PairHMM.java new file mode 100644 index 000000000..7d393274a --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/PairHMM.java @@ -0,0 +1,255 @@ +/* + * Copyright (c) 2012, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.utils; + +import com.google.java.contract.Ensures; +import com.google.java.contract.Requires; + +import java.util.*; + +/** + * Util class for performing the pair HMM for local alignment. Figure 4.3 in Durbin 1998 book. + * User: rpoplin + * Date: 3/1/12 + */ + +public class PairHMM { + private static final int MAX_CACHED_QUAL = (int)Byte.MAX_VALUE; + private static final byte DEFAULT_GOP = (byte) 45; + private static final byte DEFAULT_GCP = (byte) 10; + private static final double BANDING_TOLERANCE = 22.0; + private static final int BANDING_CLUSTER_WINDOW = 12; + private final boolean doBanded; + + public PairHMM() { + doBanded = false; + } + + public PairHMM( final boolean doBanded ) { + this.doBanded = doBanded; + } + + + public void initializeArrays(final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray, + final int X_METRIC_LENGTH) { + + for( int iii=0; iii < X_METRIC_LENGTH; iii++ ) { + Arrays.fill(matchMetricArray[iii], Double.NEGATIVE_INFINITY); + Arrays.fill(XMetricArray[iii], Double.NEGATIVE_INFINITY); + Arrays.fill(YMetricArray[iii], Double.NEGATIVE_INFINITY); + } + + // the initial condition + matchMetricArray[1][1] = 0.0; // Math.log10(1.0); + + } + + @Requires({"readBases.length == readQuals.length","readBases.length == insertionGOP.length","readBases.length == deletionGOP.length","readBases.length == overallGCP.length"}) + @Ensures({"!Double.isInfinite(result)", "!Double.isNaN(result)"}) // Result should be a proper log10 probability + public double computeReadLikelihoodGivenHaplotype( final byte[] haplotypeBases, final byte[] readBases, final byte[] readQuals, + final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP ) { + + // M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions + final int X_METRIC_LENGTH = readBases.length + 1; + final int Y_METRIC_LENGTH = haplotypeBases.length + 1; + + // initial arrays to hold the probabilities of being in the match, insertion and deletion cases + final double[][] matchMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH]; + final double[][] XMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH]; + final double[][] YMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH]; + + initializeArrays(matchMetricArray, XMetricArray, YMetricArray, X_METRIC_LENGTH); + + return computeReadLikelihoodGivenHaplotype(haplotypeBases, readBases, readQuals, insertionGOP, deletionGOP, overallGCP, 0, matchMetricArray, XMetricArray, YMetricArray); + } + + @Requires({"readBases.length == readQuals.length","readBases.length == insertionGOP.length","readBases.length == deletionGOP.length","readBases.length == overallGCP.length"}) + @Ensures({"!Double.isInfinite(result)", "!Double.isNaN(result)"}) // Result should be a proper log10 probability + public double computeReadLikelihoodGivenHaplotype( final byte[] haplotypeBases, final byte[] readBases, final byte[] readQuals, + final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP, final int hapStartIndex, + final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) { + + // M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions + final int X_METRIC_LENGTH = readBases.length + 1; + final int Y_METRIC_LENGTH = haplotypeBases.length + 1; + + if( doBanded ) { + final ArrayList workQueue = new ArrayList(); // holds a queue of starting work location (indices along the diagonal). Will be sorted each step + final ArrayList workToBeAdded = new ArrayList(); + final ArrayList calculatedValues = new ArrayList(); + final