diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java index dc5fed340..4ea2498c4 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/LikelihoodCalculationEngine.java @@ -106,12 +106,8 @@ public class LikelihoodCalculationEngine { if( haplotypeLength > Y_METRIC_LENGTH ) { Y_METRIC_LENGTH = haplotypeLength; } } - // M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment - X_METRIC_LENGTH += 2; - Y_METRIC_LENGTH += 2; - // initialize arrays to hold the probabilities of being in the match, insertion and deletion cases - pairHMM.initialize(Y_METRIC_LENGTH, X_METRIC_LENGTH); + pairHMM.initialize(X_METRIC_LENGTH, Y_METRIC_LENGTH); // for each sample's reads for( final Map.Entry> sampleEntry : perSampleReadList.entrySet() ) { @@ -134,7 +130,6 @@ public class LikelihoodCalculationEngine { for( final GATKSAMRecord read : reads ) { final byte[] overallGCP = new byte[read.getReadLength()]; Arrays.fill( overallGCP, constantGCP ); // Is there a way to derive empirical estimates for this from the data? - Haplotype previousHaplotypeSeen = null; // NOTE -- must clone anything that gets modified here so we don't screw up future uses of the read final byte[] readQuals = read.getBaseQualities().clone(); final byte[] readInsQuals = read.getBaseInsertionQualities(); @@ -149,14 +144,9 @@ public class LikelihoodCalculationEngine { for( int jjj = 0; jjj < numHaplotypes; jjj++ ) { final Haplotype haplotype = haplotypes.get(jjj); - - final int haplotypeStart = ( previousHaplotypeSeen == null ? 0 : PairHMM.findFirstPositionWhereHaplotypesDiffer(haplotype.getBases(), previousHaplotypeSeen.getBases()) ); - previousHaplotypeSeen = haplotype; - final boolean isFirstHaplotype = jjj == 0; final double log10l = pairHMM.computeReadLikelihoodGivenHaplotypeLog10(haplotype.getBases(), - read.getReadBases(), readQuals, readInsQuals, readDelQuals, - overallGCP, haplotypeStart, isFirstHaplotype); + read.getReadBases(), readQuals, readInsQuals, readDelQuals, overallGCP, isFirstHaplotype); perReadAlleleLikelihoodMap.add(read, alleleVersions.get(haplotype), log10l); } diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/indels/PairHMMIndelErrorModel.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/indels/PairHMMIndelErrorModel.java index e3d3c6640..4c5490395 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/indels/PairHMMIndelErrorModel.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/indels/PairHMMIndelErrorModel.java @@ -349,7 +349,6 @@ public class PairHMMIndelErrorModel { int j=0; - byte[] previousHaplotypeSeen = null; final byte[] contextLogGapOpenProbabilities = new byte[readBases.length]; final byte[] contextLogGapContinuationProbabilities = new byte[readBases.length]; @@ -392,34 +391,25 @@ public class PairHMMIndelErrorModel { final byte[] haplotypeBases = Arrays.copyOfRange(haplotype.getBases(), (int)indStart, (int)indStop); - final int X_METRIC_LENGTH = readBases.length+2; - final int Y_METRIC_LENGTH = haplotypeBases.length+2; - - if (previousHaplotypeSeen == null) { + if (firstHap) { //no need to reallocate arrays for each new haplotype, as length won't change - pairHMM.initialize(Y_METRIC_LENGTH, X_METRIC_LENGTH); + pairHMM.initialize(readBases.length, haplotypeBases.length); + firstHap = false; } - int startIndexInHaplotype = 0; - if (previousHaplotypeSeen != null) - startIndexInHaplotype = computeFirstDifferingPosition(haplotypeBases, previousHaplotypeSeen); - previousHaplotypeSeen = haplotypeBases.clone(); readLikelihood = pairHMM.computeReadLikelihoodGivenHaplotypeLog10(haplotypeBases, readBases, readQuals, - baseInsertionQualities, baseDeletionQualities, - contextLogGapContinuationProbabilities, startIndexInHaplotype, firstHap); + baseInsertionQualities, baseDeletionQualities, contextLogGapContinuationProbabilities, firstHap); if (DEBUG) { System.out.println("H:"+new String(haplotypeBases)); System.out.println("R:"+new String(readBases)); System.out.format("L:%4.2f\n",readLikelihood); - System.out.format("StPos:%d\n", startIndexInHaplotype); } perReadAlleleLikelihoodMap.add(p, a, readLikelihood); readLikelihoods[readIdx][j++] = readLikelihood; - firstHap = false; } } } diff --git a/protected/java/src/org/broadinstitute/sting/utils/pairhmm/LoglessPairHMM.java b/protected/java/src/org/broadinstitute/sting/utils/pairhmm/LoglessPairHMM.java index d94893e3e..b62d7a334 100644 --- a/protected/java/src/org/broadinstitute/sting/utils/pairhmm/LoglessPairHMM.java +++ b/protected/java/src/org/broadinstitute/sting/utils/pairhmm/LoglessPairHMM.java @@ -59,16 +59,20 @@ public final class LoglessPairHMM extends PairHMM { protected static final double SCALE_FACTOR_LOG10 = 300.0; protected static final double INITIAL_CONDITION = Math.pow(10, SCALE_FACTOR_LOG10); - double[][] transition = null; // The cache - double[][] prior = null; // The cache - boolean constantsAreInitialized = false; + private static final int matchToMatch = 0; + private static final int indelToMatch = 1; + private static final int matchToInsertion = 2; + private static final int insertionToInsertion = 3; + private static final int matchToDeletion = 4; + private static final int deletionToDeletion = 5; + /** * {@inheritDoc} */ @Override - public void initialize( final int haplotypeMaxLength, final int readMaxLength) { - super.initialize(haplotypeMaxLength, readMaxLength); + public void initialize(final int readMaxLength, final int haplotypeMaxLength ) { + super.initialize(readMaxLength, haplotypeMaxLength); transition = new double[paddedMaxReadLength][6]; prior = new double[paddedMaxReadLength][paddedMaxHaplotypeLength]; @@ -86,18 +90,22 @@ public final class LoglessPairHMM extends PairHMM { final byte[] overallGCP, final int hapStartIndex, final boolean recacheReadValues ) { + + if (previousHaplotypeBases == null || previousHaplotypeBases.length != haplotypeBases.length) { + final