diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java index 59cadbdf9..7cdc57464 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java @@ -48,18 +48,18 @@ package org.broadinstitute.sting.gatk.walkers.haplotypecaller; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; -import net.sf.samtools.Cigar; -import net.sf.samtools.CigarElement; -import org.apache.commons.lang.ArrayUtils; import org.apache.log4j.Logger; import org.broadinstitute.sting.gatk.walkers.annotator.VariantAnnotatorEngine; import org.broadinstitute.sting.gatk.walkers.genotyper.GenotypeLikelihoodsCalculationModel; import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine; -import org.broadinstitute.sting.utils.*; +import org.broadinstitute.sting.utils.GenomeLoc; +import org.broadinstitute.sting.utils.GenomeLocParser; +import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.genotyper.PerReadAlleleLikelihoodMap; -import org.broadinstitute.sting.utils.haplotype.EventExtractor; +import org.broadinstitute.sting.utils.haplotype.EventMap; import org.broadinstitute.sting.utils.haplotype.Haplotype; +import org.broadinstitute.sting.utils.haplotype.LDMerger; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.variantcontext.*; @@ -74,12 +74,16 @@ public class GenotypingEngine { private final boolean USE_FILTERED_READ_MAP_FOR_ANNOTATIONS; private final static List noCall = new ArrayList(); // used to noCall all genotypes until the exact model is applied private final VariantAnnotatorEngine annotationEngine; + private final LDMerger ldMerger; - public GenotypingEngine( final boolean DEBUG, final VariantAnnotatorEngine annotationEngine, final boolean USE_FILTERED_READ_MAP_FOR_ANNOTATIONS ) { + public GenotypingEngine( final boolean DEBUG, final VariantAnnotatorEngine annotationEngine, + final boolean USE_FILTERED_READ_MAP_FOR_ANNOTATIONS, + final LDMerger ldMerger) { this.DEBUG = DEBUG; this.annotationEngine = annotationEngine; this.USE_FILTERED_READ_MAP_FOR_ANNOTATIONS = USE_FILTERED_READ_MAP_FOR_ANNOTATIONS; noCall.add(Allele.NO_CALL); + this.ldMerger = ldMerger; } /** @@ -235,31 +239,18 @@ public class GenotypingEngine { final GenomeLoc refLoc, final List activeAllelesToGenotype) { final boolean in_GGA_mode = !activeAllelesToGenotype.isEmpty(); - int hapNumber = 0; // Using the cigar from each called haplotype figure out what events need to be written out in a VCF file - final TreeSet startPosKeySet = new TreeSet(); + final TreeSet startPosKeySet = EventMap.buildEventMapsForHaplotypes(haplotypes, ref, refLoc, DEBUG); - if( DEBUG ) logger.info("=== Best Haplotypes ==="); - for( final Haplotype h : haplotypes ) { - // Walk along the alignment and turn any difference from the reference into an event - h.setEventMap( new EventExtractor( h, ref, refLoc, "HC" + hapNumber++ ) ); - if( ! in_GGA_mode ) { - startPosKeySet.addAll(h.getEventMap().getStartPositions()); - } - - if( DEBUG ) { - logger.info(h.toString()); - logger.info("> Cigar = " + h.getCigar()); - logger.info(">> Events = " + h.getEventMap()); - } - } + if ( in_GGA_mode ) startPosKeySet.clear(); cleanUpSymbolicUnassembledEvents( haplotypes ); - if ( !in_GGA_mode && haplotypeReadMap.size() >= 10 ) { + if ( !in_GGA_mode ) { // if not in GGA mode and have at least 10 samples try to create MNP and complex events by looking at LD structure - mergeConsecutiveEventsBasedOnLD( haplotypes, haplotypeReadMap, startPosKeySet, ref, refLoc ); - cleanUpSymbolicUnassembledEvents( haplotypes ); // the newly created merged events could be overlapping the unassembled events + final boolean mergedAnything = ldMerger.mergeConsecutiveEventsBasedOnLD( haplotypes, haplotypeReadMap, startPosKeySet, ref, refLoc ); + if ( mergedAnything ) + cleanUpSymbolicUnassembledEvents( haplotypes ); // the newly created merged events could be overlapping the unassembled events } if ( in_GGA_mode ) { @@ -290,7 +281,7 @@ public class GenotypingEngine { if( activeAllelesToGenotype.isEmpty() ) { for( final Haplotype h : haplotypes ) { - final EventExtractor eventMap = h.getEventMap(); + final EventMap eventMap = h.getEventMap(); final VariantContext vc = eventMap.get(loc); if( vc != null && !containsVCWithMatchingAlleles(eventsAtThisLoc, vc) ) { eventsAtThisLoc.add(vc); @@ -341,14 +332,14 @@ public class GenotypingEngine { for( final String sample : alleleReadMap.keySet() ) { final int numHaplotypes = mergedVC.getAlleles().size(); final double[] genotypeLikelihoods = new double[numHaplotypes * (numHaplotypes+1) / 2]; - final double[][] haplotypeLikelihoodMatrix = LikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(sample, alleleReadMap, mergedVC.getAlleles()); + final double[][] haplotypeLikelihoodMatrix = LikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(sample, alleleReadMap, mergedVC.getAlleles(), true); int glIndex = 0; for( int iii = 0; iii < numHaplotypes; iii++ ) { for( int jjj = 0; jjj <= iii; jjj++ ) { genotypeLikelihoods[glIndex++] = haplotypeLikelihoodMatrix[iii][jjj]; // for example: AA,AB,BB,AC,BC,CC } } - genotypes.add( new GenotypeBuilder(sample).alleles(noCall).PL(genotypeLikelihoods).make() ); + genotypes.add(new GenotypeBuilder(sample).alleles(noCall).PL(genotypeLikelihoods).make()); } return genotypes; } @@ -440,156 +431,6 @@ public class GenotypingEngine { return alleleReadMap; } - /** - * TODO - comment me, clean me, refactor me! - * @param haplotypes - * @param haplotypeReadMap - * @param startPosKeySet - * @param ref - * @param refLoc - */ - protected void mergeConsecutiveEventsBasedOnLD( final List haplotypes, - final Map haplotypeReadMap, - final TreeSet startPosKeySet, - final byte[] ref, - final GenomeLoc refLoc ) { - - final int MAX_SIZE_TO_COMBINE = 15; - final double MERGE_EVENTS_R2_THRESHOLD = 0.95; - if( startPosKeySet.size() <= 1 ) { return; } - - final Set samples = haplotypeReadMap.keySet(); - boolean mapWasUpdated = true; - while( mapWasUpdated ) { - mapWasUpdated = false; - - // loop over the set of start locations and consider pairs that start near each other - final Iterator iter = startPosKeySet.iterator(); - int thisStart = iter.next(); - while( iter.hasNext() ) { - final int nextStart = iter.next(); - if( nextStart - thisStart < MAX_SIZE_TO_COMBINE) { - boolean isBiallelic = true; - VariantContext thisVC = null; - VariantContext nextVC = null; - double x11 = Double.NEGATIVE_INFINITY; - double x12 = Double.NEGATIVE_INFINITY; - double x21 = Double.NEGATIVE_INFINITY; - double x22 = Double.NEGATIVE_INFINITY; - - for( final Haplotype h : haplotypes ) { - // only make complex substitutions out of consecutive biallelic sites - final VariantContext thisHapVC = h.getEventMap().get(thisStart); - if( thisHapVC != null && !thisHapVC.isSymbolic() ) { // something was found at this location on this haplotype - if( thisVC == null ) { - thisVC = thisHapVC; - } else if( !thisHapVC.hasSameAllelesAs( thisVC ) ) { - isBiallelic = false; - break; - } - } - final VariantContext nextHapVC = h.getEventMap().get(nextStart); - if( nextHapVC != null && !nextHapVC.isSymbolic() ) { // something was found at the next location on this haplotype - if( nextVC == null ) { - nextVC = nextHapVC; - } else if( !nextHapVC.hasSameAllelesAs( nextVC ) ) { - isBiallelic = false; - break; - } - } - // count up the co-occurrences of the events for the R^2 calculation - for( final String sample : samples ) { - final double haplotypeLikelihood = LikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods( Collections.singleton(sample), haplotypeReadMap, Collections.singletonList(Allele.create(h, true)) )[0][0]; - if( thisHapVC == null ) { - if( nextHapVC == null ) { x11 = MathUtils.approximateLog10SumLog10(x11, haplotypeLikelihood); } - else { x12 = MathUtils.approximateLog10SumLog10(x12, haplotypeLikelihood); } - } else { - if( nextHapVC == null ) { x21 = MathUtils.approximateLog10SumLog10(x21, haplotypeLikelihood); } - else { x22 = MathUtils.approximateLog10SumLog10(x22, haplotypeLikelihood); } - } - } - } - if( thisVC == null || nextVC == null ) { - continue; - } - if( isBiallelic ) { - final double R2 = calculateR2LD( Math.pow(10.0, x11), Math.pow(10.0, x12), Math.pow(10.0, x21), Math.pow(10.0, x22) ); - if( DEBUG ) { - logger.info("Found consecutive biallelic events with R^2 = " + String.format("%.4f", R2)); - logger.info("-- " + thisVC); - logger.info("-- " + nextVC); - } - if( R2 > MERGE_EVENTS_R2_THRESHOLD ) { - - final VariantContext mergedVC = createMergedVariantContext(thisVC, nextVC, ref, refLoc); - - // remove the old event from the eventMap on every haplotype and the start pos key set, replace with merged event - for( final Haplotype h : haplotypes ) { - if( h.getEventMap().containsKey(thisStart) && h.getEventMap().containsKey(nextStart) ) { - h.getEventMap().remove(thisStart); - h.getEventMap().remove(nextStart); - h.getEventMap().put(mergedVC.getStart(), mergedVC); - } - } - startPosKeySet.add(mergedVC.getStart()); - boolean containsStart = false; - boolean containsNext = false; - for( final Haplotype h : haplotypes ) { - final Map eventMap = h.getEventMap(); - if( eventMap.containsKey(thisStart) ) { containsStart = true; } - if( eventMap.containsKey(nextStart) ) { containsNext = true; } - } - if(!containsStart) { startPosKeySet.remove(thisStart); } - if(!containsNext) { startPosKeySet.remove(nextStart); } - - if( DEBUG ) { logger.info("====> " + mergedVC); } - mapWasUpdated = true; - break; // break out of tree set iteration since it was just updated, start over from the beginning and keep merging events - } - } - } - thisStart = nextStart; - } - } - } - - // BUGBUG: make this merge function more general - protected static VariantContext createMergedVariantContext( final VariantContext thisVC, final VariantContext nextVC, final byte[] ref, final GenomeLoc refLoc ) { - final int thisStart = thisVC.getStart(); - final int nextStart = nextVC.getStart(); - byte[] refBases = new byte[]{}; - byte[] altBases = new byte[]{}; - refBases = ArrayUtils.addAll(refBases, thisVC.getReference().getBases()); - altBases = ArrayUtils.addAll(altBases, thisVC.getAlternateAllele(0).getBases()); - int locus; - for( locus = thisStart + refBases.length; locus < nextStart; locus++ ) { - final byte refByte = ref[locus - refLoc.getStart()]; - refBases = ArrayUtils.add(refBases, refByte); - altBases = ArrayUtils.add(altBases, refByte); - } - refBases = ArrayUtils.addAll(refBases, ArrayUtils.subarray(nextVC.getReference().getBases(), locus > nextStart ? 