int numDiags = X_METRIC_LENGTH + Y_METRIC_LENGTH - 1; + workQueue.add( 1 ); // Always start a new thread at the baseline because of partially repeating sequences that match better in the latter half of the haplotype + + for(int diag = 3; diag < numDiags; diag++) { // diag = 3 is the (1,2) element of the metric arrays. (1,1) is the initial condition and is purposefully skipped over + //Collections.sort(workQueue); // no need to sort because elements are guaranteed to be in ascending order + int el = 1; + for( int work : workQueue ) { + // choose the appropriate diagonal baseline location + int iii = 0; + int jjj = diag; + if( diag > Y_METRIC_LENGTH ) { + iii = diag - Y_METRIC_LENGTH; + jjj = Y_METRIC_LENGTH; + } + // move to the starting work location along the diagonal + iii += work; + jjj -= work; + while( iii >= X_METRIC_LENGTH || jjj <= 0 ) { + iii--; + jjj++; + work--; + } + if( !detectClusteredStartLocations(workToBeAdded, work ) ) { + workToBeAdded.add(work); // keep this thread going once it has started + } + + if( work >= el - 3 ) { + // step along the diagonal in the forward direction, updating the match matrices and looking for a drop off from the maximum observed value + double maxElement = Double.NEGATIVE_INFINITY; + for( el = work; el < numDiags + 1; el++ ) { + updateCell(iii, jjj, haplotypeBases, readBases, readQuals, + insertionGOP, deletionGOP, overallGCP, matchMetricArray, XMetricArray, YMetricArray); + final double bestMetric = MathUtils.max(matchMetricArray[iii][jjj], XMetricArray[iii][jjj], YMetricArray[iii][jjj]); + calculatedValues.add(bestMetric); + if( bestMetric > maxElement ) { + maxElement = bestMetric; + } else if( maxElement - bestMetric > BANDING_TOLERANCE ) { + break; + } + if( ++iii >= X_METRIC_LENGTH ) { // don't walk off the edge of the matrix + break; + } + if( --jjj <= 0 ) { // don't walk off the edge of the matrix + break; + } + } + + // find a local maximum to start a new band in the work queue + double localMaxElement = Double.NEGATIVE_INFINITY; + int localMaxElementIndex = 0; + for(int kkk = calculatedValues.size()-1; kkk >= 1; kkk--) { + final double bestMetric = calculatedValues.get(kkk); + if( bestMetric > localMaxElement ) { + localMaxElement = bestMetric; + localMaxElementIndex = kkk; + } else if( localMaxElement - bestMetric > BANDING_TOLERANCE * 0.5 ) { // find a local maximum + if( !detectClusteredStartLocations(workToBeAdded, work + localMaxElementIndex ) ) { + workToBeAdded.add( work + localMaxElementIndex ); + } + break; + } + } + calculatedValues.clear(); + + // reset iii and jjj to the appropriate diagonal baseline location + iii = 0; + jjj = diag; + if( diag > Y_METRIC_LENGTH ) { + iii = diag - Y_METRIC_LENGTH; + jjj = Y_METRIC_LENGTH; + } + // move to the starting work location along the diagonal + iii += work-1; + jjj -= work-1; + + // step along the diagonal in the reverse direction, updating the match matrices and looking for a drop off from the maximum observed value + for( int traceBack = work - 1; traceBack > 0 && iii > 0 && jjj < Y_METRIC_LENGTH; traceBack--,iii--,jjj++ ) { + updateCell(iii, jjj, haplotypeBases, readBases, readQuals, + insertionGOP, deletionGOP, overallGCP, matchMetricArray, XMetricArray, YMetricArray); + final double bestMetric = MathUtils.max(matchMetricArray[iii][jjj], XMetricArray[iii][jjj], YMetricArray[iii][jjj]); + if( bestMetric > maxElement ) { + maxElement = bestMetric; + } else if( maxElement - bestMetric > BANDING_TOLERANCE ) { + break; + } + } + } + } + workQueue.clear(); + workQueue.addAll(workToBeAdded); + workToBeAdded.clear(); + } + } else { + // simple rectangular version of update loop, slow + for( int iii = 1; iii < X_METRIC_LENGTH; iii++ ) { + for( int jjj = hapStartIndex + 1; jjj < Y_METRIC_LENGTH; jjj++ ) { + if( (iii == 1 && jjj == 1) ) { continue; } + updateCell(iii, jjj, haplotypeBases, readBases, readQuals, insertionGOP, deletionGOP, overallGCP, + matchMetricArray, XMetricArray, YMetricArray); + } + } + } + + // final probability is the log10 sum of the last element in all three state arrays + final int endI = X_METRIC_LENGTH - 1; + final int endJ = Y_METRIC_LENGTH - 1; + return MathUtils.approximateLog10SumLog10(new double[]{matchMetricArray[endI][endJ], XMetricArray[endI][endJ], YMetricArray[endI][endJ]}); + } + + private void updateCell( final int indI, final int indJ, final byte[] haplotypeBases, final byte[] readBases, + final byte[] readQuals, final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP, + final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) { + + // the read and haplotype indices are offset by one because the state arrays have an extra column to hold the initial conditions + final int im1 = indI - 1; + final int jm1 = indJ - 1; + + // update the match array + double pBaseReadLog10 = 0.0; // Math.log10(1.0); + if( im1 > 0 && jm1 > 0 ) { // the emission probability is applied when leaving the state + final byte x = readBases[im1-1]; + final byte y = haplotypeBases[jm1-1]; + final byte qual = ( readQuals[im1-1] < QualityUtils.MIN_USABLE_Q_SCORE ? QualityUtils.MIN_USABLE_Q_SCORE : (readQuals[im1-1] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : readQuals[im1-1]) ); + pBaseReadLog10 = ( x == y || x == (byte) 'N' || y == (byte) 'N' ? QualityUtils.qualToProbLog10(qual) : QualityUtils.qualToErrorProbLog10(qual) ); + } + final int qualIndexGOP = ( im1 == 0 ? DEFAULT_GOP + DEFAULT_GOP : ( insertionGOP[im1-1] + deletionGOP[im1-1] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : insertionGOP[im1-1] + deletionGOP[im1-1]) ); + final double d0 = QualityUtils.qualToProbLog10((byte)qualIndexGOP); + final double e0 = ( im1 == 0 ? QualityUtils.qualToProbLog10(DEFAULT_GCP) : QualityUtils.qualToProbLog10(overallGCP[im1-1]) ); + matchMetricArray[indI][indJ] = pBaseReadLog10 + MathUtils.approximateLog10SumLog10( + new double[]{matchMetricArray[indI-1][indJ-1] + d0, XMetricArray[indI-1][indJ-1] + e0, YMetricArray[indI-1][indJ-1] + e0}); + + // update the X (insertion) array + final double d1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GOP) : QualityUtils.qualToErrorProbLog10(insertionGOP[im1-1]) ); + final double e1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GCP) : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]) ); + final double qBaseReadLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0 + XMetricArray[indI][indJ] = qBaseReadLog10 + MathUtils.approximateLog10SumLog10(matchMetricArray[indI-1][indJ] + d1, XMetricArray[indI-1][indJ] + e1); + + // update the Y (deletion) array, with penalty of zero on the left and right flanks to allow for a local alignment within the haplotype + final double d2 = ( im1 == 0 || im1 == readBases.length - 1 ? 0.0 : QualityUtils.qualToErrorProbLog10(deletionGOP[im1-1]) ); + final double e2 = ( im1 == 0 || im1 == readBases.length - 1 ? 