double initialValue = INITIAL_CONDITION / haplotypeBases.length; + // set the initial value (free deletions in the beginning) for the first row in the deletion matrix + for( int j = 0; j < paddedHaplotypeLength; j++ ) { + deletionMatrix[0][j] = initialValue; + } + } + if ( ! constantsAreInitialized || recacheReadValues ) - initializeProbabilities(haplotypeBases.length, insertionGOP, deletionGOP, overallGCP); + initializeProbabilities(insertionGOP, deletionGOP, overallGCP); initializePriors(haplotypeBases, readBases, readQuals, hapStartIndex); - // NOTE NOTE NOTE -- because of caching we need to only operate over X and Y according to this - // read and haplotype lengths, not the max lengths - final int readXMetricLength = readBases.length + 2; - final int hapYMetricLength = haplotypeBases.length + 2; - - for (int i = 2; i < readXMetricLength; i++) { + for (int i = 1; i < paddedReadLength; i++) { // +1 here is because hapStartIndex is 0-based, but our matrices are 1 based - for (int j = hapStartIndex+1; j < hapYMetricLength; j++) { + for (int j = hapStartIndex+1; j < paddedHaplotypeLength; j++) { updateCell(i, j, prior[i][j], transition[i]); } } @@ -105,9 +113,9 @@ public final class LoglessPairHMM extends PairHMM { // final probability is the log10 sum of the last element in the Match and Insertion state arrays // this way we ignore all paths that ended in deletions! (huge) // but we have to sum all the paths ending in the M and I matrices, because they're no longer extended. - final int endI = readXMetricLength - 1; + final int endI = paddedReadLength - 1; double finalSumProbabilities = 0.0; - for (int j = 0; j < hapYMetricLength; j++) { + for (int j = 1; j < paddedHaplotypeLength; j++) { finalSumProbabilities += matchMatrix[endI][j] + insertionMatrix[endI][j]; } return Math.log10(finalSumProbabilities) - SCALE_FACTOR_LOG10; @@ -132,7 +140,7 @@ public final class LoglessPairHMM extends PairHMM { final byte qual = readQuals[i]; for (int j = startIndex; j < haplotypeBases.length; j++) { final byte y = haplotypeBases[j]; - prior[i+2][j+2] = ( x == y || x == (byte) 'N' || y == (byte) 'N' ? + prior[i+1][j+1] = ( x == y || x == (byte) 'N' || y == (byte) 'N' ? QualityUtils.qualToProb(qual) : QualityUtils.qualToErrorProb(qual) ); } } @@ -151,25 +159,15 @@ public final class LoglessPairHMM extends PairHMM { "overallGCP != null" }) @Ensures("constantsAreInitialized") - private void initializeProbabilities(final int haplotypeLength, final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP) { - // the initial condition -- must be here because it needs that actual read and haplotypes, not the maximum in init - final double initialValue = INITIAL_CONDITION / haplotypeLength; - matchMatrix[1][1] = initialValue; - - // fill in the first row - for( int jjj = 2; jjj < paddedMaxHaplotypeLength; jjj++ ) { - deletionMatrix[1][jjj] = initialValue; - } - - final int l = insertionGOP.length; - for (int i = 0; i < l; i++) { + private void initializeProbabilities(final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP) { + for (int i = 0; i < insertionGOP.length; i++) { final int qualIndexGOP = Math.min(insertionGOP[i] + deletionGOP[i], Byte.MAX_VALUE); - transition[i+2][0] = QualityUtils.qualToProb((byte) qualIndexGOP); - transition[i+2][1] = QualityUtils.qualToProb(overallGCP[i]); - transition[i+2][2] = QualityUtils.qualToErrorProb(insertionGOP[i]); - transition[i+2][3] = QualityUtils.qualToErrorProb(overallGCP[i]); - transition[i+2][4] = QualityUtils.qualToErrorProb(deletionGOP[i]); - transition[i+2][5] = QualityUtils.qualToErrorProb(overallGCP[i]); + transition[i+1][matchToMatch] = QualityUtils.qualToProb((byte) qualIndexGOP); + transition[i+1][indelToMatch] = QualityUtils.qualToProb(overallGCP[i]); + transition[i+1][matchToInsertion] = QualityUtils.qualToErrorProb(insertionGOP[i]); + transition[i+1][insertionToInsertion] = QualityUtils.qualToErrorProb(overallGCP[i]); + transition[i+1][matchToDeletion] = QualityUtils.qualToErrorProb(deletionGOP[i]); + transition[i+1][deletionToDeletion] = QualityUtils.qualToErrorProb(overallGCP[i]); } // note that we initialized the constants @@ -185,14 +183,14 @@ public final class LoglessPairHMM extends PairHMM { * @param indI row index in the matrices to update * @param indJ column index in the matrices to update * @param prior the likelihood editing distance matrix for the read x haplotype - * @param transitition an array with the six transitition relevant to this location + * @param transition an array with the six transition relevant to this location */ - private void updateCell( final int indI, final int indJ, final double prior, final double[] transitition) { + private void updateCell( final int indI, final int indJ, final double prior, final double[] transition) { - matchMatrix[indI][indJ] = prior * ( matchMatrix[indI - 1][indJ - 1] * transitition[0] + - insertionMatrix[indI - 1][indJ - 1] * transitition[1] + - deletionMatrix[indI - 1][indJ - 1] * transitition[1] ); - insertionMatrix[indI][indJ] = matchMatrix[indI - 1][indJ] * transitition[2] + insertionMatrix[indI - 1][indJ] * transitition[3]; - deletionMatrix[indI][indJ] = matchMatrix[indI][indJ - 1] * transitition[4] + deletionMatrix[indI][indJ - 1] * transitition[5]; + matchMatrix[indI][indJ] = prior * ( matchMatrix[indI - 1][indJ - 1] * transition[matchToMatch] + + insertionMatrix[indI - 1][indJ - 1] * transition[indelToMatch] + + deletionMatrix[indI - 1][indJ - 1] * transition[indelToMatch] ); + insertionMatrix[indI][indJ] = matchMatrix[indI - 1][indJ] * transition[matchToInsertion] + insertionMatrix[indI - 1][indJ] * transition[insertionToInsertion]; + deletionMatrix[indI][indJ] = matchMatrix[indI][indJ - 1] * transition[matchToDeletion] + deletionMatrix[indI][indJ - 