1 : 0, nextVC.getReference().getBases().length)); // special case of deletion including the padding base of consecutive indel - altBases = ArrayUtils.addAll(altBases, nextVC.getAlternateAllele(0).getBases()); - - int iii = 0; - if( refBases.length == altBases.length ) { // insertion + deletion of same length creates an MNP --> trim common prefix bases off the beginning of the allele - while( iii < refBases.length && refBases[iii] == altBases[iii] ) { iii++; } - } - final List mergedAlleles = new ArrayList(); - mergedAlleles.add( Allele.create( ArrayUtils.subarray(refBases, iii, refBases.length), true ) ); - mergedAlleles.add( Allele.create( ArrayUtils.subarray(altBases, iii, altBases.length), false ) ); - return new VariantContextBuilder("merged", thisVC.getChr(), thisVC.getStart() + iii, nextVC.getEnd(), mergedAlleles).make(); - } - - protected static double calculateR2LD( final double x11, final double x12, final double x21, final double x22 ) { - final double total = x11 + x12 + x21 + x22; - final double pa1b1 = x11 / total; - final double pa1b2 = x12 / total; - final double pa2b1 = x21 / total; - final double pa1 = pa1b1 + pa1b2; - final double pb1 = pa1b1 + pa2b1; - return ((pa1b1 - pa1*pb1) * (pa1b1 - pa1*pb1)) / ( pa1 * (1.0 - pa1) * pb1 * (1.0 - pb1) ); - } - protected static Map> createAlleleMapper( final Map mergeMap, final Map> eventMap ) { final Map> alleleMapper = new LinkedHashMap>(); for( final Map.Entry entry : mergeMap.entrySet() ) { @@ -616,8 +457,8 @@ public class GenotypingEngine { alleles.add(h.getArtificialRefAllele()); alleles.add(h.getArtificialAltAllele()); final Event artificialVC = new Event( (new VariantContextBuilder()).source("artificialHaplotype") - .alleles(alleles) - .loc(refVC.getChr(), refVC.getStart(), refVC.getStart() + h.getArtificialRefAllele().length() - 1).make() ); + .alleles(alleles) + .loc(refVC.getChr(), refVC.getStart(), refVC.getStart() + h.getArtificialRefAllele().length() - 1).make() ); if( eventMapper.containsKey(artificialVC) ) { eventMapper.get(artificialVC).add(h); } @@ -711,7 +552,7 @@ public class GenotypingEngine { @Deprecated protected static Map generateVCsFromAlignment( final Haplotype haplotype, final byte[] ref, final GenomeLoc refLoc, final String sourceNameToAdd ) { - return new EventExtractor(haplotype, ref, refLoc, sourceNameToAdd); + return new EventMap(haplotype, ref, refLoc, sourceNameToAdd); } protected static boolean containsVCWithMatchingAlleles( final List list, final VariantContext vcToTest ) { diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java index a6b19826b..53fffec61 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java @@ -78,6 +78,8 @@ import org.broadinstitute.sting.utils.fragments.FragmentCollection; import org.broadinstitute.sting.utils.fragments.FragmentUtils; import org.broadinstitute.sting.utils.genotyper.PerReadAlleleLikelihoodMap; import org.broadinstitute.sting.utils.haplotype.Haplotype; +import org.broadinstitute.sting.utils.haplotype.HaplotypeBaseComparator; +import org.broadinstitute.sting.utils.haplotype.LDMerger; import org.broadinstitute.sting.utils.haplotypeBAMWriter.HaplotypeBAMWriter; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import org.broadinstitute.sting.utils.help.HelpConstants; @@ -302,6 +304,10 @@ public class HaplotypeCaller extends ActiveRegionWalker implem @Argument(fullName="useLowQualityBasesForAssembly", shortName="useLowQualityBasesForAssembly", doc="If specified, we will include low quality bases when doing the assembly", required = false) protected boolean useLowQualityBasesForAssembly = false; + @Hidden + @Argument(fullName="useNewLDMerger", shortName="useNewLDMerger", doc="If specified, we will include low quality bases when doing the assembly", required = false) + protected boolean useNewLDMerger = false; + // the UG engines private UnifiedGenotyperEngine UG_engine = null; private UnifiedGenotyperEngine UG_engine_simple_genotyper = null; @@ -412,7 +418,10 @@ public class HaplotypeCaller extends ActiveRegionWalker implem if ( useLowQualityBasesForAssembly ) assemblyEngine.setMinBaseQualityToUseInAssembly((byte)1); likelihoodCalculationEngine = new LikelihoodCalculationEngine( (byte)gcpHMM, DEBUG, pairHMM ); - genotypingEngine = new GenotypingEngine( DEBUG, annotationEngine, USE_FILTERED_READ_MAP_FOR_ANNOTATIONS ); + + final LDMerger ldMerger = new LDMerger(DEBUG, useNewLDMerger ? 10 : 10, useNewLDMerger ? 1 : 10); + + genotypingEngine = new GenotypingEngine( DEBUG, annotationEngine, USE_FILTERED_READ_MAP_FOR_ANNOTATIONS, ldMerger ); if ( bamWriter != null ) haplotypeBAMWriter = HaplotypeBAMWriter.create(bamWriterType, bamWriter, getToolkit().getSAMFileHeader()); @@ -545,7 +554,7 @@ public class HaplotypeCaller extends ActiveRegionWalker implem if( activeRegion.size() == 0 ) { return 1; } // no reads remain after filtering so nothing else to do! // sort haplotypes to take full advantage of haplotype start offset optimizations in PairHMM - Collections.sort( haplotypes, new Haplotype.HaplotypeBaseComparator() ); + Collections.sort( haplotypes, new HaplotypeBaseComparator() ); if (dontGenotype) return 1; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java index df1c9aabc..543b23d9c 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java @@ -158,17 +158,17 @@ public class LikelihoodCalculationEngine { @Ensures({"result.length == result[0].length", "result.length == alleleOrdering.size()"}) public static double[][] computeDiploidHaplotypeLikelihoods( final String sample, final Map stratifiedReadMap, - final List alleleOrdering ) { - final TreeSet sampleSet = new TreeSet(); - sampleSet.add(sample); - return computeDiploidHaplotypeLikelihoods(sampleSet, stratifiedReadMap, alleleOrdering); + final List alleleOrdering, + final boolean normalize ) { + return computeDiploidHaplotypeLikelihoods(Collections.singleton(sample), stratifiedReadMap, alleleOrdering, normalize); } @Requires({"alleleOrdering.size() > 0"}) @Ensures({"result.length == result[0].length", "result.length == alleleOrdering.size()"}) public static double[][] computeDiploidHaplotypeLikelihoods( final Set samples, final Map stratifiedReadMap, - final List alleleOrdering ) { + final List alleleOrdering, + final boolean normalize) { final int numHaplotypes = alleleOrdering.size(); final double[][] haplotypeLikelihoodMatrix = new double[numHaplotypes][numHaplotypes]; @@ -195,7 +195,7 @@ public class LikelihoodCalculationEngine { } // normalize the diploid likelihoods matrix - return normalizeDiploidLikelihoodMatrixFromLog10( haplotypeLikelihoodMatrix ); + return normalize ? normalizeDiploidLikelihoodMatrixFromLog10( haplotypeLikelihoodMatrix ) : haplotypeLikelihoodMatrix; } @Requires({"likelihoodMatrix.length == likelihoodMatrix[0].length"}) @@ -230,7 +230,7 @@ public class LikelihoodCalculationEngine { final List haplotypesAsAlleles = new ArrayList(); for( final Haplotype h : haplotypes ) { haplotypesAsAlleles.add(Allele.create(h, true)); } - final double[][] haplotypeLikelihoodMatrix = computeDiploidHaplotypeLikelihoods( sampleKeySet, stratifiedReadMap, haplotypesAsAlleles ); // all samples pooled together + final double[][] haplotypeLikelihoodMatrix = computeDiploidHaplotypeLikelihoods( sampleKeySet, stratifiedReadMap, haplotypesAsAlleles, true ); // all samples pooled together int hap1 = 0; int hap2 = 0; diff --git a/protected/java/src/org/broadinstitute/sting/utils/haplotype/HaplotypeLDCalculator.java b/protected/java/src/org/broadinstitute/sting/utils/haplotype/HaplotypeLDCalculator.java new file mode 100644 index 000000000..4609c3209 --- /dev/null +++ b/protected/java/src/org/broadinstitute/sting/utils/haplotype/HaplotypeLDCalculator.java @@ -0,0 +1,194 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.sting.utils.haplotype; + +import com.google.java.contract.Requires; +import org.broadinstitute.sting.gatk.walkers.haplotypecaller.LikelihoodCalculationEngine; +import org.broadinstitute.sting.utils.MathUtils; +import org.broadinstitute.sting.utils.genotyper.PerReadAlleleLikelihoodMap; +import org.broadinstitute.variant.variantcontext.Allele; +import org.broadinstitute.variant.variantcontext.VariantContext; + +import java.util.*; + +/** + * Computes the likelihood based probability that haplotypes for first and second variant contexts + * only appear in their fully linked form (x11 and x22) given a set of haplotypes where they might occur + * and read likelihoods per sample + * + * User: depristo + * Date: 3/29/13 + * Time: 9:23 AM + */ +public class HaplotypeLDCalculator { + private final List haplotypes; + private final Map haplotypeReadMap; + private List> haplotypeLikelihoodsPerSample = null; + + // linear contigency table with table[0] == [0][0], table[1] = [0][1], table[2] = [1][0], table[3] = [1][1] + private final double[] table = new double[4]; + + /** + * For testing + */ + protected HaplotypeLDCalculator() { + haplotypes = Collections.emptyList(); + haplotypeReadMap = Collections.emptyMap(); + } + + public HaplotypeLDCalculator(List haplotypes, Map haplotypeReadMap) { + this.haplotypes = haplotypes; + this.haplotypeReadMap = haplotypeReadMap; + } + + /** + * Construct the cached list of summed haplotype likelihoods per sample if it + * hasn't already been computed. This data structure is lazy created but only + * needs to be made once when we make 1 merge decision as the data doesn't change + * no matter how many calls to computeProbOfBeingPhased + */ + private void buildHaplotypeLikelihoodsPerSampleIfNecessary() { + if ( haplotypeLikelihoodsPerSample == null ) { + // do the lazy computation + final Set samples = haplotypeReadMap.keySet(); + haplotypeLikelihoodsPerSample = new LinkedList>(); + for( final String sample : samples ) { + final Map map = new HashMap(haplotypes.size()); + for( final Haplotype h : haplotypes ) { + // count up the co-occurrences of the events for the R^2 calculation + final double haplotypeLikelihood = LikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(sample, haplotypeReadMap, Collections.singletonList(Allele.create(h, true)), false)[0][0]; + map.put(h, haplotypeLikelihood); + } + haplotypeLikelihoodsPerSample.add(map); + } + } + } + + /** + * Compute the likelihood based probability that that haplotypes for first and second are only x11 and x22 + * + * As opposed to the hypothesis that all four haplotypes (x11, x12, x21, and x22) exist in the population + * + * @param first a non-null VariantContext + * @param second a non-null VariantContext + * @return the probability that only x11 and x22 exist among the samples + */ + protected double computeProbOfBeingPhased(final VariantContext first, final VariantContext second) { + buildHaplotypeLikelihoodsPerSampleIfNecessary(); + + Arrays.fill(table, Double.NEGATIVE_INFINITY); + + for ( final Map entry : haplotypeLikelihoodsPerSample ) { + for ( final Map.Entry haplotypeLikelihood : entry.entrySet() ) { + final Haplotype h = haplotypeLikelihood.getKey(); + // count up the co-occurrences of the events for the R^2 calculation + final VariantContext thisHapVC = h.getEventMap().get(first.getStart()); + final VariantContext nextHapVC = h.getEventMap().get(second.getStart()); // TODO -- add function to take a VC + final int i = thisHapVC == null ? 