0.0 : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]) ); + final double qBaseRefLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0 + YMetricArray[indI][indJ] = qBaseRefLog10 + MathUtils.approximateLog10SumLog10(matchMetricArray[indI][indJ-1] + d2, YMetricArray[indI][indJ-1] + e2); + } + + // private function used by the banded approach to ensure the proposed bands are sufficiently distinct from each other + private boolean detectClusteredStartLocations( final ArrayList list, int loc ) { + for(int x : list) { + if( Math.abs(x-loc) <= BANDING_CLUSTER_WINDOW ) { + return true; + } + } + return false; + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/utils/PairHMMUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/PairHMMUnitTest.java new file mode 100644 index 000000000..6f76cf520 --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/utils/PairHMMUnitTest.java @@ -0,0 +1,305 @@ +/* + * Copyright (c) 2012, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.utils; + + +// the imports for unit testing. + + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + + +public class PairHMMUnitTest extends BaseTest { + final static boolean EXTENSIVE_TESTING = true; + PairHMM hmm = new PairHMM( false ); // reference implementation + PairHMM bandedHMM = new PairHMM( true ); // algorithm with banding + + // -------------------------------------------------------------------------------- + // + // Provider + // + // -------------------------------------------------------------------------------- + + private class BasicLikelihoodTestProvider extends TestDataProvider { + final String ref, read; + final byte[] refBasesWithContext, readBasesWithContext; + final int baseQual, insQual, delQual, gcp; + final int expectedQual; + final static String CONTEXT = "ACGTAATGACGATTGCA"; + final static String LEFT_FLANK = "GATTTATCATCGAGTCTGC"; + final static String RIGHT_FLANK = "CATGGATCGTTATCAGCTATCTCGAGGGATTCACTTAACAGTTTTA"; + + public BasicLikelihoodTestProvider(final String ref, final String read, final int baseQual, final int insQual, final int delQual, final int expectedQual, final int gcp) { + this(ref, read, baseQual, insQual, delQual, expectedQual, gcp, false, false); + } + + public BasicLikelihoodTestProvider(final String ref, final String read, final int baseQual, final int insQual, final int delQual, final int expectedQual, final int gcp, final boolean left, final boolean right) { + super(BasicLikelihoodTestProvider.class, String.format("ref=%s read=%s b/i/d/c quals = %d/%d/%d/%d l/r flank = %b/%b e[qual]=%d", ref, read, baseQual, insQual, delQual, gcp, left, right, expectedQual)); + this.baseQual = baseQual; + this.delQual = delQual; + this.insQual = insQual; + this.gcp = gcp; + this.read = read; + this.ref = ref; + this.expectedQual = expectedQual; + + refBasesWithContext = asBytes(ref, left, right); + readBasesWithContext = asBytes(read, false, false); + } + + public double expectedLogL() { + return expectedQual / -10.0; + } + + public double tolerance() { + return 0.1; // TODO FIXME arbitrary + } + + public double calcLogL() { + + double logL = hmm.computeReadLikelihoodGivenHaplotype( + refBasesWithContext, readBasesWithContext, + qualAsBytes(baseQual, false), qualAsBytes(insQual, true), qualAsBytes(delQual, true), + qualAsBytes(gcp, false)); + + return logL; + } + + private final byte[] asBytes(final String bases, final boolean left, final boolean right) { + return ( (left ? LEFT_FLANK : "") + CONTEXT + bases + CONTEXT + (right ? RIGHT_FLANK : "")).getBytes(); + } + + private byte[] qualAsBytes(final int phredQual, final boolean doGOP) { + final byte phredQuals[] = new byte[readBasesWithContext.length]; + // initialize everything to MASSIVE_QUAL so it cannot be moved by HMM + Arrays.fill(phredQuals, (byte)100); + + // update just the bases corresponding to the provided micro read with the quality scores + if( doGOP ) { + phredQuals[0 + CONTEXT.length()] = (byte)phredQual; + } else { + for ( int i = 0; i < read.length(); i++) + phredQuals[i + CONTEXT.length()] = (byte)phredQual; + } + + return phredQuals; + } + } + + final Random random = new Random(87865573); + private class BandedLikelihoodTestProvider extends TestDataProvider { + final String ref, read; + final