1] * transition[deletionToDeletion]; } } diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite1IntegrationTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite1IntegrationTest.java index 5cdc2c65f..34b19ed2d 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite1IntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite1IntegrationTest.java @@ -79,6 +79,6 @@ public class UnifiedGenotyperGeneralPloidySuite1IntegrationTest extends WalkerTe @Test(enabled = true) public void testINDEL_maxAltAlleles2_ploidy1_Pools_noRef() { - executor.PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 1", "LSV_INDEL_DISC_NOREF_p1", "INDEL", "faadc0b77a91a716dbb1191fd579d025"); + executor.PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 1", "LSV_INDEL_DISC_NOREF_p1", "INDEL", "603416111f34e2a735163fa97e1a8272"); } } diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite2IntegrationTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite2IntegrationTest.java index 4299b024b..8a165cbeb 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite2IntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite2IntegrationTest.java @@ -58,7 +58,7 @@ public class UnifiedGenotyperGeneralPloidySuite2IntegrationTest extends WalkerTe @Test(enabled = true) public void testINDEL_maxAltAlleles2_ploidy3_Pools_noRef() { - executor.PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 3","LSV_INDEL_DISC_NOREF_p3","INDEL","fe715b715526a7c1ebd575ff66bba716"); + executor.PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 3","LSV_INDEL_DISC_NOREF_p3","INDEL","13de8558acaa0b9082f2df477b45de9b"); } @Test(enabled = true) diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIndelCallingIntegrationTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIndelCallingIntegrationTest.java index d0d77c8e0..6b26be0d0 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIndelCallingIntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIndelCallingIntegrationTest.java @@ -72,7 +72,7 @@ public class UnifiedGenotyperIndelCallingIntegrationTest extends WalkerTest { " -o %s" + " -L 1:10,000,000-10,500,000", 1, - Arrays.asList("51e022d07ead45a4e154f949b6642e84")); + Arrays.asList("118ed5b54fc9ce1cde89f06a20afebef")); executeTest(String.format("test indel caller in SLX"), spec); } @@ -87,7 +87,7 @@ public class UnifiedGenotyperIndelCallingIntegrationTest extends WalkerTest { " -minIndelCnt 1" + " -L 1:10,000,000-10,100,000", 1, - Arrays.asList("1d9c6fda344eeee76cbe4221251dc341")); + Arrays.asList("6ef59013331bc031ea37807b325d7d2c")); executeTest(String.format("test indel caller in SLX with low min allele count"), spec); } @@ -100,7 +100,7 @@ public class UnifiedGenotyperIndelCallingIntegrationTest extends WalkerTest { " -o %s" + " -L 1:10,000,000-10,500,000", 1, - Arrays.asList("2ec7262f0a3d04534ce1fe15cc79f52e")); + Arrays.asList("dd3ee4675377191e34aaf67335e0219a")); executeTest(String.format("test indel calling, multiple technologies"), spec); } @@ -110,7 +110,7 @@ public class UnifiedGenotyperIndelCallingIntegrationTest extends WalkerTest { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( baseCommandIndels + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -alleles " + privateTestDir + "indelAllelesForUG.vcf -I " + validationDataLocation + "pilot2_daughters.chr20.10k-11k.bam -o %s -L 20:10,000,000-10,100,000", 1, - Arrays.asList("3131cd7c49b623983a106db5228754b3")); + Arrays.asList("bb06ef8262f91664b7d2fe7e1e5df195")); executeTest("test MultiSample Pilot2 indels with alleles passed in", spec); } @@ -120,7 +120,7 @@ public class UnifiedGenotyperIndelCallingIntegrationTest extends WalkerTest { baseCommandIndels + " --output_mode EMIT_ALL_SITES --genotyping_mode GENOTYPE_GIVEN_ALLELES -alleles " + privateTestDir + "indelAllelesForUG.vcf -I " + validationDataLocation + "pilot2_daughters.chr20.10k-11k.bam -o %s -L 20:10,000,000-10,100,000", 1, - Arrays.asList("273f5daa936e93da98efd6ceb37d7533")); + Arrays.asList("0a2a8cc2d1a79e84624836a31de5491c")); executeTest("test MultiSample Pilot2 indels with alleles passed in and emitting all sites", spec); } @@ -135,7 +135,7 @@ public class UnifiedGenotyperIndelCallingIntegrationTest extends WalkerTest { WalkerTest.WalkerTestSpec spec2 = new WalkerTest.WalkerTestSpec( baseCommandIndels + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -alleles " + result.get(0).getAbsolutePath() + " -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -o %s -L " + result.get(0).getAbsolutePath(), 1, - Arrays.asList("00a003a0908281384e981294434a9f3e")); + Arrays.asList("939f80c6d2dfb592956aed3bdeaf319d")); executeTest("test MultiSample Pilot1 CEU indels using GENOTYPE_GIVEN_ALLELES", spec2); } @@ -175,7 +175,7 @@ public class UnifiedGenotyperIndelCallingIntegrationTest extends WalkerTest { public void testMinIndelFraction0() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( assessMinIndelFraction + " -minIndelFrac 0.0", 1, - Arrays.asList("87521a1bde124c7c5908ed067060fe45")); + Arrays.asList("fc937f92e59dfe07b894411b5dfc166a")); executeTest("test minIndelFraction 0.0", spec); } @@ -183,7 +183,7 @@ public class UnifiedGenotyperIndelCallingIntegrationTest extends WalkerTest { public void testMinIndelFraction25() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( assessMinIndelFraction + " -minIndelFrac 0.25", 1, - Arrays.asList("8a880b8b1662e31e0b5c65733eac6b74")); + Arrays.asList("41ad9e0edca4b9987390ba5c07f39e4a")); executeTest("test minIndelFraction 0.25", spec); } diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java index 15655622e..c89b1dfbf 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java @@ -232,7 +232,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { " -o %s" + " -L 1:10,000,000-10,100,000", 1, - Arrays.asList("3a805f5b823ccac19aaec01a3016100e")); + Arrays.asList("0a4a78da876bfa3d42170249a94357b4")); executeTest(String.format("test multiple