From f313e14e4ef2c3f933505bb16527313ce09e618c Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Tue, 12 Jul 2011 08:50:58 -0400 Subject: [PATCH] Now deletes the dump directory on ant clean Moving diffengine tests from private to public --- build.xml | 1 + .../diffengine/DiffEngineUnitTest.java | 229 ++++++++++++++++ .../walkers/diffengine/DiffNodeUnitTest.java | 249 ++++++++++++++++++ .../diffengine/DiffableReaderUnitTest.java | 143 ++++++++++ .../diffengine/DifferenceUnitTest.java | 95 +++++++ 5 files changed, 717 insertions(+) create mode 100644 public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java create mode 100644 public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java create mode 100644 public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java create mode 100644 public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java diff --git a/build.xml b/build.xml index 80627fae0..068c69316 100644 --- a/build.xml +++ b/build.xml @@ -981,6 +981,7 @@ + diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java new file mode 100644 index 000000000..cd6c3598a --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java @@ -0,0 +1,229 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DiffEngineUnitTest extends BaseTest { + DiffEngine engine; + + @BeforeClass(enabled = true) + public void createDiffEngine() { + engine = new DiffEngine(); + } + + // -------------------------------------------------------------------------------- + // + // Difference testing routines + // + // -------------------------------------------------------------------------------- + + private class DifferenceTest extends TestDataProvider { + public DiffElement tree1, tree2; + public List differences; + + private DifferenceTest(String tree1, String tree2) { + this(tree1, tree2, Collections.emptyList()); + } + + private DifferenceTest(String tree1, String tree2, String difference) { + this(tree1, tree2, Arrays.asList(difference)); + } + + private DifferenceTest(String tree1, String tree2, List differences) { + super(DifferenceTest.class); + this.tree1 = DiffNode.fromString(tree1); + this.tree2 = DiffNode.fromString(tree2); + this.differences = differences; + } + + public String toString() { + return String.format("tree1=%s tree2=%s diff=%s", + tree1.toOneLineString(), tree2.toOneLineString(), differences); + } + } + + @DataProvider(name = "trees") + public Object[][] createTrees() { + new DifferenceTest("A=X", "A=X"); + new DifferenceTest("A=X", "A=Y", "A:X!=Y"); + new DifferenceTest("A=X", "B=X", Arrays.asList("A:X!=MISSING", "B:MISSING!=X")); + new DifferenceTest("A=(X=1)", "B=(X=1)", Arrays.asList("A:(X=1)!=MISSING", "B:MISSING!=(X=1)")); + new DifferenceTest("A=(X=1)", "A=(X=1)"); + new DifferenceTest("A=(X=1 Y=2)", "A=(X=1 Y=2)"); + new DifferenceTest("A=(X=1 Y=2 B=(Z=3))", "A=(X=1 Y=2 B=(Z=3))"); + new DifferenceTest("A=(X=1)", "A=(X=2)", "A.X:1!=2"); + new DifferenceTest("A=(X=1 Y=2 B=(Z=3))", "A=(X=1 Y=2 B=(Z=4))", "A.B.Z:3!=4"); + new DifferenceTest("A=(X=1)", "A=(X=1 Y=2)", "A.Y:MISSING!=2"); + new DifferenceTest("A=(X=1 Y=2 B=(Z=3))", "A=(X=1 Y=2)", "A.B:(Z=3)!=MISSING"); + return DifferenceTest.getTests(DifferenceTest.class); + } + + @Test(enabled = true, dataProvider = "trees") + public void testDiffs(DifferenceTest test) { + logger.warn("Test tree1: " + test.tree1.toOneLineString()); + logger.warn("Test tree2: " + test.tree2.toOneLineString()); + + List diffs = engine.diff(test.tree1, test.tree2); + logger.warn("Test expected diff : " + test.differences); + logger.warn("Observed diffs : " + diffs); + } + + // -------------------------------------------------------------------------------- + // + // Low-level routines for summarizing differences + // + // -------------------------------------------------------------------------------- + + @Test(enabled = true) + public void