0 : 1; + final int j = nextHapVC == null ? 0 : 1; + final int index = 2 * i + j; + table[index] = MathUtils.approximateLog10SumLog10(table[index], haplotypeLikelihood.getValue()); + } + } + + return pPhased(table); + } + + /** + * Compute probability that two variants are in phase with each other and that no + * compound hets exist in the population. + * + * Implemented as a likelihood ratio test of the hypothesis: + * + * x11 and x22 are the only haplotypes in the populations + * + * vs. + * + * all four haplotype combinations (x11, x12, x21, and x22) all exist in the population. + * + * Now, since we have to have both variants in the population, we exclude the x11 & x11 state. So the + * p of having just x11 and x22 is P(x11 & x22) + p(x22 & x22). + * + * Alternatively, we might have any configuration that gives us both 1 and 2 alts, which are: + * + * - P(x11 & x12 & x21) -- we have hom-ref and both hets + * - P(x22 & x12 & x21) -- we have hom-alt and both hets + * - P(x22 & x12) -- one haplotype is 22 and the other is het 12 + * - P(x22 & x21) -- one haplotype is 22 and the other is het 21 + * + * The probability is just p11_22 / (p11_22 + p hets) + * + * @table linear contigency table with table[0] == [0][0], table[1] = [0][1], table[2] = [1][0], table[3] = [1][1] + * doesn't have to be normalized as this function does the normalization internally + * @return the real space probability that the data is phased + */ + @Requires("table.length == 4") + protected double pPhased( double[] table ) { + final double[] normTable = MathUtils.normalizeFromLog10(table, true); + + final double x11 = normTable[0], x12 = normTable[1], x21 = normTable[2], x22 = normTable[3]; + + // probability that we are only x11 && x22 + final double p11_22 = MathUtils.approximateLog10SumLog10(x11 + x22, x22 + x22); + + // probability of having any of the other pairs + final double p11_12_21 = MathUtils.approximateLog10SumLog10(x11 + x12, x11 + x21, x12 + x21); + final double p22_12_21 = MathUtils.approximateLog10SumLog10(x22 + x12, x22 + x21, x12 + x21); + final double p22_12 = x22 + x12; + final double p22_21 = x22 + x21; + final double pOthers = MathUtils.approximateLog10SumLog10(new double[]{p11_12_21, p22_12_21, p22_12, p22_21}); + + // probability of being phases is the ratio of p11_22 / pOthers which in log space is just a substraction + final double log10phased = p11_22 - (MathUtils.approximateLog10SumLog10(p11_22, pOthers)); + + return Math.pow(10.0, log10phased); + } + + protected double pPhasedTest( final double x11, final double x12, final double x21, final double x22 ) { + return pPhased(new double[]{x11, x12, x21, x22}); + } +} diff --git a/protected/java/src/org/broadinstitute/sting/utils/haplotype/LDMerger.java b/protected/java/src/org/broadinstitute/sting/utils/haplotype/LDMerger.java new file mode 100644 index 000000000..ea00a1901 --- /dev/null +++ b/protected/java/src/org/broadinstitute/sting/utils/haplotype/LDMerger.java @@ -0,0 +1,303 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.sting.utils.haplotype; + +import org.apache.commons.lang.ArrayUtils; +import org.apache.log4j.Logger; +import org.broadinstitute.sting.utils.GenomeLoc; +import org.broadinstitute.sting.utils.genotyper.PerReadAlleleLikelihoodMap; +import org.broadinstitute.variant.variantcontext.Allele; +import org.broadinstitute.variant.variantcontext.VariantContext; +import org.broadinstitute.variant.variantcontext.VariantContextBuilder; + +import java.util.*; + +/** + * Merges VariantContexts in a series of haplotypes according to their pairwise LD + * + * User: depristo + * Date: 3/28/13 + * Time: 6:17 PM + */ +public class LDMerger { + private final static Logger logger = Logger.getLogger(LDMerger.class); + + private final boolean DEBUG; + private final int minSamplesToMergeSNPs; + private final int minSamplesToMergeOtherEvents; + + public LDMerger(boolean DEBUG, int minSamplesToMergeSNPs, int minSamplesToMergeOtherEvents) { + this.DEBUG = DEBUG; + this.minSamplesToMergeSNPs = minSamplesToMergeSNPs; + this.minSamplesToMergeOtherEvents = minSamplesToMergeOtherEvents; + } + + protected LDMerger() { + this(false, 1, 1); + } + + // TODO -- should be class arguments and static variables in HC + protected final static int MAX_DISTANCE_BETWEEN_SNPS_TO_MERGE = 6; + protected final static int MAX_DISTANCE_BETWEEN_OTHER_EVENTS_TO_MERGE = 25; + + /** + * We require 99% confidence that only the phased haplotypes exist in the population to merge the records + */ + protected final static double MERGE_EVENTS_PROB_PHASED_THRESHOLD = 0.99; + + /** + * Merge as many events among the haplotypes as possible based on pairwise LD among variants + * + * @param haplotypes a list of haplotypes whose events we want to merge + * @param haplotypeReadMap map from sample name -> read likelihoods for each haplotype + * @param startPosKeySet a set of starting positions of all events among the haplotypes + * @param ref the reference bases + * @param refLoc the span of the reference bases + */ + public boolean mergeConsecutiveEventsBasedOnLD( final List haplotypes, + final Map haplotypeReadMap, + final TreeSet startPosKeySet, + final byte[] ref, + final GenomeLoc refLoc ) { + if ( haplotypes == null ) throw new IllegalArgumentException("haplotypes cannot be null"); + if ( haplotypeReadMap == null ) throw new IllegalArgumentException("haplotypeReadMap cannot be null"); + if ( startPosKeySet == null ) throw new IllegalArgumentException("startPosKeySet cannot be null"); + if ( ref == null ) throw new IllegalArgumentException("ref cannot be null"); + if ( refLoc == null ) throw new IllegalArgumentException("refLoc cannot be null"); + if ( refLoc.size() != ref.length ) throw new IllegalArgumentException("refLoc size " + refLoc.size() + " != ref.length " + ref.length + " at " + refLoc); + + if( startPosKeySet.size() <= 1 ) { return false; } + + final int nSamples = haplotypeReadMap.keySet().size(); + final HaplotypeLDCalculator r2Calculator = new HaplotypeLDCalculator(haplotypes, haplotypeReadMap); + boolean somethingWasMerged = false; + boolean mapWasUpdated = true; + while( mapWasUpdated ) { + mapWasUpdated = mergeConsecutiveEventsBasedOnLDOnce(haplotypes, r2Calculator, nSamples, startPosKeySet, ref, refLoc); + somethingWasMerged |= mapWasUpdated; + } + return somethingWasMerged; + } + + /** + * Merge the next pair of events, if possible + * + * @param haplotypes a list of haplotypes whose events we want to merge + * @param ldCalculator calculates R^2 for pairs of events on demand + * @param startPosKeySet a set of starting positions of all events among the haplotypes + * @param ref the reference bases + * @param refLoc the span of the reference bases + * @return true if something was merged, false otherwise + */ + protected boolean mergeConsecutiveEventsBasedOnLDOnce( final List haplotypes, + final HaplotypeLDCalculator ldCalculator, + final int nSamples, + final TreeSet startPosKeySet, + final byte[] ref, + final GenomeLoc refLoc ) { + // loop over the set of start locations and consider pairs that start near each other + final Iterator iter = startPosKeySet.iterator(); + int thisStart = iter.next(); + while( iter.hasNext() ) { + final int nextStart = iter.next(); + final LDMergeData toMerge = getPairOfEventsToMerge(haplotypes, thisStart, nextStart); + + if ( toMerge.canBeMerged(nSamples) ) { + final double pPhased = ldCalculator.computeProbOfBeingPhased(toMerge.firstVC, toMerge.secondVC); + + if( DEBUG ) { + logger.info("Found consecutive biallelic events with R^2 = " + String.format("%.4f", pPhased)); + logger.info("-- " + toMerge.firstVC); + logger.info("-- " + toMerge.secondVC); + } + + if( pPhased > MERGE_EVENTS_PROB_PHASED_THRESHOLD) { + final VariantContext mergedVC = createMergedVariantContext(toMerge.firstVC, toMerge.secondVC, ref, refLoc); + // if for some reason the merging resulting in a bad allele, mergedVC will be null, and we will just remove first and second + replaceVariantContextsInMap(haplotypes, startPosKeySet, mergedVC, toMerge.firstVC, toMerge.secondVC); + return true; // break out of tree set iteration since it was just updated, start over from the beginning and keep merging events + } + } + + thisStart = nextStart; + } + + return false; + } + + /** + * Info about potential LD merge of two variant contexts + */ + private class LDMergeData { + VariantContext firstVC = null, secondVC = null; + boolean canBeMerged = true; + + /** Tell this object that it cant be merged for some reason */ + public LDMergeData cantBeMerged() { + canBeMerged = false; + return this; + } + + /** + * Can these two events be merged + * @param nSamples the number of samples we're considering + * @return true if we can merge our two variant contexts + */ + public boolean canBeMerged(final int nSamples) { + if ( ! canBeMerged || firstVC == null || secondVC == null ) + return false; + + final int distance = secondVC.getStart() - firstVC.getEnd(); + if ( firstVC.isSNP() && secondVC.isSNP() ) { + return nSamples >= minSamplesToMergeSNPs && distance <= MAX_DISTANCE_BETWEEN_SNPS_TO_MERGE; + } else { + return nSamples >= minSamplesToMergeOtherEvents && distance <= MAX_DISTANCE_BETWEEN_OTHER_EVENTS_TO_MERGE; + } + } + } + + /** + * Get the information about the potential merge of two events starting at thisStart and nextStart + * @param haplotypes our haplotypes + * @param thisStart the starting position of the first event to merge + * @param nextStart the starting position of the next event to merge + * @return + */ + private LDMergeData getPairOfEventsToMerge(final List haplotypes, final int thisStart, final int nextStart) { + final LDMergeData mergeData = new LDMergeData(); + + for( final Haplotype h : haplotypes ) { + // only make complex substitutions out of consecutive biallelic sites + final VariantContext thisHapVC = h.getEventMap().get(thisStart); + if( thisHapVC != null && !thisHapVC.isSymbolic() ) { // something was found at this location on this haplotype + if( mergeData.firstVC == null ) { + mergeData.firstVC = thisHapVC; + } else if( !thisHapVC.hasSameAllelesAs( mergeData.firstVC) ) { + return mergeData.cantBeMerged(); + } + } + final VariantContext nextHapVC = h.getEventMap().get(nextStart); + if( nextHapVC != null && !nextHapVC.isSymbolic() ) { // something was found at the next location on this haplotype + if( mergeData.secondVC == null ) { + mergeData.secondVC = nextHapVC; + } else if( !nextHapVC.hasSameAllelesAs( mergeData.secondVC) ) { + return mergeData.cantBeMerged(); + } + } + } + + // don't try to merge overlapping events + if ( mergeData.firstVC != null && mergeData.secondVC != null && mergeData.firstVC.getEnd() >= mergeData.secondVC.getStart() ) + return mergeData.cantBeMerged(); + + return mergeData; + } + + // BUGBUG: make this merge function more general + protected VariantContext createMergedVariantContext( final VariantContext thisVC, final VariantContext nextVC, final byte[] ref, final GenomeLoc refLoc ) { + final int thisStart = thisVC.getStart(); + final int nextStart = nextVC.getStart(); + byte[] refBases = new byte[]{}; + byte[] altBases = new byte[]{}; + refBases = ArrayUtils.addAll(refBases, thisVC.getReference().getBases()); + altBases = ArrayUtils.addAll(altBases, thisVC.getAlternateAllele(0).getBases()); + int locus; + for( locus = thisStart + refBases.length; locus < nextStart; locus++ ) { + final byte refByte = ref[locus - refLoc.getStart()]; + refBases = ArrayUtils.add(refBases, refByte); + altBases = ArrayUtils.add(altBases, refByte); + } + refBases = ArrayUtils.addAll(refBases, ArrayUtils.subarray(nextVC.getReference().getBases(), locus > nextStart ? 