technologies"), spec); } @@ -251,7 +251,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { " -L 1:10,000,000-10,100,000" + " -baq CALCULATE_AS_NECESSARY", 1, - Arrays.asList("25aa0259876692dc3c848a37369bac6a")); + Arrays.asList("89182fd4d9532ab4b2a0a84bfb557089")); executeTest(String.format("test calling with BAQ"), spec); } diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperNormalCallingIntegrationTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperNormalCallingIntegrationTest.java index c10b3d6df..a58d3f3a8 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperNormalCallingIntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperNormalCallingIntegrationTest.java @@ -64,7 +64,7 @@ public class UnifiedGenotyperNormalCallingIntegrationTest extends WalkerTest{ public void testMultiSamplePilot1() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( baseCommand + " -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10,022,000-10,025,000", 1, - Arrays.asList("3f8ee598c9b85aa1d2b85746ad46c1af")); + Arrays.asList("52b6086f4597da5b35ab902bea4066fc")); executeTest("test MultiSample Pilot1", spec); } @@ -96,7 +96,7 @@ public class UnifiedGenotyperNormalCallingIntegrationTest extends WalkerTest{ public void testMultipleSNPAlleles() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( "-T UnifiedGenotyper -R " + b37KGReference + " --no_cmdline_in_header -glm BOTH --dbsnp " + b37dbSNP129 + " -I " + privateTestDir + "multiallelic.snps.bam -o %s -L " + privateTestDir + "multiallelic.snps.intervals", 1, - Arrays.asList("31c0f0074b3306b54170056e93b69e11")); + Arrays.asList("28bfbff3da3af43d6a1eff673e5cb0f8")); executeTest("test Multiple SNP alleles", spec); } @@ -112,7 +112,7 @@ public class UnifiedGenotyperNormalCallingIntegrationTest extends WalkerTest{ public void testReverseTrim() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( "-T UnifiedGenotyper -R " + b37KGReference + " --no_cmdline_in_header -glm INDEL -I " + validationDataLocation + "CEUTrio.HiSeq.b37.chr20.10_11mb.bam -o %s -L 20:10289124 -L 20:10090289", 1, - Arrays.asList("753d6358b1634107de76900200116805")); + Arrays.asList("a9edd04374ee9c42970291f39a50c191")); executeTest("test reverse trim", spec); } @@ -120,7 +120,7 @@ public class UnifiedGenotyperNormalCallingIntegrationTest extends WalkerTest{ public void testMismatchedPLs() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( "-T UnifiedGenotyper -R " + b37KGReference + " --no_cmdline_in_header -glm INDEL -I " + privateTestDir + "mismatchedPLs.bam -o %s -L 1:24020341", 1, - Arrays.asList("274eadae8a630a3fda9281d6d6253dea")); + Arrays.asList("6fc32ca9de769060f3c2a3d94f8f2f91")); executeTest("test mismatched PLs", spec); } } diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperReducedReadsIntegrationTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperReducedReadsIntegrationTest.java index b63c591ce..21b7d0f86 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperReducedReadsIntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperReducedReadsIntegrationTest.java @@ -74,7 +74,7 @@ public class UnifiedGenotyperReducedReadsIntegrationTest extends WalkerTest { @Test public void testReducedBamINDELs() { - testReducedCalling("INDEL", "c5939a7f5f85ea2fe994ce912732e180"); + testReducedCalling("INDEL", "38c3d14cb9086f7355788d3db9b8ff16"); } diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest.java index 4204a0634..a891220c5 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest.java @@ -64,7 +64,7 @@ public class HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest extends Wa @Test public void testHaplotypeCallerMultiSampleComplex() { - HCTestComplexVariants(privateTestDir + "AFR.complex.variants.bam", "", "73817d9173b8d9d05dac1f3092871f33"); + HCTestComplexVariants(privateTestDir + "AFR.complex.variants.bam", "", "7b67ac6213b7a6f759057fb9d7148fdc"); } private void HCTestSymbolicVariants(String bam, String args, String md5) { @@ -88,12 +88,12 @@ public class HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest extends Wa @Test public void testHaplotypeCallerMultiSampleGGAComplex() { HCTestComplexGGA(NA12878_CHR20_BAM, "-L 20:119673-119823 -L 20:121408-121538", - "8a110549543412fa682419e9a8f0dd1d"); + "eb41ed6f1d692368a0f67311d139a38a"); } @Test public void testHaplotypeCallerMultiSampleGGAMultiAllelic() { HCTestComplexGGA(NA12878_CHR20_BAM, "-L 20:133041-133161 -L 20:300207-300337", - "5429c234d471434adc09d9e60b87de24"); + "c4c33c962aca12c51def9b8cde35b7d2"); } } diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCallerIntegrationTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCallerIntegrationTest.java index 292bea50d..51c3296ac 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCallerIntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCallerIntegrationTest.java @@ -47,15 +47,12 @@ package org.broadinstitute.sting.gatk.walkers.haplotypecaller; import net.sf.picard.reference.IndexedFastaSequenceFile; -import org.broad.tribble.TribbleIndexedFeatureReader; import org.broadinstitute.sting.WalkerTest; -import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.variant.GATKVCFUtils; import org.broadinstitute.variant.variantcontext.VariantContext; -import org.broadinstitute.variant.vcf.VCFCodec; import org.testng.annotations.Test; import java.io.File; @@ -80,12 +77,12 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { @Test public void testHaplotypeCallerMultiSample() { - HCTest(CEUTRIO_BAM, "", "008958c211a8a439a7213a96f3dd7f6c"); + HCTest(CEUTRIO_BAM, "", "f132843e3c8e065a783cc4fdf9ee5df3"); } @Test public void testHaplotypeCallerSingleSample() { - HCTest(NA12878_BAM, "", "3b60c6133eeadfea028dffea93b88478"); + HCTest(NA12878_BAM, "", "15e0201f5c478310d278d2d03483c152"); } @Test(enabled = false) // can't annotate the rsID's yet @@ -96,7 +93,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { @Test public void testHaplotypeCallerMultiSampleGGA() { HCTest(CEUTRIO_BAM, "--max_alternate_alleles 3 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles " + validationDataLocation + "combined.phase1.chr20.raw.indels.sites.vcf", - "70bd5d0805bf6f51e5f61b377526c979"); + "48d309aed0cdc40cc983eeb5a8d12f53"); } @Test @@ -112,7 +109,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { @Test public void testHaplotypeCallerSingleSampleIndelQualityScores() { - HCTestIndelQualityScores(NA12878_RECALIBRATED_BAM, "", "4141b4c24a136a3fe4c0b0a4c231cdfa"); + HCTestIndelQualityScores(NA12878_RECALIBRATED_BAM, "", "34c7fcfe17a1d835e2dc403df9eb3591"); } private void HCTestNearbySmallIntervals(String bam, String args, String md5) { @@ -149,7 +146,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { @Test public void testHaplotypeCallerNearbySmallIntervals() { - HCTestNearbySmallIntervals(NA12878_BAM, "", "b9d614efdaf38b87b459df421aab93a7"); + HCTestNearbySmallIntervals(NA12878_BAM, "", "eae65d20836d6c6ebca9e25e33566f74"); } // This problem bam came from a user on the forum and it spotted a problem where the ReadClipper @@ -159,14 +156,14 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { @Test public void HCTestProblematicReadsModifiedInActiveRegions() { final String base = String.format("-T HaplotypeCaller -R %s -I %s", REF, privateTestDir + "haplotype-problem-4.bam") + " --no_cmdline_in_header -o %s -minPruning 3 -L 4:49139026-49139965"; - final WalkerTestSpec spec = new WalkerTestSpec(base, Arrays.asList("35a8edeca7518835d67a10de21493eca")); + final WalkerTestSpec spec = new WalkerTestSpec(base, Arrays.asList("a3d74040a4966bf7a04cbd4924970685")); executeTest("HCTestProblematicReadsModifiedInActiveRegions: ", spec); } @Test public void HCTestStructuralIndels() { final String base = String.format("-T HaplotypeCaller -R %s -I %s", REF, privateTestDir + "AFR.structural.indels.bam") + " --no_cmdline_in_header -o %s -minPruning 6 -L 20:8187565-8187800 -L 20:18670537-18670730"; - final WalkerTestSpec spec = new WalkerTestSpec(base, Arrays.asList("c81d7e69dd4116890f06a71b19870300")); + final WalkerTestSpec spec = new WalkerTestSpec(base, Arrays.asList("40da88ed3722c512264b72db37f18720")); executeTest("HCTestStructuralIndels: ", spec); } @@ -188,7 +185,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { public void HCTestReducedBam() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( "-T HaplotypeCaller -R " + b37KGReference + " --no_cmdline_in_header -I " + privateTestDir + "bamExample.ReducedRead.ADAnnotation.bam -o %s -L 1:67,225,396-67,288,518", 1, - Arrays.asList("f0a215faed194dc160f19e26293e85f8")); + Arrays.asList("69b83d578c14ed32d08ce4e7ff8a8a18")); executeTest("HC calling on a ReducedRead BAM", spec); } @@ -196,7 +193,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { public void testReducedBamWithReadsNotFullySpanningDeletion() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( "-T HaplotypeCaller -R " + b37KGReference + " --no_cmdline_in_header -I " + privateTestDir + "reduced.readNotFullySpanningDeletion.bam -o %s -L 1:167871297", 1, - Arrays.asList("bea274584344fa6b4b0f98eee327bad8")); + Arrays.asList("0cae60d86a3f86854699217a30ece3e3")); executeTest("test calling on a ReducedRead BAM where the reads do not fully span a deletion", spec); } } diff --git a/protected/java/test/org/broadinstitute/sting/utils/nanoScheduler/NanoSchedulerIntegrationTest.java b/protected/java/test/org/broadinstitute/sting/utils/nanoScheduler/NanoSchedulerIntegrationTest.java index 96eaa109e..f9a4985b0 100644 --- a/protected/java/test/org/broadinstitute/sting/utils/nanoScheduler/NanoSchedulerIntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/utils/nanoScheduler/NanoSchedulerIntegrationTest.java @@ -67,7 +67,7 @@ public class NanoSchedulerIntegrationTest extends WalkerTest { for ( final int nct : Arrays.asList(1, 2) ) { // tests.add(new Object[]{ "SNP", "a1c7546f32a8919a3f3a70a04b2e8322", nt, nct }); //// tests.add(new Object[]{ "INDEL", "0a6d2be79f4f8a4b0eb788cc4751b31b", nt, nct }); - tests.add(new Object[]{ "BOTH", "9a1202d849653f0480932f450ec507b4", nt, nct }); + tests.add(new Object[]{ "BOTH", "aad3a398273ec795e363268997247bd8", nt, nct }); } return tests.toArray(new Object[][]{}); diff --git a/protected/java/test/org/broadinstitute/sting/utils/pairhmm/PairHMMUnitTest.java b/protected/java/test/org/broadinstitute/sting/utils/pairhmm/PairHMMUnitTest.java index 6dbcd0220..2499183a6 100644 --- a/protected/java/test/org/broadinstitute/sting/utils/pairhmm/PairHMMUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/utils/pairhmm/PairHMMUnitTest.java @@ -142,11 +142,11 @@ public class PairHMMUnitTest extends BaseTest { } public double calcLogL( final PairHMM pairHMM, boolean anchorIndel ) { - pairHMM.initialize(refBasesWithContext.length, readBasesWithContext.length); + pairHMM.initialize(readBasesWithContext.length, refBasesWithContext.length); return pairHMM.computeReadLikelihoodGivenHaplotypeLog10( refBasesWithContext, readBasesWithContext, qualAsBytes(baseQual, false, anchorIndel), qualAsBytes(insQual, true, anchorIndel), qualAsBytes(delQual, true, anchorIndel), - qualAsBytes(gcp, false, anchorIndel), 0, true); + qualAsBytes(gcp, false, anchorIndel), true); } private byte[] asBytes(final String bases, final boolean left, final boolean right) { @@ -268,8 +268,8 @@ public class PairHMMUnitTest extends BaseTest { if ( ALLOW_READS_LONGER_THAN_HAPLOTYPE || cfg.read.length() <= cfg.ref.length() ) { final double exactLogL = cfg.calcLogL( exactHMM, true ); for ( final PairHMM hmm : getHMMs() ) { - double actualLogL = cfg.calcLogL( hmm, true ); - double expectedLogL = cfg.expectedLogL(); + final double actualLogL = cfg.calcLogL( hmm, true ); + final double expectedLogL = cfg.expectedLogL(); // compare