byte[] refBasesWithContext, readBasesWithContext; + final int baseQual, insQual, delQual, gcp; + final int expectedQual; + final static String LEFT_CONTEXT = "ACGTAATGACGCTACATGTCGCCAACCGTC"; + final static String RIGHT_CONTEXT = "TACGGCTTCATATAGGGCAATGTGTGTGGCAAAA"; + final static String LEFT_FLANK = "GATTTATCATCGAGTCTGTT"; + final static String RIGHT_FLANK = "CATGGATCGTTATCAGCTATCTCGAGGGATTCACTTAACAGTTTCCGTA"; + final byte[] baseQuals, insQuals, delQuals, gcps; + + public BandedLikelihoodTestProvider(final String ref, final String read, final int baseQual, final int insQual, final int delQual, final int expectedQual, final int gcp) { + this(ref, read, baseQual, insQual, delQual, expectedQual, gcp, false, false); + } + + public BandedLikelihoodTestProvider(final String ref, final String read, final int baseQual, final int insQual, final int delQual, final int expectedQual, final int gcp, final boolean left, final boolean right) { + super(BandedLikelihoodTestProvider.class, String.format("BANDED: ref=%s read=%s b/i/d/c quals = %d/%d/%d/%d l/r flank = %b/%b e[qual]=%d", ref, read, baseQual, insQual, delQual, gcp, left, right, expectedQual)); + this.baseQual = baseQual; + this.delQual = delQual; + this.insQual = insQual; + this.gcp = gcp; + this.read = read; + this.ref = ref; + this.expectedQual = expectedQual; + + refBasesWithContext = asBytes(ref, left, right); + readBasesWithContext = asBytes(read, false, false); + baseQuals = qualAsBytes(baseQual); + insQuals = qualAsBytes(insQual); + delQuals = qualAsBytes(delQual); + gcps = qualAsBytes(gcp, false); + } + + public double expectedLogL() { + double logL = hmm.computeReadLikelihoodGivenHaplotype( + refBasesWithContext, readBasesWithContext, + baseQuals, insQuals, delQuals, gcps); + + return logL; + } + + public double tolerance() { + return 0.2; // TODO FIXME arbitrary + } + + public double calcLogL() { + + double logL = bandedHMM.computeReadLikelihoodGivenHaplotype( + refBasesWithContext, readBasesWithContext, + baseQuals, insQuals, delQuals, gcps); + + return logL; + } + + private final byte[] asBytes(final String bases, final boolean left, final boolean right) { + return ( (left ? LEFT_FLANK : "") + LEFT_CONTEXT + bases + RIGHT_CONTEXT + (right ? RIGHT_FLANK : "")).getBytes(); + } + + private byte[] qualAsBytes(final int phredQual) { + return qualAsBytes(phredQual, true); + } + + private byte[] qualAsBytes(final int phredQual, final boolean addRandom) { + final byte phredQuals[] = new byte[readBasesWithContext.length]; + Arrays.fill(phredQuals, (byte)phredQual); + if(addRandom) { + for( int iii = 0; iii < phredQuals.length; iii++) { + phredQuals[iii] = (byte) ((int) phredQuals[iii] + (random.nextInt(7) - 3)); + } + } + return phredQuals; + } + } + + @DataProvider(name = "BasicLikelihoodTestProvider") + public Object[][] makeBasicLikelihoodTests() { + // context on either side is ACGTTGCA REF ACGTTGCA + // test all combinations + final List baseQuals = EXTENSIVE_TESTING ? Arrays.asList(10, 20, 30, 40, 50) : Arrays.asList(30); + final List indelQuals = EXTENSIVE_TESTING ? Arrays.asList(10, 20, 30, 40, 50) : Arrays.asList(40); + final List gcps = EXTENSIVE_TESTING ? Arrays.asList(10, 20, 30) : Arrays.asList(10); + final List sizes = EXTENSIVE_TESTING ? Arrays.asList(2,3,4,5,6,7,8,9,10,20) : Arrays.asList(2); + + for ( final int baseQual : baseQuals ) { + for ( final int indelQual : indelQuals ) { + for ( final int gcp : gcps ) { + + // test substitutions + for ( final byte refBase : BaseUtils.BASES ) { + for ( final byte readBase : BaseUtils.BASES ) { + final String ref = new String(new byte[]{refBase}); + final String read = new String(new byte[]{readBase}); + final int expected = refBase == readBase ? 