testLongestCommonPostfix() { + testLongestCommonPostfixHelper("A", "A", 1); + testLongestCommonPostfixHelper("A", "B", 0); + testLongestCommonPostfixHelper("A.B", "A.B", 2); + testLongestCommonPostfixHelper("A.B.C", "A.B.C", 3); + testLongestCommonPostfixHelper("A.B.C", "X.B.C", 2); + testLongestCommonPostfixHelper("A.B.C", "X.Y.C", 1); + testLongestCommonPostfixHelper("A.B.C", "X.Y.Z", 0); + testLongestCommonPostfixHelper("A.B.C", "A.X.C", 1); + testLongestCommonPostfixHelper("A.B.C", "A.X.Z", 0); + testLongestCommonPostfixHelper("A.B.C", "A.B.Z", 0); + } + + public void testLongestCommonPostfixHelper(String p1, String p2, int expected) { + String[] parts1 = p1.split("\\."); + String[] parts2 = p2.split("\\."); + int obs = DiffEngine.longestCommonPostfix(parts1, parts2); + Assert.assertEquals(obs, expected, "p1=" + p1 + " p2=" + p2 + " failed"); + } + + @Test(enabled = true, dependsOnMethods = "testLongestCommonPostfix") + public void testSummarizePath() { + testSummarizePathHelper("A", "A", "A"); + testSummarizePathHelper("A", "B", "*"); + testSummarizePathHelper("A.B", "A.B", "A.B"); + testSummarizePathHelper("A.B", "X.B", "*.B"); + testSummarizePathHelper("A.B", "X.Y", "*.*"); + testSummarizePathHelper("A.B.C", "A.B.C", "A.B.C"); + testSummarizePathHelper("A.B.C", "X.B.C", "*.B.C"); + testSummarizePathHelper("A.B.C", "X.Y.C", "*.*.C"); + testSummarizePathHelper("A.B.C", "X.Y.Z", "*.*.*"); + testSummarizePathHelper("A.B.C", "A.X.C", "*.*.C"); + testSummarizePathHelper("A.B.C", "A.X.Z", "*.*.*"); + testSummarizePathHelper("A.B.C", "A.B.Z", "*.*.*"); + } + + public void testSummarizePathHelper(String p1, String p2, String expected) { + String[] parts1 = DiffEngine.diffNameToPath(p1); + String[] parts2 = DiffEngine.diffNameToPath(p2); + int obs = DiffEngine.longestCommonPostfix(parts1, parts2); + String path = DiffEngine.summarizedPath(parts2, obs); + Assert.assertEquals(path, expected, "p1=" + p1 + " p2=" + p2 + " failed"); + } + + // -------------------------------------------------------------------------------- + // + // High-level difference summary + // + // -------------------------------------------------------------------------------- + + private class SummarizeDifferenceTest extends TestDataProvider { + List diffs = new ArrayList(); + List expecteds = new ArrayList(); + + public SummarizeDifferenceTest() { super(SummarizeDifferenceTest.class); } + + public SummarizeDifferenceTest addDiff(String... diffsToAdd) { + diffs.addAll(Arrays.asList(diffsToAdd)); + return this; + } + + public SummarizeDifferenceTest addSummary(String... expectedSummary) { + expecteds.addAll(Arrays.asList(expectedSummary)); + return this; + } + + public String toString() { + return String.format("diffs=%s => expected=%s", diffs, expecteds); + } + + public void test() { + List diffPaths = new ArrayList(diffs.size()); + for ( String diff : diffs ) { diffPaths.add(DiffEngine.diffNameToPath(diff)); } + + List sumDiffs = engine.summarizedDifferencesOfPaths(diffPaths); + + Assert.assertEquals(sumDiffs.size(), expecteds.size(), "Unexpected number of summarized differences: " + sumDiffs); + + for ( int i = 0; i < sumDiffs.size(); i++ ) { + DiffEngine.SummarizedDifference sumDiff = sumDiffs.get(i); + String expected = expecteds.get(i); + String[] pathCount = expected.split(":"); + String path = pathCount[0]; + int count = Integer.valueOf(pathCount[1]); + Assert.assertEquals(sumDiff.getPath(), path, "Unexpected path at: " + expected + " obs=" + sumDiff + " all=" + sumDiffs); + Assert.assertEquals(sumDiff.getCount(), count, "Unexpected counts at: " + expected + " obs=" + sumDiff + " all=" + sumDiffs); + } + } + } + + @DataProvider(name = "summaries") + public Object[][] createSummaries() { + new SummarizeDifferenceTest().addDiff("A", "A").addSummary("A:2"); + new SummarizeDifferenceTest().addDiff("A", "B").addSummary("A:1", "B:1"); + new