to our theoretical expectation with appropriate tolerance Assert.assertEquals(actualLogL, expectedLogL, cfg.toleranceFromTheoretical(), "Failed with hmm " + hmm); @@ -283,10 +283,10 @@ public class PairHMMUnitTest extends BaseTest { @Test(enabled = !DEBUG, dataProvider = "OptimizedLikelihoodTestProvider") public void testOptimizedLikelihoods(BasicLikelihoodTestProvider cfg) { if ( ALLOW_READS_LONGER_THAN_HAPLOTYPE || cfg.read.length() <= cfg.ref.length() ) { - double exactLogL = cfg.calcLogL( exactHMM, false ); + final double exactLogL = cfg.calcLogL( exactHMM, false ); for ( final PairHMM hmm : getHMMs() ) { - double calculatedLogL = cfg.calcLogL( hmm, false ); + final double calculatedLogL = cfg.calcLogL( hmm, false ); // compare to the exact reference implementation with appropriate tolerance Assert.assertEquals(calculatedLogL, exactLogL, cfg.getTolerance(hmm), String.format("Test: logL calc=%.2f expected=%.2f for %s with hmm %s", calculatedLogL, exactLogL, cfg.toString(), hmm)); Assert.assertTrue(MathUtils.goodLog10Probability(calculatedLogL), "Bad log10 likelihood " + calculatedLogL); @@ -296,64 +296,55 @@ public class PairHMMUnitTest extends BaseTest { @Test(enabled = !DEBUG) public void testMismatchInEveryPositionInTheReadWithCenteredHaplotype() { - byte[] haplotype1 = "TTCTCTTCTGTTGTGGCTGGTT".getBytes(); - + final byte[] haplotype1 = "TTCTCTTCTGTTGTGGCTGGTT".getBytes(); + final byte matchQual = 90; + final byte mismatchQual = 20; + final byte indelQual = 80; final int offset = 2; - byte[] gop = new byte[haplotype1.length - 2 * offset]; - Arrays.fill(gop, (byte) 80); - byte[] gcp = new byte[haplotype1.length - 2 * offset]; - Arrays.fill(gcp, (byte) 80); + final byte[] gop = new byte[haplotype1.length - 2 * offset]; + Arrays.fill(gop, indelQual); + final byte[] gcp = new byte[haplotype1.length - 2 * offset]; + Arrays.fill(gcp, indelQual); + loglessHMM.initialize(gop.length, haplotype1.length); for( int k = 0; k < haplotype1.length - 2 * offset; k++ ) { - byte[] quals = new byte[haplotype1.length - 2 * offset]; - Arrays.fill(quals, (byte) 90); - // one read mismatches the haplotype - quals[k] = 20; - - byte[] mread = Arrays.copyOfRange(haplotype1,offset,haplotype1.length-offset); + final byte[] quals = new byte[haplotype1.length - 2 * offset]; + Arrays.fill(quals, matchQual); + // one base mismatches the haplotype + quals[k] = mismatchQual; + final byte[] mread = Arrays.copyOfRange(haplotype1,offset,haplotype1.length-offset); // change single base at position k to C. If it's a C, change to T mread[k] = ( mread[k] == (byte)'C' ? (byte)'T' : (byte)'C'); - originalHMM.initialize(haplotype1.length, mread.length); - double res1 = originalHMM.computeReadLikelihoodGivenHaplotypeLog10( - haplotype1, mread, - quals, gop, gop, - gcp, 0, false); - - System.out.format("H:%s\nR: %s\n Pos:%d Result:%4.2f\n",new String(haplotype1), new String(mread), k,res1); - - final double expected = Math.log10(1.0/haplotype1.length * Math.pow(QualityUtils.qualToProb(90), mread.length-1) * QualityUtils.qualToErrorProb(20)); + final double res1 = loglessHMM.computeReadLikelihoodGivenHaplotypeLog10(haplotype1, mread, quals, gop, gop, gcp, false); + final double expected = Math.log10(1.0/haplotype1.length * Math.pow(QualityUtils.qualToProb(matchQual), mread.length-1) * QualityUtils.qualToErrorProb(mismatchQual)); Assert.assertEquals(res1, expected, 1e-2); } } @Test(enabled = ! DEBUG) public void testMismatchInEveryPositionInTheRead() { - byte[] haplotype1 = "TTCTCTTCTGTTGTGGCTGGTT".getBytes(); + final byte[] haplotype1 = "TTCTCTTCTGTTGTGGCTGGTT".getBytes(); + final byte matchQual = 90; + final byte mismatchQual = 20; + final byte indelQual = 80; final int offset = 2; - byte[] gop = new byte[haplotype1.length - offset]; - Arrays.fill(gop, (byte) 80); - byte[] gcp = new byte[haplotype1.length - offset]; - Arrays.fill(gcp, (byte) 80); + final byte[] gop = new byte[haplotype1.length - offset]; + Arrays.fill(gop, indelQual); + final byte[] gcp = new byte[haplotype1.length - offset]; + Arrays.fill(gcp, indelQual); + loglessHMM.initialize(gop.length, haplotype1.length); for( int k = 0; k < haplotype1.length - offset; k++ ) { - byte[] quals = new byte[haplotype1.length - offset]; - Arrays.fill(quals, (byte) 90); - // one read mismatches the haplotype - quals[k] = 20; - - byte[] mread = Arrays.copyOfRange(haplotype1,offset,haplotype1.length); + final byte[] quals = new byte[haplotype1.length - offset]; + Arrays.fill(quals, matchQual); + // one base mismatches the haplotype with low qual + quals[k] = mismatchQual; + final byte[] mread = Arrays.copyOfRange(haplotype1,offset,haplotype1.length); // change single base at position k to C. If it's a C, change to T mread[k] = ( mread[k] == (byte)'C' ? (byte)'T' : (byte)'C'); - originalHMM.initialize(haplotype1.length, mread.length); - double res1 = originalHMM.computeReadLikelihoodGivenHaplotypeLog10( - haplotype1, mread, - quals, gop, gop, - gcp, 0, false); - - System.out.format("H:%s\nR: %s\n Pos:%d Result:%4.2f\n",new String(haplotype1), new String(mread), k,res1); - - final double expected = Math.log10(1.0/haplotype1.length * Math.pow(QualityUtils.qualToProb(90), mread.length-1) * QualityUtils.qualToErrorProb(20)); + final double res1 = loglessHMM.computeReadLikelihoodGivenHaplotypeLog10(haplotype1, mread, quals, gop, gop, gcp, false); + final double expected = Math.log10(1.0/haplotype1.length * Math.pow(QualityUtils.qualToProb(matchQual), mread.length-1) * QualityUtils.qualToErrorProb(mismatchQual)); Assert.assertEquals(res1, expected, 1e-2); } } @@ -376,35 +367,35 @@ public class PairHMMUnitTest extends BaseTest { @Test(enabled = !DEBUG, dataProvider = "HMMProvider") void testMultipleReadMatchesInHaplotype(final PairHMM hmm, final int readSize, final int refSize) { - byte[] readBases = Utils.dupBytes((byte)'A', readSize); - byte[] refBases = ("CC" + new String(Utils.dupBytes((byte)'A', refSize)) + "GGA").getBytes(); - byte baseQual = 20; - byte insQual = 37; - byte delQual = 37; - byte gcp = 10; - hmm.initialize(refBases.length, readBases.length); - double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, + final byte[] readBases = Utils.dupBytes((byte)'A', readSize); + final byte[] refBases = ("CC" + new String(Utils.dupBytes((byte)'A', refSize)) + "GGA").getBytes(); + final byte baseQual = 20; + final byte insQual = 37; + final byte delQual = 37; + final byte gcp = 10; + hmm.initialize(readBases.length, refBases.length); + final double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, Utils.dupBytes(baseQual, readBases.length), Utils.dupBytes(insQual, readBases.length), Utils.dupBytes(delQual, readBases.length), - Utils.dupBytes(gcp, readBases.length), 0, true); + Utils.dupBytes(gcp, readBases.length), true); Assert.assertTrue(d <= 0.0, "Likelihoods should be <= 0 but got "+ d); } @Test(enabled = !DEBUG, dataProvider = "HMMProvider") void testAllMatchingRead(final PairHMM hmm, final int readSize, final int refSize) { - byte[] readBases = Utils.dupBytes((byte)'A', readSize); - byte[] refBases = Utils.dupBytes((byte)'A', refSize); - byte baseQual = 20; - byte insQual = 100; - byte delQual = 100; - byte gcp = 100; - hmm.initialize(refBases.length, readBases.length); + final byte[] readBases = Utils.dupBytes((byte)'A', readSize); + final byte[] refBases = Utils.dupBytes((byte)'A', refSize); + final byte baseQual = 20; + final byte insQual = 100; + final byte delQual = 100; + final byte gcp = 100; + hmm.initialize(readBases.length, refBases.length); double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, Utils.dupBytes(baseQual, readBases.length), Utils.dupBytes(insQual, readBases.length), Utils.dupBytes(delQual, readBases.length), - Utils.dupBytes(gcp, readBases.length), 0, true); + Utils.dupBytes(gcp, readBases.length), true); double expected = 0; final double initialCondition = ((double) Math.abs(refBases.length-readBases.length+1))/refBases.length; if (readBases.length < refBases.length) { @@ -439,45 +430,42 @@ public class PairHMMUnitTest extends BaseTest { @Test(enabled = !DEBUG, dataProvider = "HMMProviderWithBigReads") void testReallyBigReads(final PairHMM hmm, final String read, final String ref) { - byte[] readBases = read.getBytes(); - byte[] refBases = ref.getBytes(); - byte baseQual = 30; - byte insQual = 40; - byte delQual = 40; - byte gcp = 10; - hmm.initialize(refBases.length, readBases.length); - double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, + final byte[] readBases = read.getBytes(); + final byte[] refBases = ref.getBytes(); + final byte baseQual = 30; + final byte insQual = 40; + final byte delQual = 40; + final byte gcp = 10; + hmm.initialize(readBases.length, refBases.length); + hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, Utils.dupBytes(baseQual, readBases.length), Utils.dupBytes(insQual, readBases.length), Utils.dupBytes(delQual, readBases.length), - Utils.dupBytes(gcp, readBases.length), 0, true); - Assert.assertTrue(MathUtils.goodLog10Probability(d), "Likelihoods = " + d +" was bad for a read with " + read.length() + " bases and ref with " + ref.length() + " bases"); + Utils.dupBytes(gcp, readBases.length), true); } @Test(enabled = !DEBUG) void testPreviousBadValue() { - byte[] readBases = "A".getBytes(); - byte[] refBases = "AT".getBytes(); - byte baseQual = 30; - byte insQual = 40; - byte delQual = 40; - byte gcp = 10; + final byte[] readBases = "A".getBytes(); + final byte[] refBases = "AT".getBytes(); + final byte baseQual = 30; + final byte insQual = 40; + final byte delQual = 40; + final byte gcp = 10; - exactHMM.initialize(refBases.length, readBases.length); - double d = exactHMM.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, + exactHMM.initialize(readBases.length, refBases.length); + exactHMM.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, Utils.dupBytes(baseQual, readBases.length), Utils.dupBytes(insQual, readBases.length), Utils.dupBytes(delQual, readBases.length), - Utils.dupBytes(gcp, readBases.length), 0, true); - //exactHMM.dumpMatrices(); + Utils.dupBytes(gcp, readBases.length), true); - loglessHMM.initialize(refBases.length, readBases.length); - double logless = loglessHMM.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, + loglessHMM.initialize(readBases.length, refBases.length); + loglessHMM.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, Utils.dupBytes(baseQual, readBases.length), Utils.dupBytes(insQual, readBases.length), Utils.dupBytes(delQual, readBases.length), - Utils.dupBytes(gcp, readBases.length), 0, true); -// loglessHMM.dumpMatrices(); + Utils.dupBytes(gcp, readBases.length), true); } @DataProvider(name = "JustHMMProvider") @@ -493,25 +481,16 @@ public class PairHMMUnitTest extends BaseTest { @Test(enabled = !DEBUG, dataProvider = "JustHMMProvider") void testMaxLengthsBiggerThanProvidedRead(final PairHMM hmm) { + final byte[] readBases = "CTATCTTAGTAAGCCCCCATACCTGCAAATTTCAGGATGTCTCCTCCAAAAATCAACA".getBytes(); + final byte[] refBases = "CTATCTTAGTAAGCCCCCATACCTGCAAATTTCAGGATGTCTCCTCCAAAAATCAAAACTTCTGAGAAAAAAAAAAAAAATTAAATCAAACCCTGATTCCTTAAAGGTAGTAAAAAAACATCATTCTTTCTTAGTGGAATAGAAACTAGGTCAAAAGAACAGTGATTC".getBytes(); + + final byte[] quals = new byte[]{35,34,31,32,35,34,32,31,36,30,31,32,36,34,33,32,32,32,33,32,30,35,33,35,36,36,33,33,33,32,32,32,37,33,36,35,33,32,34,31,36,35,35,35,35,33,34,31,31,30,28,27,26,29,26,25,29,29}; + final byte[] insQual = new byte[]{46,46,46,46,46,47,45,46,45,48,47,44,45,48,46,43,43,42,48,48,45,47,47,48,48,47,48,45,38,47,45,39,47,48,47,47,48,46,49,48,49,48,46,47,48,44,44,43,39,32,34,36,46,48,46,44,45,45}; + final byte[] delQual = new