1 : 0, nextVC.getReference().getBases().length)); // special case of deletion including the padding base of consecutive indel + altBases = ArrayUtils.addAll(altBases, nextVC.getAlternateAllele(0).getBases()); + + int iii = 0; + if( refBases.length == altBases.length ) { // insertion + deletion of same length creates an MNP --> trim common prefix bases off the beginning of the allele + while( iii < refBases.length && refBases[iii] == altBases[iii] ) { iii++; } + if ( iii == refBases.length ) { + // we've become a null allele, such as with CA/C + A/AA -> CA/CA => after trimming there's nothing left + // so return a null variant context so we can eliminate the variants from consideration + return null; + } + } + + + final Allele refAllele = Allele.create( ArrayUtils.subarray(refBases, iii, refBases.length), true ); + final Allele altAllele = Allele.create( ArrayUtils.subarray(altBases, iii, altBases.length), false ); + return new VariantContextBuilder("merged", thisVC.getChr(), thisVC.getStart() + iii, nextVC.getEnd(), Arrays.asList(refAllele, altAllele)).make(); + } + + /** + * Update the event maps in all haplotypes to replace a replacement of update1 and 2 with replacement + * + * @param haplotypes the haplotypes whose event maps we need to update + * @param startPosKeySet a sorted set of start positions that we must update + * @param replacement a VariantContext to replace update1 and update2 with. Can be null, indicating that we just want to remove update1 and update2 + * @param update1 the first VC we want to update + * @param update2 the second VC we want to update + */ + private void replaceVariantContextsInMap(final List haplotypes, + final TreeSet startPosKeySet, + final VariantContext replacement, + final VariantContext update1, final VariantContext update2) { + // remove the old event from the eventMap on every haplotype and the start pos key set, replace with merged event + for( final Haplotype h : haplotypes ) { + // if we had both events, add replacement. In some cases the haplotype may not have both + // events but they were still merged because the haplotype isn't a particularly informative + // haplotype in any case. The order of operations here is important because we are modifying the map + final boolean shouldAdd = h.getEventMap().containsKey(update1.getStart()) && h.getEventMap().containsKey(update2.getStart()); + h.getEventMap().remove(update1.getStart()); + h.getEventMap().remove(update2.getStart()); + if ( shouldAdd && replacement != null ) { + h.getEventMap().addVC(replacement, false); // cannot merge we other events at the same position + } + } + + startPosKeySet.remove(update1.getStart()); + startPosKeySet.remove(update2.getStart()); + if ( replacement != null ) startPosKeySet.add(replacement.getStart()); + } +} diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngineUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngineUnitTest.java index 9fb75463a..6a66d9845 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngineUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngineUnitTest.java @@ -279,148 +279,6 @@ public class GenotypingEngineUnitTest extends BaseTest { Assert.assertTrue(compareVCMaps(calculatedMap, expectedMap)); } - /** - * Tests that we get the right values from the R^2 calculation - */ - @Test - public void testCalculateR2LD() { - logger.warn("Executing testCalculateR2LD"); - - Assert.assertEquals(GenotypingEngine.calculateR2LD(1,1,1,1), 0.0, 0.00001); - Assert.assertEquals(GenotypingEngine.calculateR2LD(100,100,100,100), 0.0, 0.00001); - Assert.assertEquals(GenotypingEngine.calculateR2LD(1,0,0,1), 1.0, 0.00001); - Assert.assertEquals(GenotypingEngine.calculateR2LD(100,0,0,100), 1.0, 0.00001); - Assert.assertEquals(GenotypingEngine.calculateR2LD(1,2,3,4), (0.1 - 0.12) * (0.1 - 0.12) / (0.3 * 0.7 * 0.4 * 0.6), 0.00001); - } - - @Test - public void testCreateMergedVariantContext() { - logger.warn("Executing testCreateMergedVariantContext"); - - final byte[] ref = "AATTCCGGAATTCCGGAATT".getBytes(); - final GenomeLoc refLoc = genomeLocParser.createGenomeLoc("2", 1700, 1700 + ref.length); - - // SNP + SNP = simple MNP - VariantContext thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make(); - VariantContext nextVC = new VariantContextBuilder().loc("2", 1704, 1704).alleles("C","G").make(); - VariantContext truthVC = new VariantContextBuilder().loc("2", 1703, 1704).alleles("TC","GG").source("merged").make(); - VariantContext mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // SNP + ref + SNP = MNP with ref base gap - thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make(); - nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","G").make(); - truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","GCG").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // insertion + SNP - thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TAAAAA").make(); - nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","G").make(); - truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","TAAAAACG").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // SNP + insertion - thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make(); - nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","CAAAAA").make(); - truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","GCCAAAAA").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // deletion + SNP - thisVC = new VariantContextBuilder().loc("2", 1703, 1704).alleles("TC","T").make(); - nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","G").make(); - truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","TG").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // SNP + deletion - thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make(); - nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make(); - truthVC = new VariantContextBuilder().loc("2", 1703, 1706).alleles("TCCG","GCC").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // insertion + deletion = MNP - thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TA").make(); - nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make(); - truthVC = new VariantContextBuilder().loc("2", 1704, 1706).alleles("CCG","ACC").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // insertion + deletion - thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TAAAAA").make(); - nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make(); - truthVC = new VariantContextBuilder().loc("2", 1703, 1706).alleles("TCCG","TAAAAACC").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // insertion + insertion - thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TA").make(); - nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","CA").make(); - truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","TACCA").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // deletion + deletion - thisVC = new VariantContextBuilder().loc("2", 1701, 1702).alleles("AT","A").make(); - nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make(); - truthVC = new VariantContextBuilder().loc("2", 1701, 1706).alleles("ATTCCG","ATCC").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // deletion + insertion (abutting) - thisVC = new VariantContextBuilder().loc("2", 1701, 1702).alleles("AT","A").make(); - nextVC = new VariantContextBuilder().loc("2", 1702, 1702).alleles("T","GCGCGC").make(); - truthVC = new VariantContextBuilder().loc("2", 1701, 1702).alleles("AT","AGCGCGC").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - - // complex + complex - thisVC = new VariantContextBuilder().loc("2", 1703, 1704).alleles("TC","AAA").make(); - nextVC = new VariantContextBuilder().loc("2", 1706, 1707).alleles("GG","AC").make(); - truthVC = new VariantContextBuilder().loc("2", 1703, 1707).alleles("TCCGG","AAACAC").source("merged").make(); - mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc); - logger.warn(truthVC + " == " + mergedVC); - Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); - Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); - Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); - } - /** * Private function to compare Map of VCs, it only checks the types and start locations of the VariantContext */ diff --git a/protected/java/test/org/broadinstitute/sting/utils/haplotype/HaplotypeBaseComparatorUnitTest.java b/protected/java/test/org/broadinstitute/sting/utils/haplotype/HaplotypeBaseComparatorUnitTest.java new file mode 100644 index 000000000..26384c190 --- /dev/null +++ b/protected/java/test/org/broadinstitute/sting/utils/haplotype/HaplotypeBaseComparatorUnitTest.java @@ -0,0 +1,77 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.sting.utils.haplotype; + +import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.sting.utils.Utils; +import org.testng.Assert; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.Arrays; +import java.util.Collections; +import java.util.List; + +public class HaplotypeBaseComparatorUnitTest extends BaseTest { + @Test + public void testComparison() { + final List rawStrings = Arrays.asList("A", "C", "AC", "CT", "GTC", "ACGT"); + final List lexStrings = new ArrayList(rawStrings); + Collections.sort(lexStrings); + + for ( final List seqs : Utils.makePermutations(lexStrings, lexStrings.size(), false) ) { + final List haps = new ArrayList(seqs.size()); + for ( final String seq : seqs ) { + haps.add(new Haplotype(seq.getBytes(), false)); + } + + Collections.sort(haps, new HaplotypeBaseComparator()); + for ( int i = 0; i < lexStrings.size(); i++ ) + Assert.assertEquals(haps.get(i).getBaseString(), lexStrings.get(i), "Failed sort " + haps + " expected " + lexStrings); + } + } +} diff --git a/protected/java/test/org/broadinstitute/sting/utils/haplotype/HaplotypeLDCalculatorUnitTest.java b/protected/java/test/org/broadinstitute/sting/utils/haplotype/HaplotypeLDCalculatorUnitTest.java new file mode 100644 index 000000000..3c3452bbf --- /dev/null +++ b/protected/java/test/org/broadinstitute/sting/utils/haplotype/HaplotypeLDCalculatorUnitTest.java @@ -0,0 +1,118 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.sting.utils.haplotype; + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.BeforeMethod; +import org.testng.annotations.Test; + +public class HaplotypeLDCalculatorUnitTest extends BaseTest { + HaplotypeLDCalculator calculator; + + @BeforeMethod + public void setUp() throws Exception { + calculator = new HaplotypeLDCalculator(); + } + + /** + * Tests that we get the right values from the R^2 calculation + */ + @Test + public void computeProbOfBeingPhased() { + logger.warn("Executing testCalculateR2LD"); + + // See AA, AB, and BA in population + Assert.assertEquals(calculator.pPhasedTest(0, 0, 0, -100), 0, 0.00001); + + // See AA, AB, BB in population + Assert.assertTrue(calculator.pPhasedTest(0, 0, -100, 0) < 0.5); + + // See AA and BB in population + Assert.assertEquals(calculator.pPhasedTest(0, -100, -100, 0), 1, 0.00001); + + // See AA, AB, and BA but no BBs in population + Assert.assertEquals(calculator.pPhasedTest(0, -20, -40, Double.NEGATIVE_INFINITY), 0, 0.00001); + + // See BB, AB, and BA but no AAs in population, so BB is the best explanation + Assert.assertEquals(calculator.pPhasedTest(Double.NEGATIVE_INFINITY, -20, -40, 0), 1, 0.00001); + + // See only AB and BA but no AAs nor BBs in population + Assert.assertEquals(calculator.pPhasedTest(Double.NEGATIVE_INFINITY, -20, -40, Double.NEGATIVE_INFINITY), 0, 0.00001); + + // Previously bad input + Assert.assertEquals(calculator.pPhasedTest(-400, -600, -1200, Double.NEGATIVE_INFINITY), 0, 0.00001); + + // first variant is just bad, so BA and BB are both very bad, shouldn't be phased + Assert.assertEquals(calculator.pPhasedTest(0, -1000, -100, -10000), 0, 0.00001); + + // second variant is just bad, so AB and BB are both very bad, shouldn't be phased + Assert.assertEquals(calculator.pPhasedTest(0, -100, -1000, -10000), 0, 0.00001); + + // AA is very good, all all others are quite poor. Shouldn't be phased + Assert.assertEquals(calculator.pPhasedTest(0, -1000, -1000, -10000), 0, 0.00001); + + + for ( int i = -10; i > -10000; i -= 10 ) { + // only bad het states + Assert.assertTrue(calculator.pPhasedTest(0, i, i, 0) > 0.99, "Failed for " + i); + + // BB state is terrible + Assert.assertTrue(calculator.pPhasedTest(0, 0, 0, i) < 0.5, "Failed for " + i); + + // truth is AB, BA, and BB + Assert.assertTrue(calculator.pPhasedTest(i, 0, 0, 0) < 0.5, "Failed for " + i); + + // truth is AB, BA + Assert.assertTrue(calculator.pPhasedTest(i, 0, 0, i) < 0.5, "Failed for " + i); + + // Only good signal is AB, so we shouldn't be phased + Assert.assertTrue(calculator.pPhasedTest(i, i, 0, i) < 0.5, "Failed for " + i); + Assert.assertTrue(calculator.pPhasedTest(i, 0, i, i) < 0.5, "Failed for " + i); + } + } +} diff --git a/protected/java/test/org/broadinstitute/sting/utils/haplotype/HaplotypeScoreComparatorUnitTest.java b/protected/java/test/org/broadinstitute/sting/utils/haplotype/HaplotypeScoreComparatorUnitTest.java new file mode 100644 index 000000000..64a62bc02 --- /dev/null +++ b/protected/java/test/org/broadinstitute/sting/utils/haplotype/HaplotypeScoreComparatorUnitTest.java @@ -0,0 +1,76 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.sting.utils.haplotype; + +import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.sting.utils.Utils; +import org.testng.Assert; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.Arrays; +import java.util.Collections; +import java.util.List; + +public class HaplotypeScoreComparatorUnitTest extends BaseTest { + @Test + public void testComparison() { + final List scores = Arrays.asList(3.0, 2.0, 1.0); + for ( final List myScores : Utils.makePermutations(scores, scores.size(), false) ) { + final List haps = new ArrayList(myScores.size()); + for ( final double score : myScores ) { + final Haplotype h = new Haplotype("ACT".getBytes(), false); + h.setScore(score); + haps.add(h); + } + + Collections.sort(haps, new HaplotypeScoreComparator()); + for ( int i = 0; i < myScores.size(); i++ ) + Assert.assertEquals(haps.get(i).getScore(), scores.get(i)); + } + } +} diff --git a/protected/java/test/org/broadinstitute/sting/utils/haplotype/LDMergerUnitTest.java b/protected/java/test/org/broadinstitute/sting/utils/haplotype/LDMergerUnitTest.java new file mode 100644 index 000000000..a2c69e535 --- /dev/null +++ b/protected/java/test/org/broadinstitute/sting/utils/haplotype/LDMergerUnitTest.java @@ -0,0 +1,334 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.sting.utils.haplotype; + +import net.sf.samtools.TextCigarCodec; +import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.sting.utils.*; +import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; +import org.broadinstitute.variant.variantcontext.VariantContext; +import org.broadinstitute.variant.variantcontext.VariantContextBuilder; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.BeforeMethod; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.io.File; +import java.io.FileNotFoundException; +import java.util.ArrayList; +import java.util.Arrays; +import java.util.List; +import java.util.TreeSet; + +public class LDMergerUnitTest extends BaseTest { + LDMerger merger; + GenomeLocParser genomeLocParser; + + @BeforeClass + public void init() throws FileNotFoundException { + genomeLocParser = new GenomeLocParser(new CachingIndexedFastaSequenceFile(new File(b37KGReference))); + } + + @BeforeMethod + public void setUp() throws Exception { + merger = new LDMerger(); + } + + @Test + public void testCreateMergedVariantContext() { + logger.warn("Executing testCreateMergedVariantContext"); + + final byte[] ref = "AATTCCGGAATTCCGGAATT".getBytes(); + final GenomeLoc refLoc = genomeLocParser.createGenomeLoc("2", 1700, 1700 + ref.length); + + // SNP + SNP = simple MNP + VariantContext thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make(); + VariantContext nextVC = new VariantContextBuilder().loc("2", 1704, 1704).alleles("C","G").make(); + VariantContext truthVC = new VariantContextBuilder().loc("2", 1703, 1704).alleles("TC","GG").source("merged").make(); + VariantContext mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // SNP + ref + SNP = MNP with ref base gap + thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make(); + nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","G").make(); + truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","GCG").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // insertion + SNP + thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TAAAAA").make(); + nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","G").make(); + truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","TAAAAACG").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // SNP + insertion + thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make(); + nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","CAAAAA").make(); + truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","GCCAAAAA").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // deletion + SNP + thisVC = new VariantContextBuilder().loc("2", 1703, 1704).alleles("TC","T").make(); + nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","G").make(); + truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","TG").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // SNP + deletion + thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make(); + nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make(); + truthVC = new VariantContextBuilder().loc("2", 1703, 1706).alleles("TCCG","GCC").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // insertion + deletion = MNP + thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TA").make(); + nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make(); + truthVC = new VariantContextBuilder().loc("2", 1704, 1706).alleles("CCG","ACC").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // insertion + deletion + thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TAAAAA").make(); + nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make(); + truthVC = new VariantContextBuilder().loc("2", 1703, 1706).alleles("TCCG","TAAAAACC").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // insertion + insertion + thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TA").make(); + nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","CA").make(); + truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","TACCA").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // deletion + deletion + thisVC = new VariantContextBuilder().loc("2", 1701, 1702).alleles("AT","A").make(); + nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make(); + truthVC = new VariantContextBuilder().loc("2", 1701, 1706).alleles("ATTCCG","ATCC").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // deletion + insertion (abutting) + thisVC = new VariantContextBuilder().loc("2", 1701, 1702).alleles("AT","A").make(); + nextVC = new VariantContextBuilder().loc("2", 1702, 1702).alleles("T","GCGCGC").make(); + truthVC = new VariantContextBuilder().loc("2", 1701, 1702).alleles("AT","AGCGCGC").