SummarizeDifferenceTest().addDiff("A", "A", "A").addSummary("A:3"); + new SummarizeDifferenceTest().addDiff("A", "A", "A", "B").addSummary("A:3", "B:1"); + new SummarizeDifferenceTest().addDiff("A", "A", "A", "B", "B").addSummary("A:3", "B:2"); + new SummarizeDifferenceTest().addDiff("A", "A", "A", "B", "B", "C").addSummary("A:3", "B:2", "C:1"); + new SummarizeDifferenceTest().addDiff("A.X", "A.X").addSummary("A.X:2"); + new SummarizeDifferenceTest().addDiff("A.X", "A.X", "B.X").addSummary("*.X:3", "A.X:2", "B.X:1"); + new SummarizeDifferenceTest().addDiff("A.X", "A.X", "B.X", "B.X").addSummary("*.X:4", "A.X:2", "B.X:2"); + new SummarizeDifferenceTest().addDiff("A.B.C", "X.B.C").addSummary("*.B.C:2", "A.B.C:1", "X.B.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "X.Y.C", "X.Y.C").addSummary("*.*.C:3", "X.Y.C:2", "A.B.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "A.X.C", "X.Y.C").addSummary("*.*.C:3", "A.B.C:1", "A.X.C:1", "X.Y.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "A.X.C", "B.X.C").addSummary("*.*.C:3", "*.X.C:2", "A.B.C:1", "A.X.C:1", "B.X.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "A.X.C", "B.X.C", "B.X.C").addSummary("*.*.C:4", "*.X.C:3", "B.X.C:2", "A.B.C:1", "A.X.C:1"); + + return SummarizeDifferenceTest.getTests(SummarizeDifferenceTest.class); + } + + + @Test(enabled = true, dependsOnMethods = "testSummarizePath", dataProvider = "summaries") + public void testSummarizeDifferences(SummarizeDifferenceTest test) { + test.test(); + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java new file mode 100644 index 000000000..534416d29 --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java @@ -0,0 +1,249 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DiffNodeUnitTest extends BaseTest { + // Data is: + // MY_ROOT + // fields: A=A, B=B + // nodes: C, D + // C: fields: E=E, nodes: none + // D: fields: F=F, G=G, nodes: none + static DiffNode MY_ROOT = DiffNode.rooted("MY_ROOT"); + static DiffValue Value_A = new DiffValue("A", MY_ROOT, "A"); + static DiffValue Value_B = new DiffValue("B", MY_ROOT, "B"); + static DiffNode NODE_C = DiffNode.empty("C", MY_ROOT); + static DiffNode NODE_D = DiffNode.empty("D", MY_ROOT); + static DiffValue Value_E = new DiffValue("E", NODE_C, "E"); + static DiffValue Value_F = new DiffValue("F", NODE_D, "F"); + static DiffValue Value_G = new DiffValue("G", NODE_D, "G"); + + static { + MY_ROOT.add(Value_A); + MY_ROOT.add(Value_B); + MY_ROOT.add(NODE_C); + MY_ROOT.add(NODE_D); + NODE_C.add(Value_E); + NODE_D.add(Value_F); + NODE_D.add(Value_G); + } + + + // -------------------------------------------------------------------------------- + // + // Element testing routines + // + // -------------------------------------------------------------------------------- + + private class ElementTest extends TestDataProvider { + public DiffElement elt; + public String name; + public String fullName; + public DiffElement parent; + + private ElementTest(DiffValue elt, DiffValue parent, String name, String fullName) { + this(elt.getBinding(), parent.getBinding(), name, fullName); + } + + private ElementTest(DiffElement elt, DiffElement parent, String name, String fullName) { + super(ElementTest.class); + this.elt = elt; + this.name = name; + this.fullName = fullName; + this.parent = parent; + } + + public String toString() { + return String.format("ElementTest elt=%s name=%s fullName=%s parent=%s", + elt.toOneLineString(), name, fullName, parent.getName()); + } + } + + @DataProvider(name = "elementdata") + public Object[][] createElementData() { + new ElementTest(MY_ROOT.getBinding(), DiffElement.ROOT, "MY_ROOT", "MY_ROOT"); + new ElementTest(NODE_C, MY_ROOT, "C", "MY_ROOT.C"); + new ElementTest(NODE_D, MY_ROOT, "D", "MY_ROOT.D"); + new ElementTest(Value_A, MY_ROOT, "A", "MY_ROOT.A"); + new ElementTest(Value_B, MY_ROOT, "B", "MY_ROOT.B"); + new ElementTest(Value_E, NODE_C, "E", "MY_ROOT.C.E"); + new