0 : baseQual; + new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp); + } + } + + // test insertions and deletions + for ( final int size : sizes ) { + for ( final byte base : BaseUtils.BASES ) { + final int expected = indelQual + (size - 2) * gcp; + + for ( boolean insertionP : Arrays.asList(true, false)) { + final String small = Utils.dupString((char)base, 1); + final String big = Utils.dupString((char)base, size); + + final String ref = insertionP ? small : big; + final String read = insertionP ? big : small; + + new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp); + new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp, true, false); + new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp, false, true); + new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp, true, true); + } + } + } + } + } + } + + return BasicLikelihoodTestProvider.getTests(BasicLikelihoodTestProvider.class); + } + + @Test(dataProvider = "BasicLikelihoodTestProvider", enabled = true) + public void testBasicLikelihoods(BasicLikelihoodTestProvider cfg) { + double calculatedLogL = cfg.calcLogL(); + double expectedLogL = cfg.expectedLogL(); + logger.warn(String.format("Test: logL calc=%.2f expected=%.2f for %s", calculatedLogL, expectedLogL, cfg.toString())); + Assert.assertEquals(calculatedLogL, expectedLogL, cfg.tolerance()); + } + + @DataProvider(name = "BandedLikelihoodTestProvider") + public Object[][] makeBandedLikelihoodTests() { + // context on either side is ACGTTGCA REF ACGTTGCA + // test all combinations + final List baseQuals = EXTENSIVE_TESTING ? Arrays.asList(25, 30, 40, 50) : Arrays.asList(30); + final List indelQuals = EXTENSIVE_TESTING ? Arrays.asList(30, 40, 50) : Arrays.asList(40); + final List gcps = EXTENSIVE_TESTING ? Arrays.asList(10, 12) : Arrays.asList(10); + final List sizes = EXTENSIVE_TESTING ? Arrays.asList(2,3,4,5,6,7,8,9,10,20) : Arrays.asList(2); + + for ( final int baseQual : baseQuals ) { + for ( final int indelQual : indelQuals ) { + for ( final int gcp : gcps ) { + + // test substitutions + for ( final byte refBase : BaseUtils.BASES ) { + for ( final byte readBase : BaseUtils.BASES ) { + final String ref = new String(new byte[]{refBase}); + final String read = new String(new byte[]{readBase}); + final int expected = refBase == readBase ? 0 : baseQual; + new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp); + } + } + + // test insertions and deletions + for ( final int size : sizes ) { + for ( final byte base : BaseUtils.BASES ) { + final int expected = indelQual + (size - 2) * gcp; + + for ( boolean insertionP : Arrays.asList(true, false)) { + final String small = Utils.dupString((char)base, 1); + final String big = Utils.dupString((char)base, size); + + final String ref = insertionP ? small : big; + final String read = insertionP ? big : small; + + new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp); + new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp, true, false); + new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp, false, true); + new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp, true, true); + } + } + } + } + } + } + + return BandedLikelihoodTestProvider.getTests(BandedLikelihoodTestProvider.class); + } + + @Test(dataProvider = "BandedLikelihoodTestProvider", enabled = true) + public void testBandedLikelihoods(BandedLikelihoodTestProvider cfg) { + double calculatedLogL = cfg.calcLogL(); + double expectedLogL = cfg.expectedLogL(); + logger.warn(String.format("Test: logL calc=%.2f expected=%.2f for %s", calculatedLogL, expectedLogL, cfg.toString())); + Assert.assertEquals(calculatedLogL, expectedLogL, cfg.tolerance()); + } +} \ No newline at end of file