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + + // complex + complex + thisVC = new VariantContextBuilder().loc("2", 1703, 1704).alleles("TC","AAA").make(); + nextVC = new VariantContextBuilder().loc("2", 1706, 1707).alleles("GG","AC").make(); + truthVC = new VariantContextBuilder().loc("2", 1703, 1707).alleles("TCCGG","AAACAC").source("merged").make(); + mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + logger.warn(truthVC + " == " + mergedVC); + Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC)); + Assert.assertEquals(truthVC.getStart(), mergedVC.getStart()); + Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd()); + } + + @Test + public void testInsertionDeletionBecomingNullAllele() { + final byte[] ref = "CAAA".getBytes(); + final GenomeLoc refLoc = genomeLocParser.createGenomeLoc("2", 1700, 1700 + ref.length); + + // insertion + deletion results in a null allele, should return false + final VariantContext thisVC = new VariantContextBuilder().loc("2", 1700, 1701).alleles("CA","C").make(); + final VariantContext nextVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("A","AA").make(); + final VariantContext mergedVC = merger.createMergedVariantContext(thisVC, nextVC, ref, refLoc); + Assert.assertNull(mergedVC, "Insertion deletion becoming a null allele should return a null variant context"); + } + + /** + * Just returns a given R2 value for testing + */ + private static class MockLDCalculator extends HaplotypeLDCalculator { + private final double R2; + + private MockLDCalculator(double r2) { + R2 = r2; + } + + @Override + protected double computeProbOfBeingPhased(VariantContext first, VariantContext second) { + return R2; + } + } + + @DataProvider(name = "R2MergerData") + public Object[][] makeR2MergerData() { + List tests = new ArrayList(); + + // this functionality can be adapted to provide input data for whatever you might want in your data + final double thres = LDMerger.MERGE_EVENTS_PROB_PHASED_THRESHOLD; + for ( final double r2 : Arrays.asList(0.0, thres - 0.01, thres + 0.01, 1.0) ) { + tests.add(new Object[]{"ACGT", "CCGC", 2, "4M", "ACGT", "CCGC", r2, r2 >= thres}); + tests.add(new Object[]{"ACGT", "AGGC", 2, "4M", "CGT", "GGC", r2, r2 >= thres}); + tests.add(new Object[]{"ACGT", "ACCC", 2, "4M", "GT", "CC", r2, r2 >= thres}); + tests.add(new Object[]{"ACGT", "ACCGTT", 2, "2M1I1M1I1M", "CG", "CCGT", r2, r2 >= thres}); + tests.add(new Object[]{"ACGT", "AGCT", 2, "4M", "CG", "GC", r2, r2 >= thres}); + tests.add(new Object[]{"ACAGT", "AAGC", 2, "1M1D3M", "ACAGT", "AAGC", r2, r2 >= thres}); + tests.add(new Object[]{"ACAGT", "AAT", 2, "1M1D1M1D1M", "ACAG", "AA", r2, r2 >= thres}); + + // cannot be merged -- only 1 event + tests.add(new Object[]{"AAA", "ACA", 1, "3M", null, null, r2, false}); + + final int dist = LDMerger.MAX_DISTANCE_BETWEEN_SNPS_TO_MERGE + 2; + tests.add(new Object[]{Utils.dupString("A", dist), "C" + Utils.dupString("A", dist - 2) + "C", 2, dist + "M", null, null, r2, false}); + } + + return tests.toArray(new Object[][]{}); + } + + @Test(dataProvider = "R2MergerData") + public void testR2Merger(final String refS, final String hapS, int nEvents, final String cigar, final String expectedMergedRef, final String expectedMergedAlt, final double r2, final boolean expectMerge) { + final Haplotype ref = new Haplotype(refS.getBytes(), true, 0, TextCigarCodec.getSingleton().decode(refS.length() + "M")); + final Haplotype hap = new Haplotype(hapS.getBytes(), false, 0, TextCigarCodec.getSingleton().decode(cigar)); + final GenomeLoc loc = new UnvalidatingGenomeLoc("1", 0, 1, ref.length()); + + final List haplotypes = Arrays.asList(ref, hap); + final TreeSet vcStarts = EventMap.buildEventMapsForHaplotypes(haplotypes, ref.getBases(), loc, false); + final MockLDCalculator r2Calc = new MockLDCalculator(r2); + + Assert.assertEquals(vcStarts.size(), nEvents); + final boolean merged = merger.mergeConsecutiveEventsBasedOnLDOnce(haplotypes, r2Calc, 1, vcStarts, ref.getBases(), loc); + Assert.assertEquals(merged, expectMerge); + Assert.assertEquals(vcStarts.size(), expectMerge ? 1 : nEvents); + if ( expectMerge ) { + final VariantContext vc = hap.getEventMap().getVariantContexts().iterator().next(); + Assert.assertTrue(vc.isBiallelic()); + Assert.assertEquals(vc.getReference().getDisplayString(), expectedMergedRef); + Assert.assertEquals(vc.getAlternateAllele(0).getDisplayString(), expectedMergedAlt); + } + } + + @Test + public void testR2MergerWithThirdHapWithoutEvent() { + final String refS = "ACGT"; + final String hapS = "CCGA"; + final String cigar = "4M"; + final Haplotype ref = new Haplotype(refS.getBytes(), true, 0, TextCigarCodec.getSingleton().decode(refS.length() + "M")); + final Haplotype hap1 = new Haplotype(hapS.getBytes(), false, 0, TextCigarCodec.getSingleton().decode(cigar)); + final Haplotype hap2 = new Haplotype("ACGA".getBytes(), false, 0, TextCigarCodec.getSingleton().decode(cigar)); + final GenomeLoc loc = new UnvalidatingGenomeLoc("1", 0, 1, ref.length()); + + final List haplotypes = Arrays.asList(ref, hap1, hap2); + final TreeSet vcStarts = EventMap.buildEventMapsForHaplotypes(haplotypes, ref.getBases(), loc, false); + final MockLDCalculator r2Calc = new MockLDCalculator(1.0); + + Assert.assertEquals(vcStarts.size(), 2); + final boolean merged = merger.mergeConsecutiveEventsBasedOnLDOnce(haplotypes, r2Calc, 1, vcStarts, ref.getBases(), loc); + Assert.assertEquals(merged, true); + Assert.assertEquals(vcStarts.size(), 1); + + final VariantContext vc = hap1.getEventMap().getVariantContexts().iterator().next(); + Assert.assertTrue(vc.isBiallelic()); + Assert.assertEquals(vc.getReference().getDisplayString(), "ACGT"); + Assert.assertEquals(vc.getAlternateAllele(0).getDisplayString(), "CCGA"); + + Assert.assertEquals(hap2.getEventMap().size(), 0); + } + + @Test + public void testR2MergerWithMultipleAllelesAtSites() { + final String refS = "ACGT"; + final String hapS = "TCGA"; + final String cigar = "4M"; + final Haplotype ref = new Haplotype(refS.getBytes(), true, 0, TextCigarCodec.getSingleton().decode(refS.length() + "M")); + final Haplotype hap1 = new Haplotype(hapS.getBytes(), false, 0, TextCigarCodec.getSingleton().decode(cigar)); + + final GenomeLoc loc = new UnvalidatingGenomeLoc("1", 0, 1, ref.length()); + for (final String hap2S : Arrays.asList("GCGA", "TCGG")) { + final Haplotype hap2 = new Haplotype(hap2S.getBytes(), false, 0, TextCigarCodec.getSingleton().decode(cigar)); + + final List haplotypes = Arrays.asList(ref, hap1, hap2); + final TreeSet vcStarts = EventMap.buildEventMapsForHaplotypes(haplotypes, ref.getBases(), loc, false); + final MockLDCalculator r2Calc = new MockLDCalculator(1.0); + + Assert.assertEquals(vcStarts.size(), 2); + final boolean merged = merger.mergeConsecutiveEventsBasedOnLDOnce(haplotypes, r2Calc, 1, vcStarts, ref.getBases(), loc); + Assert.assertEquals(merged, false); + Assert.assertEquals(vcStarts.size(), 2); + } + } +} \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/utils/haplotype/EventExtractor.java b/public/java/src/org/broadinstitute/sting/utils/haplotype/EventMap.java similarity index 58% rename from public/java/src/org/broadinstitute/sting/utils/haplotype/EventExtractor.java rename to public/java/src/org/broadinstitute/sting/utils/haplotype/EventMap.java index c32cde641..7bc6acbfe 100644 --- a/public/java/src/org/broadinstitute/sting/utils/haplotype/EventExtractor.java +++ b/public/java/src/org/broadinstitute/sting/utils/haplotype/EventMap.java @@ -1,27 +1,27 @@ /* - * Copyright (c) 2012 The Broad Institute - * - * Permission is hereby granted, free of charge, to any person - * obtaining a copy of this software and associated documentation - * files (the "Software"), to deal in the Software without - * restriction, including without limitation the rights to use, - * copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the - * Software is furnished to do so, subject to the following - * conditions: - * - * The above copyright notice and this permission notice shall be - * included in all copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, - * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES - * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND - * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT - * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, - * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING - * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR - * THE USE OR OTHER DEALINGS IN THE SOFTWARE. - */ +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ package org.broadinstitute.sting.utils.haplotype; @@ -35,7 +35,6 @@ import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.sam.AlignmentUtils; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.variantcontext.Allele; import org.broadinstitute.variant.variantcontext.VariantContext; import org.broadinstitute.variant.variantcontext.VariantContextBuilder; @@ -49,39 +48,40 @@ import java.util.*; * Date: 3/27/13 * Time: 8:35 AM */ -public class EventExtractor extends TreeMap { - private final static Logger logger = Logger.getLogger(EventExtractor.class); - private final static boolean mergeClumpedEvents = true; +public class EventMap extends TreeMap { + private final static Logger logger = Logger.getLogger(EventMap.class); protected final static int MIN_NUMBER_OF_EVENTS_TO_COMBINE_INTO_BLOCK_SUBSTITUTION = 3; public final static Allele SYMBOLIC_UNASSEMBLED_EVENT_ALLELE = Allele.create("", false); - public EventExtractor( final Haplotype haplotype, final byte[] ref, final GenomeLoc refLoc, final String sourceNameToAdd ) { + private final Haplotype haplotype; + private final byte[] ref; + private final GenomeLoc refLoc; + private final String sourceNameToAdd; + + public EventMap(final Haplotype haplotype, final byte[] ref, final GenomeLoc refLoc, final String sourceNameToAdd) { super(); + this.haplotype = haplotype; + this.ref = ref; + this.refLoc = refLoc; + this.sourceNameToAdd = sourceNameToAdd; - processCigarForInitialEvents(haplotype, ref, refLoc, sourceNameToAdd); - if ( mergeClumpedEvents && getNumberOfEvents() >= MIN_NUMBER_OF_EVENTS_TO_COMBINE_INTO_BLOCK_SUBSTITUTION) { - replaceClumpedEventsWithBlockSubstititions(haplotype, ref, refLoc); - } + processCigarForInitialEvents(); } /** * For testing. Let's you set up a explicit configuration without having to process a haplotype and reference * @param stateForTesting */ - protected EventExtractor(final Map stateForTesting) { - super(stateForTesting); - } - - /** - * For testing. Let's you set up a explicit configuration without having to process a haplotype and reference - * @param stateForTesting - */ - protected EventExtractor(final Collection stateForTesting) { + protected EventMap(final Collection stateForTesting) { + haplotype = null; + ref = null; + refLoc = null; + sourceNameToAdd = null; for ( final VariantContext vc : stateForTesting ) addVC(vc); } - protected void processCigarForInitialEvents(final Haplotype haplotype, final byte[] ref, final GenomeLoc refLoc, final String sourceNameToAdd) { + protected void processCigarForInitialEvents() { final Cigar cigar = haplotype.getCigar(); final byte[] alignment = haplotype.getBases(); @@ -172,11 +172,22 @@ public class EventExtractor extends TreeMap { } } - private void addVC(final VariantContext vc) { + /** + * Add VariantContext vc to this map, merging events with the same start sites if necessary + * @param vc the variant context to add + */ + protected void addVC(final VariantContext vc) { addVC(vc, true); } - private void addVC(final VariantContext vc, final boolean merge) { + /** + * Add VariantContext vc to this map + * @param vc the variant context to add + * @param merge should we attempt to merge it with an already existing element, or should we throw an error in that case? + */ + protected void addVC(final VariantContext vc, final boolean merge) { + if ( vc == null ) throw new IllegalArgumentException("vc cannot be null"); + if ( containsKey(vc.getStart()) ) { if ( merge ) { final VariantContext prev = get(vc.getStart()); @@ -188,20 +199,46 @@ public class EventExtractor extends TreeMap { put(vc.getStart(), vc); } - private VariantContext makeBlock(final VariantContext vc1, final VariantContext vc2) { - if ( ! vc1.isSNP() ) throw new IllegalArgumentException("vc1 must be a snp"); + /** + * Create a block substitution out of two variant contexts that start at the same position + * + * vc1 can be SNP, and vc2 can then be either a insertion or deletion. + * If vc1 is an indel, then vc2 must be the opposite type (vc1 deletion => vc2 must be an insertion) + * + * @param vc1 the first variant context we want to merge + * @param vc2 the second + * @return a block substitution that represents the composite substitution implied by vc1 and vc2 + */ + protected VariantContext makeBlock(final VariantContext vc1, final VariantContext vc2) { + if ( vc1.getStart() != vc2.getStart() ) throw new IllegalArgumentException("vc1 and 2 must have the same start but got " + vc1 + " and " + vc2); + if ( ! vc1.isBiallelic() ) throw new IllegalArgumentException("vc1 must be biallelic"); + if ( ! vc1.isSNP() ) { + if ( ! ((vc1.isSimpleDeletion() && vc2.isSimpleInsertion()) || (vc1.isSimpleInsertion() && vc2.isSimpleDeletion()))) + throw new IllegalArgumentException("Can only merge single insertion with deletion (or vice versa) but got " + vc1 + " merging with " + vc2); + } else if ( vc2.isSNP() ) { + throw new IllegalArgumentException("vc1 is " + vc1 + " but vc2 is a SNP, which implies there's been some terrible bug in the cigar " + vc2); + } - Allele ref, alt; + final Allele ref, alt; final VariantContextBuilder b = new VariantContextBuilder(vc1); - if ( vc1.getReference().equals(vc2.getReference()) ) { - // we've got an insertion, so we just update the alt to have the prev alt - ref = vc1.getReference(); - alt = Allele.create(vc1.getAlternateAllele(0).getDisplayString() + vc2.getAlternateAllele(0).getDisplayString().substring(1), false); + if ( vc1.isSNP() ) { + // we have to repair the first base, so SNP case is special cased + if ( vc1.getReference().equals(vc2.getReference()) ) { + // we've got an insertion, so we just update the alt to have the prev alt + ref = vc1.getReference(); + alt = Allele.create(vc1.getAlternateAllele(0).getDisplayString() + vc2.getAlternateAllele(0).getDisplayString().substring(1), false); + } else { + // we're dealing with a deletion, so we patch the ref + ref = vc2.getReference(); + alt = vc1.getAlternateAllele(0); + b.stop(vc2.getEnd()); + } } else { - // we're dealing with a deletion, so we patch the ref - ref = vc2.getReference(); - alt = vc1.getAlternateAllele(0); - b.stop(vc2.getEnd()); + final VariantContext insertion = vc1.isSimpleInsertion() ? vc1 : vc2; + final VariantContext deletion = vc1.isSimpleInsertion() ? vc2 : vc1; + ref = deletion.getReference(); + alt = insertion.getAlternateAllele(0); + b.stop(deletion.getEnd()); } return b.alleles(Arrays.asList(ref, alt)).make(); @@ -209,24 +246,26 @@ public class EventExtractor extends TreeMap { // TODO -- warning this is an O(N^3) algorithm because I'm just lazy. If it's valuable we need to reengineer it @Requires("getNumberOfEvents() > 0") - protected void replaceClumpedEventsWithBlockSubstititions(final Haplotype haplotype, final byte[] ref, final GenomeLoc refLoc) { - int lastStart = -1; - for ( boolean foundOne = true; foundOne; ) { - foundOne = false; - for ( final VariantContext vc : getVariantContexts() ) { - if ( vc.getStart() > lastStart ) { - lastStart = vc.getStart(); - final List neighborhood = getNeighborhood(vc, 10); - if ( updateToBlockSubstitutionIfBetter(neighborhood, haplotype, ref, refLoc) ) { - foundOne = true; - break; + protected void replaceClumpedEventsWithBlockSubstititions() { + if ( getNumberOfEvents() >= MIN_NUMBER_OF_EVENTS_TO_COMBINE_INTO_BLOCK_SUBSTITUTION) { + int lastStart = -1; + for ( boolean foundOne = true; foundOne; ) { + foundOne = false; + for ( final VariantContext vc : getVariantContexts() ) { + if ( vc.getStart() > lastStart ) { + lastStart = vc.getStart(); + final List neighborhood = getNeighborhood(vc, 10); + if ( updateToBlockSubstitutionIfBetter(neighborhood) ) { + foundOne = true; + break; + } } } } } } - protected boolean updateToBlockSubstitutionIfBetter(final List neighbors, final Haplotype haplotype, final byte[] ref, final GenomeLoc refLoc) { + protected boolean updateToBlockSubstitutionIfBetter(final List neighbors) { if (neighbors.size() < MIN_NUMBER_OF_EVENTS_TO_COMBINE_INTO_BLOCK_SUBSTITUTION) return false; // TODO -- need more tests to decide if this is really so good @@ -284,24 +323,70 @@ public class EventExtractor extends TreeMap { return neighbors; } + /** + * Get the starting positions of events in this event map + * @return + */ public Set getStartPositions() { return keySet(); } + /** + * Get the variant contexts in order of start position in this event map + * @return + */ public Collection getVariantContexts() { return values(); } + /** + * How many events do we have? + * @return + */ public int getNumberOfEvents() { return size(); } @Override public String toString() { - final StringBuilder b = new StringBuilder("EventExtractor{"); + final StringBuilder b = new StringBuilder("EventMap{"); for ( final VariantContext vc : getVariantContexts() ) b.append(String.format("%s:%d-%d %s,", vc.getChr(), vc.getStart(), vc.getEnd(), vc.getAlleles())); b.append("}"); return b.toString(); } + + /** + * Build event maps for each haplotype, returning the sorted set of all of the starting positions of all + * events across all haplotypes + * + * @param haplotypes a list of haplotypes + * @param ref the reference bases + * @param refLoc the span of the reference bases + * @param debug if true, we'll emit debugging information during this operation + * @return a sorted set of start positions of all events among all haplotypes + */ + public static TreeSet buildEventMapsForHaplotypes( final List haplotypes, + final byte[] ref, + final GenomeLoc refLoc, + final boolean debug) { + // Using the cigar from each called haplotype figure out what events need to be written out in a VCF file + final TreeSet startPosKeySet = new TreeSet(); + int hapNumber = 0; + + if( debug ) logger.info("=== Best Haplotypes ==="); + for( final Haplotype h : haplotypes ) { + // Walk along the alignment and turn any difference from the reference into an event + h.setEventMap( new EventMap( h, ref, refLoc, "HC" + hapNumber++ ) ); + startPosKeySet.addAll(h.getEventMap().getStartPositions()); + + if( debug ) { + logger.info(h.toString()); + logger.info("> Cigar = " + h.getCigar()); + logger.info(">> Events = " + h.getEventMap()); + } + } + + return startPosKeySet; + } } diff --git a/public/java/src/org/broadinstitute/sting/utils/haplotype/Haplotype.java b/public/java/src/org/broadinstitute/sting/utils/haplotype/Haplotype.java index a94c08198..081fd14e0 100644 --- a/public/java/src/org/broadinstitute/sting/utils/haplotype/Haplotype.java +++ b/public/java/src/org/broadinstitute/sting/utils/haplotype/Haplotype.java @@ -37,15 +37,13 @@ import org.broadinstitute.sting.utils.sam.AlignmentUtils; import org.broadinstitute.sting.utils.sam.ReadUtils; import org.broadinstitute.variant.variantcontext.Allele; -import java.io.Serializable; import java.util.Arrays; -import java.util.Comparator; import java.util.LinkedHashMap; import java.util.List; public class Haplotype extends Allele { private GenomeLoc genomeLocation = null; - private EventExtractor eventMap = null; + private EventMap eventMap = null; private Cigar cigar; private int alignmentStartHapwrtRef; private Event artificialEvent = null; @@ -115,11 +113,11 @@ public class Haplotype extends Allele { return Arrays.hashCode(getBases()); } - public EventExtractor getEventMap() { + public EventMap getEventMap() { return eventMap; } - public void setEventMap( final EventExtractor eventMap ) { + public void setEventMap( final EventMap eventMap ) { this.eventMap = eventMap; } @@ -219,25 +217,6 @@ public class Haplotype extends Allele { return new Haplotype(newHaplotypeBases, new Event(refAllele, altAllele, genomicInsertLocation)); } - public static class HaplotypeBaseComparator implements Comparator, Serializable { - @Override - public int compare( final Haplotype hap1, final Haplotype hap2 ) { - return compareHaplotypeBases(hap1, hap2); - } - - public static int compareHaplotypeBases(final Haplotype hap1, final Haplotype hap2) { - final byte[] arr1 = hap1.getBases(); - final byte[] arr2 = hap2.getBases(); - // compares byte arrays using lexical ordering - final int len = Math.min(arr1.length, arr2.length); - for( int iii = 0; iii < len; iii++ ) { - final int cmp = arr1[iii] - arr2[iii]; - if (cmp != 0) { return cmp; } - } - return arr2.length - arr1.length; - } - } - public static LinkedHashMap makeHaplotypeListFromAlleles(final List alleleList, final int startPos, final ReferenceContext ref, @@ -316,15 +295,4 @@ public class Haplotype extends Allele { public void setScore(double score) { this.score = this.isReference() ? Double.MAX_VALUE : score; } - - /** - * A comparator that sorts haplotypes in decreasing order of score, so that the best supported - * haplotypes are at the top - */ - public static class ScoreComparator implements Comparator { - @Override - public int compare(Haplotype o1, Haplotype o2) { - return -1 * Double.valueOf(o1.getScore()).compareTo(o2.getScore()); - } - } } diff --git a/public/java/src/org/broadinstitute/sting/utils/haplotype/HaplotypeBaseComparator.java b/public/java/src/org/broadinstitute/sting/utils/haplotype/HaplotypeBaseComparator.java new file mode 100644 index 000000000..191442e3e --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/haplotype/HaplotypeBaseComparator.java @@ -0,0 +1,42 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.sting.utils.haplotype; + +import java.util.Comparator; + +/** + * Compares two haplotypes in the lexicographic order of their bases + * + * User: depristo + * Date: 3/29/13 + * Time: 11:09 AM + */ +public class HaplotypeBaseComparator implements Comparator { + @Override + public int compare( final Haplotype hap1, final Haplotype hap2 ) { + return hap1.getBaseString().compareTo(hap2.getBaseString()); + } +} diff --git a/public/java/src/org/broadinstitute/sting/utils/haplotype/HaplotypeScoreComparator.java b/public/java/src/org/broadinstitute/sting/utils/haplotype/HaplotypeScoreComparator.java new file mode 100644 index 000000000..40146ba88 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/haplotype/HaplotypeScoreComparator.java @@ -0,0 +1,39 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.sting.utils.haplotype; + +import java.util.Comparator; + +/** + * A comparator that sorts haplotypes in decreasing order of score, so that the best supported + * haplotypes are at the top + */ +public class HaplotypeScoreComparator implements Comparator { + @Override + public int compare(Haplotype o1, Haplotype o2) { + return -1 * Double.valueOf(o1.getScore()).compareTo(o2.getScore()); + } +} diff --git a/public/java/test/org/broadinstitute/sting/utils/haplotype/EventExtractorUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/haplotype/EventMapUnitTest.java similarity index 61% rename from public/java/test/org/broadinstitute/sting/utils/haplotype/EventExtractorUnitTest.java rename to public/java/test/org/broadinstitute/sting/utils/haplotype/EventMapUnitTest.java index 480f82a46..d0b418b96 100644 --- a/public/java/test/org/broadinstitute/sting/utils/haplotype/EventExtractorUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/haplotype/EventMapUnitTest.java @@ -1,27 +1,27 @@ /* - * Copyright (c) 2012 The Broad Institute - * - * Permission is hereby granted, free of charge, to any person - * obtaining a copy of this software and associated documentation - * files (the "Software"), to deal in the Software without - * restriction, including without limitation the rights to use, - * copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the - * Software is furnished to do so, subject to the following - * conditions: - * - * The above copyright notice and this permission notice shall be - * included in all copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, - * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES - * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND - * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT - * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, - * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING - * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR - * THE USE OR OTHER DEALINGS IN THE SOFTWARE. - */ +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ package org.broadinstitute.sting.utils.haplotype; @@ -31,16 +31,14 @@ import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.UnvalidatingGenomeLoc; import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; -import org.broadinstitute.variant.variantcontext.Allele; import org.broadinstitute.variant.variantcontext.VariantContext; -import org.broadinstitute.variant.variantcontext.VariantContextBuilder; import org.testng.Assert; import org.testng.annotations.DataProvider; import org.testng.annotations.Test; import java.util.*; -public class EventExtractorUnitTest extends BaseTest { +public class EventMapUnitTest extends BaseTest { private final static String CHR = "20"; private final static String NAME = "foo"; @@ -71,9 +69,9 @@ public class EventExtractorUnitTest extends BaseTest { vcs.add(vc); } - tests.add(new Object[]{new EventExtractor(new LinkedList(allVCS)), Collections.emptyList()}); + tests.add(new Object[]{new EventMap(new LinkedList(allVCS)), Collections.emptyList()}); allVCS.addAll(vcs); - tests.add(new Object[]{new EventExtractor(allVCS), vcs}); + tests.add(new Object[]{new EventMap(allVCS), vcs}); } } } @@ -86,12 +84,12 @@ public class EventExtractorUnitTest extends BaseTest { /** * Example testng test using MyDataProvider */ - @Test(dataProvider = "MyDataProvider", enabled = true) // TODO == reenable - public void testGetNeighborhood(final EventExtractor eventExtractor, final List expectedNeighbors) { + @Test(dataProvider = "MyDataProvider", enabled = true) + public void testGetNeighborhood(final EventMap eventMap, final List expectedNeighbors) { final VariantContext leftOfNeighors = expectedNeighbors.isEmpty() ? null : expectedNeighbors.get(0); - for ( final VariantContext vc : eventExtractor.getVariantContexts() ) { - final List n = eventExtractor.getNeighborhood(vc, 5); + for ( final VariantContext vc : eventMap.getVariantContexts() ) { + final List n = eventMap.getNeighborhood(vc, 5); if ( leftOfNeighors == vc ) Assert.assertEquals(n, expectedNeighbors); else if ( ! expectedNeighbors.contains(vc) ) @@ -103,7 +101,7 @@ public class EventExtractorUnitTest extends BaseTest { public Object[][] makeBlockSubstitutionsData() { List tests = new ArrayList(); - for ( int size = EventExtractor.MIN_NUMBER_OF_EVENTS_TO_COMBINE_INTO_BLOCK_SUBSTITUTION; size < 10; size++ ) { + for ( int size = EventMap.MIN_NUMBER_OF_EVENTS_TO_COMBINE_INTO_BLOCK_SUBSTITUTION; size < 10; size++ ) { final String ref = Utils.dupString("A", size); final String alt = Utils.dupString("C", size); tests.add(new Object[]{ref, alt, size + "M", GATKVariantContextUtils.makeFromAlleles(NAME, CHR, 1, Arrays.asList(ref, alt))}); @@ -131,7 +129,8 @@ public class EventExtractorUnitTest extends BaseTest { public void testBlockSubstitutionsData(final String refBases, final String haplotypeBases, final String cigar, final VariantContext expectedBlock) { final Haplotype hap = new Haplotype(haplotypeBases.getBytes(), false, 0, TextCigarCodec.getSingleton().decode(cigar)); final GenomeLoc loc = new UnvalidatingGenomeLoc(CHR, 0, 1, refBases.length()); - final EventExtractor ee = new EventExtractor(hap, refBases.getBytes(), loc, NAME); + final EventMap ee = new EventMap(hap, refBases.getBytes(), loc, NAME); + ee.replaceClumpedEventsWithBlockSubstititions(); Assert.assertEquals(ee.getNumberOfEvents(), 1); final VariantContext actual = ee.getVariantContexts().iterator().next(); Assert.assertTrue(GATKVariantContextUtils.equalSites(actual, expectedBlock), "Failed with " + actual); @@ -142,11 +141,11 @@ public class EventExtractorUnitTest extends BaseTest { List tests = new ArrayList(); tests.add(new Object[]{"TT", "GCT", "1M1I1M", Arrays.asList(Arrays.asList("T", "GC"))}); - tests.add(new Object[]{"GCT", "TT", "1M1D", Arrays.asList(Arrays.asList("GC", "T"))}); + tests.add(new Object[]{"GCT", "TT", "1M1D1M", Arrays.asList(Arrays.asList("GC", "T"))}); tests.add(new Object[]{"TT", "GCCT", "1M2I1M", Arrays.asList(Arrays.asList("T", "GCC"))}); - tests.add(new Object[]{"GCCT", "TT", "1M2D", Arrays.asList(Arrays.asList("GCC", "T"))}); - tests.add(new Object[]{"AAGCCT", "AATT", "3M2D", Arrays.asList(Arrays.asList("GCC", "T"))}); - tests.add(new Object[]{"AAGCCT", "GATT", "3M2D", Arrays.asList(Arrays.asList("A", "G"), Arrays.asList("GCC", "T"))}); + tests.add(new Object[]{"GCCT", "TT", "1M2D1M", Arrays.asList(Arrays.asList("GCC", "T"))}); + tests.add(new Object[]{"AAGCCT", "AATT", "3M2D1M", Arrays.asList(Arrays.asList("GCC", "T"))}); + tests.add(new Object[]{"AAGCCT", "GATT", "3M2D1M", Arrays.asList(Arrays.asList("A", "G"), Arrays.asList("GCC", "T"))}); tests.add(new Object[]{"AAAAA", "AGACA", "5M", Arrays.asList(Arrays.asList("A", "G"), Arrays.asList("A", "C"))}); return tests.toArray(new Object[][]{}); @@ -155,11 +154,12 @@ public class EventExtractorUnitTest extends BaseTest { /** * Example testng test using MyDataProvider */ - @Test(dataProvider = "AdjacentSNPIndelTest", enabled = true) + @Test(dataProvider = "AdjacentSNPIndelTest") public void testAdjacentSNPIndelTest(final String refBases, final String haplotypeBases, final String cigar, final List> expectedAlleles) { final Haplotype hap = new Haplotype(haplotypeBases.getBytes(), false, 0, TextCigarCodec.getSingleton().decode(cigar)); final GenomeLoc loc = new UnvalidatingGenomeLoc(CHR, 0, 1, refBases.length()); - final EventExtractor ee = new EventExtractor(hap, refBases.getBytes(), loc, NAME); + final EventMap ee = new EventMap(hap, refBases.getBytes(), loc, NAME); + ee.replaceClumpedEventsWithBlockSubstititions(); Assert.assertEquals(ee.getNumberOfEvents(), expectedAlleles.size()); final List actuals = new ArrayList(ee.getVariantContexts()); for ( int i = 0; i < ee.getNumberOfEvents(); i++ ) { @@ -168,4 +168,36 @@ public class EventExtractorUnitTest extends BaseTest { Assert.assertEquals(actual.getAlternateAllele(0).getDisplayString(), expectedAlleles.get(i).get(1)); } } + + @DataProvider(name = "MakeBlockData") + public Object[][] makeMakeBlockData() { + List tests = new ArrayList(); + + tests.add(new Object[]{Arrays.asList("A", "G"), Arrays.asList("AGT", "A"), Arrays.asList("AGT", "G")}); + tests.add(new Object[]{Arrays.asList("A", "G"), Arrays.asList("A", "AGT"), Arrays.asList("A", "GGT")}); + + tests.add(new Object[]{Arrays.asList("AC", "A"), Arrays.asList("A", "AGT"), Arrays.asList("AC", "AGT")}); + tests.add(new Object[]{Arrays.asList("ACGTA", "A"), Arrays.asList("A", "AG"), Arrays.asList("ACGTA", "AG")}); + tests.add(new Object[]{Arrays.asList("AC", "A"), Arrays.asList("A", "AGCGT"), Arrays.asList("AC", "AGCGT")}); + tests.add(new Object[]{Arrays.asList("A", "ACGTA"), Arrays.asList("AG", "A"), Arrays.asList("AG", "ACGTA")}); + tests.add(new Object[]{Arrays.asList("A", "AC"), Arrays.asList("AGCGT", "A"), Arrays.asList("AGCGT", "AC")}); + + return tests.toArray(new Object[][]{}); + } + + /** + * Example testng test using MyDataProvider + */ + @Test(dataProvider = "MakeBlockData", enabled = true) + public void testGetNeighborhood(final List firstAlleles, final List secondAlleles, final List expectedAlleles) { + final VariantContext vc1 = GATKVariantContextUtils.makeFromAlleles("x", "20", 10, firstAlleles); + final VariantContext vc2 = GATKVariantContextUtils.makeFromAlleles("x", "20", 10, secondAlleles); + final VariantContext expected = GATKVariantContextUtils.makeFromAlleles("x", "20", 10, expectedAlleles); + + final EventMap eventMap = new EventMap(Collections.emptyList()); + final VariantContext block = eventMap.makeBlock(vc1, vc2); + + Assert.assertEquals(block.getStart(), expected.getStart()); + Assert.assertEquals(block.getAlleles(), expected.getAlleles()); + } }