ElementTest(Value_F, NODE_D, "F", "MY_ROOT.D.F"); + new ElementTest(Value_G, NODE_D, "G", "MY_ROOT.D.G"); + return TestDataProvider.getTests(ElementTest.class); + } + + @Test(enabled = true, dataProvider = "elementdata") + public void testElementMethods(ElementTest test) { + Assert.assertNotNull(test.elt.getName()); + Assert.assertNotNull(test.elt.getParent()); + Assert.assertEquals(test.elt.getName(), test.name); + Assert.assertEquals(test.elt.getParent(), test.parent); + Assert.assertEquals(test.elt.fullyQualifiedName(), test.fullName); + } + + // -------------------------------------------------------------------------------- + // + // DiffValue testing routines + // + // -------------------------------------------------------------------------------- + + private class LeafTest extends TestDataProvider { + public DiffValue diffvalue; + public Object value; + + private LeafTest(DiffValue diffvalue, Object value) { + super(LeafTest.class); + this.diffvalue = diffvalue; + this.value = value; + } + + public String toString() { + return String.format("LeafTest diffvalue=%s value=%s", diffvalue.toOneLineString(), value); + } + } + + @DataProvider(name = "leafdata") + public Object[][] createLeafData() { + new LeafTest(Value_A, "A"); + new LeafTest(Value_B, "B"); + new LeafTest(Value_E, "E"); + new LeafTest(Value_F, "F"); + new LeafTest(Value_G, "G"); + return TestDataProvider.getTests(LeafTest.class); + } + + @Test(enabled = true, dataProvider = "leafdata") + public void testLeafMethods(LeafTest test) { + Assert.assertNotNull(test.diffvalue.getValue()); + Assert.assertEquals(test.diffvalue.getValue(), test.value); + } + + // -------------------------------------------------------------------------------- + // + // Node testing routines + // + // -------------------------------------------------------------------------------- + + private class NodeTest extends TestDataProvider { + public DiffNode node; + public Set fields; + public Set subnodes; + public Set allNames; + + private NodeTest(DiffNode node, List fields, List subnodes) { + super(NodeTest.class); + this.node = node; + this.fields = new HashSet(fields); + this.subnodes = new HashSet(subnodes); + this.allNames = new HashSet(fields); + allNames.addAll(subnodes); + } + + public String toString() { + return String.format("NodeTest node=%s fields=%s subnodes=%s", + node.toOneLineString(), fields, subnodes); + } + } + + @DataProvider(name = "nodedata") + public Object[][] createData1() { + new NodeTest(MY_ROOT, Arrays.asList("A", "B"), Arrays.asList("C", "D")); + new NodeTest(NODE_C, Arrays.asList("E"), Collections.emptyList()); + new NodeTest(NODE_D, Arrays.asList("F", "G"), Collections.emptyList()); + return TestDataProvider.getTests(NodeTest.class); + } + + @Test(enabled = true, dataProvider = "nodedata") + public void testNodeAccessors(NodeTest test) { + Assert.assertNotNull(test.node.getElements()); + + for ( String name : test.allNames ) { + DiffElement elt = test.node.getElement(name); + Assert.assertNotNull(elt, "Failed to find field " + elt + " in " + test.node); + Assert.assertEquals(elt.getName(), name); + Assert.assertEquals(elt.getValue().isAtomic(), test.fields.contains(name), "Failed atomic/compound expectation: " + test.node); + } + } + + // NOTE: add routines are being implicitly tested by the creation of the data structures + + @Test(enabled = true, dataProvider = "nodedata") + public void testCounts(NodeTest test) { + Assert.assertEquals(test.node.getElements().size(), test.allNames.size()); + Assert.assertEquals(test.node.getElementNames(), test.allNames); + } + + // -------------------------------------------------------------------------------- + // + // fromString testing routines + // + // -------------------------------------------------------------------------------- + + private class FromStringTest extends TestDataProvider { + public String string; + public DiffElement expected; + + private FromStringTest(String string, DiffElement expected) { + super(FromStringTest.class); + this.string = string; + this.expected = expected; + } + + public String toString() { + return String.format("FromStringTest string=%s expected=%s", string, expected.toOneLineString()); + } + } + + @DataProvider(name = "fromstringdata") + public Object[][] createFromData() { + new FromStringTest("A=A", Value_A.getBinding()); + new FromStringTest("B=B", Value_B.getBinding()); + new FromStringTest("C=(E=E)", NODE_C.getBinding()); + new FromStringTest("D=(F=F G=G)", NODE_D.getBinding()); + return TestDataProvider.getTests(FromStringTest.class); + } + + @Test(enabled = true, dataProvider = "fromstringdata") + public void parseFromString(FromStringTest test) { + logger.warn("Testing from string: " + test.string); + DiffElement elt = DiffNode.fromString(test.string); + Assert.assertEquals(elt.toOneLineString(), test.expected.toOneLineString()); + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java new file mode 100644 index 000000000..5738b643f --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java @@ -0,0 +1,143 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + + +import net.sf.samtools.SAMRecord; +import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.sting.utils.variantcontext.Allele; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.Test; + +import java.io.File; +import java.util.*; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DiffableReaderUnitTest extends BaseTest { + DiffEngine engine; + + File vcfFile = new File(testDir + "diffTestMaster.vcf"); + File bamFile = new File(testDir + "exampleBAM.bam"); + + @BeforeClass(enabled = true) + public void createDiffEngine() { + engine = new DiffEngine(); + } + + @Test(enabled = true) + public void testPluggableDiffableReaders() { + logger.warn("testPluggableDiffableReaders"); + Map readers = engine.getReaders(); + Assert.assertNotNull(readers); + Assert.assertTrue(readers.size() > 0); + Assert.assertNotNull(readers.get("VCF")); + for ( Map.Entry e : engine.getReaders().entrySet() ) { + logger.warn("Found diffable reader: " + e.getKey()); + Assert.assertEquals(e.getValue().getName(), e.getKey()); + Assert.assertEquals(e.getValue(), engine.getReader(e.getKey())); + } + } + + private static void testLeaf(DiffNode rec, String field, Object expected) { + DiffElement value = rec.getElement(field); + Assert.assertNotNull(value, "Expected to see leaf named " + field + " in rec " + rec); + Assert.assertEquals(value.getValue().getValue(), expected, "Expected to leaf named " + field + " to have value " + expected + " in rec " + rec); + } + + @Test(enabled = true, dependsOnMethods = "testPluggableDiffableReaders") + public void testVCF1() { + logger.warn("testVCF1"); + DiffableReader vcfReader = engine.getReader("VCF"); + Assert.assertTrue(vcfReader.canRead(vcfFile)); + Assert.assertFalse(vcfReader.canRead(bamFile)); + + DiffElement diff = vcfReader.readFromFile(vcfFile); + Assert.assertNotNull(diff); + + Assert.assertEquals(diff.getName(), vcfFile.getName()); + Assert.assertSame(diff.getParent(), DiffElement.ROOT); + + DiffNode node = diff.getValueAsNode(); + Assert.assertEquals(node.getElements().size(), 9); + + // chr1 2646 rs62635284 G A 0.15 PASS AC=2;AF=1.00;AN=2 GT:AD:DP:GL:GQ 1/1:53,75:3:-12.40,-0.90,-0.00:9.03 + DiffNode rec1 = node.getElement("chr1:2646").getValueAsNode(); + testLeaf(rec1, "CHROM", "chr1"); + testLeaf(rec1, "POS", 2646); + testLeaf(rec1, "ID", "rs62635284"); + testLeaf(rec1, "REF", Allele.create("G", true)); + testLeaf(rec1, "ALT", new HashSet(Arrays.asList(Allele.create("A")))); + testLeaf(rec1, "QUAL", 0.15); + testLeaf(rec1, "FILTER", Collections.emptySet()); + testLeaf(rec1, "AC", "2"); + testLeaf(rec1, "AF", "1.00"); + testLeaf(rec1, "AN", "2"); + } + + @Test(enabled = true, dependsOnMethods = "testPluggableDiffableReaders") + public void testBAM() { + logger.warn("testBAM"); + DiffableReader bamReader = engine.getReader("BAM"); + Assert.assertTrue(bamReader.canRead(bamFile)); + Assert.assertFalse(bamReader.canRead(vcfFile)); + + DiffElement diff = bamReader.readFromFile(bamFile); + Assert.assertNotNull(diff); + + Assert.assertEquals(diff.getName(), bamFile.getName()); + Assert.assertSame(diff.getParent(), DiffElement.ROOT); + + DiffNode node = diff.getValueAsNode(); + Assert.assertEquals(node.getElements().size(), 33); + + // 30PPJAAXX090125:1:42:512:1817#0 99 chr1 200 0 76M = + // 255 -130 ACCCTAACCCTAACCCTAACCCTAACCATAACCCTAAGACTAACCCTAAACCTAACCCTCATAATCGAAATACAAC + // BBBBC@C?AABCBB<63>=B@>+B9-9+)2B8,+@327B5A>90((>-+''3?(/'''A)(''19('7.,**%)3: + // PG:Z:0 RG:Z:exampleBAM.bam SM:Z:exampleBAM.bam + + DiffNode rec1 = node.getElement("30PPJAAXX090125:1:42:512:1817#0_1").getValueAsNode(); + testLeaf(rec1, "NAME", "30PPJAAXX090125:1:42:512:1817#0"); + testLeaf(rec1, "FLAGS", 99); + testLeaf(rec1, "RNAME", "chr1"); + testLeaf(rec1, "POS", 200); + testLeaf(rec1, "MAPQ", 0); + testLeaf(rec1, "CIGAR", "76M"); + testLeaf(rec1, "RNEXT", "chr1"); + testLeaf(rec1, "PNEXT", 255); + testLeaf(rec1, "TLEN", -130); + testLeaf(rec1, "SEQ", "ACCCTAACCCTAACCCTAACCCTAACCATAACCCTAAGACTAACCCTAAACCTAACCCTCATAATCGAAATACAAC"); + testLeaf(rec1, "QUAL", "BBBBC@C?AABCBB<63>=B@>+B9-9+)2B8,+@327B5A>90((>-+''3?(/'''A)(''19('7.,**%)3:"); + testLeaf(rec1, "PG", "0"); + testLeaf(rec1, "RG", "exampleBAM.bam"); + testLeaf(rec1, "SM", "exampleBAM.bam"); + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java new file mode 100644 index 000000000..da272ec30 --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java @@ -0,0 +1,95 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.Arrays; +import java.util.Collections; +import java.util.List; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DifferenceUnitTest extends BaseTest { + // -------------------------------------------------------------------------------- + // + // testing routines + // + // -------------------------------------------------------------------------------- + + private class DifferenceTest extends TestDataProvider { + public DiffElement tree1, tree2; + public String difference; + + private DifferenceTest(String tree1, String tree2, String difference) { + this(DiffNode.fromString(tree1), DiffNode.fromString(tree2), difference); + } + + private DifferenceTest(DiffElement tree1, DiffElement tree2, String difference) { + super(DifferenceTest.class); + this.tree1 = tree1; + this.tree2 = tree2; + this.difference = difference; + } + + public String toString() { + return String.format("tree1=%s tree2=%s diff=%s", + tree1 == null ? "null" : tree1.toOneLineString(), + tree2 == null ? "null" : tree2.toOneLineString(), + difference); + } + } + + @DataProvider(name = "data") + public Object[][] createTrees() { + new DifferenceTest("A=X", "A=Y", "A:X!=Y"); + new DifferenceTest("A=Y", "A=X", "A:Y!=X"); + new DifferenceTest(DiffNode.fromString("A=X"), null, "A:X!=MISSING"); + new DifferenceTest(null, DiffNode.fromString("A=X"), "A:MISSING!=X"); + return DifferenceTest.getTests(DifferenceTest.class); + } + + @Test(enabled = true, dataProvider = "data") + public void testDiffToString(DifferenceTest test) { + logger.warn("Test tree1: " + (test.tree1 == null ? "null" : test.tree1.toOneLineString())); + logger.warn("Test tree2: " + (test.tree2 == null ? "null" : test.tree2.toOneLineString())); + logger.warn("Test expected diff : " + test.difference); + Difference diff = new Difference(test.tree1, test.tree2); + logger.warn("Observed diffs : " + diff); + Assert.assertEquals(diff.toString(), test.difference, "Observed diff string " + diff + " not equal to expected difference string " + test.difference ); + + } +} \ No newline at end of file