byte[]{44,44,44,43,45,44,43,42,45,46,45,43,44,47,45,40,40,40,45,46,43,45,45,44,46,46,46,43,35,44,43,36,44,45,46,46,44,44,47,43,47,45,45,45,46,45,45,46,44,35,35,35,45,47,45,44,44,43}; + final byte[] gcp = Utils.dupBytes((byte) 10, delQual.length); + hmm.initialize(readBases.length + 100, refBases.length + 100); for ( int nExtraMaxSize = 0; nExtraMaxSize < 100; nExtraMaxSize++ ) { - byte[] readBases = "CTATCTTAGTAAGCCCCCATACCTGCAAATTTCAGGATGTCTCCTCCAAAAATCAACA".getBytes(); - byte[] refBases = "CTATCTTAGTAAGCCCCCATACCTGCAAATTTCAGGATGTCTCCTCCAAAAATCAAAACTTCTGAGAAAAAAAAAAAAAATTAAATCAAACCCTGATTCCTTAAAGGTAGTAAAAAAACATCATTCTTTCTTAGTGGAATAGAAACTAGGTCAAAAGAACAGTGATTC".getBytes(); - byte gcp = 10; - - byte[] quals = new byte[]{35,34,31,32,35,34,32,31,36,30,31,32,36,34,33,32,32,32,33,32,30,35,33,35,36,36,33,33,33,32,32,32,37,33,36,35,33,32,34,31,36,35,35,35,35,33,34,31,31,30,28,27,26,29,26,25,29,29}; - byte[] insQual = new byte[]{46,46,46,46,46,47,45,46,45,48,47,44,45,48,46,43,43,42,48,48,45,47,47,48,48,47,48,45,38,47,45,39,47,48,47,47,48,46,49,48,49,48,46,47,48,44,44,43,39,32,34,36,46,48,46,44,45,45}; - byte[] delQual = new byte[]{44,44,44,43,45,44,43,42,45,46,45,43,44,47,45,40,40,40,45,46,43,45,45,44,46,46,46,43,35,44,43,36,44,45,46,46,44,44,47,43,47,45,45,45,46,45,45,46,44,35,35,35,45,47,45,44,44,43}; - - final int maxHaplotypeLength = refBases.length + nExtraMaxSize; - final int maxReadLength = readBases.length + nExtraMaxSize; - - hmm.initialize(maxHaplotypeLength, maxReadLength); - double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, - quals, - insQual, - delQual, - Utils.dupBytes(gcp, readBases.length), 0, true); - Assert.assertTrue(MathUtils.goodLog10Probability(d), "Likelihoods = " + d +" was bad for a read with " + readBases.length + " bases and ref with " + refBases.length + " bases"); + hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, quals, insQual, delQual, gcp, true); } } @@ -551,7 +530,7 @@ public class PairHMMUnitTest extends BaseTest { final int maxHaplotypeLength = prefix.length() + root1.length(); // the initialization occurs once, at the start of the evalution of reads - hmm.initialize(maxHaplotypeLength, maxReadLength); + hmm.initialize(maxReadLength, maxHaplotypeLength); for ( int prefixStart = prefix.length(); prefixStart >= 0; prefixStart-- ) { final String myPrefix = prefix.substring(prefixStart, prefix.length()); @@ -574,9 +553,7 @@ public class PairHMMUnitTest extends BaseTest { final byte[] insQuals = Utils.dupBytes((byte)45, readBases.length); final byte[] delQuals = Utils.dupBytes((byte)40, readBases.length); final byte[] gcp = Utils.dupBytes((byte)10, readBases.length); - double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( - hap.getBytes(), readBases, baseQuals, insQuals, delQuals, gcp, - hapStart, recache); + double d = hmm.computeReadLikelihoodGivenHaplotypeLog10(hap.getBytes(), readBases, baseQuals, insQuals, delQuals, gcp, recache); Assert.assertTrue(MathUtils.goodLog10Probability(d), "Likelihoods = " + d + " was bad for read " + read + " and ref " + hap + " with hapStart " + hapStart); return d; } @@ -629,7 +606,7 @@ public class PairHMMUnitTest extends BaseTest { // didn't call initialize => should exception out double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, - baseQuals, baseQuals, baseQuals, baseQuals, 0, true); + baseQuals, baseQuals, baseQuals, baseQuals, true); } @Test(enabled = true, expectedExceptions = IllegalArgumentException.class, dataProvider = "JustHMMProvider") @@ -640,7 +617,7 @@ public class PairHMMUnitTest extends BaseTest { hmm.initialize(3, 3); double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, - baseQuals, baseQuals, baseQuals, baseQuals, 0, true); + baseQuals, baseQuals, baseQuals, baseQuals, true); } @Test(enabled = true, expectedExceptions = IllegalArgumentException.class, dataProvider = "JustHMMProvider") @@ -649,8 +626,8 @@ public class PairHMMUnitTest extends BaseTest { byte[] refBases = "AAAT".getBytes(); byte[] baseQuals = Utils.dupBytes((byte)30, readBases.length); - hmm.initialize(3, 2); + hmm.initialize(2, 3); double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases, - baseQuals, baseQuals, baseQuals, baseQuals, 0, true); + baseQuals, baseQuals, baseQuals, baseQuals, true); } } \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/utils/pairhmm/Log10PairHMM.java b/public/java/src/org/broadinstitute/sting/utils/pairhmm/Log10PairHMM.java index d7c55e37c..ab6c321e8 100644 --- a/public/java/src/org/broadinstitute/sting/utils/pairhmm/Log10PairHMM.java +++ b/public/java/src/org/broadinstitute/sting/utils/pairhmm/Log10PairHMM.java @@ -25,6 +25,7 @@ package org.broadinstitute.sting.utils.pairhmm; +import com.google.java.contract.Ensures; import com.google.java.contract.Requires; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.QualityUtils; @@ -34,15 +35,22 @@ import java.util.Arrays; /** * Util class for performing the pair HMM for local alignment. Figure 4.3 in Durbin 1998 book. * - * User: rpoplin + * User: rpoplin, carneiro * Date: 3/1/12 */ -public class Log10PairHMM extends PairHMM { +public final class Log10PairHMM extends PairHMM { /** * Should we use exact log10 calculation (true), or an approximation (false)? */ private final boolean doExactLog10; + private static final int matchToMatch = 0; + private static final int indelToMatch = 1; + private static final int matchToInsertion = 2; + private static final int insertionToInsertion = 3; + private static final int matchToDeletion = 4; + private static final int deletionToDeletion = 5; + /** * Create an uninitialized PairHMM * @@ -64,14 +72,17 @@ public class Log10PairHMM extends PairHMM { * {@inheritDoc} */ @Override - public void initialize( final int haplotypeMaxLength, final int readMaxLength) { - super.initialize(haplotypeMaxLength, readMaxLength); + public void initialize(final int readMaxLength, final int haplotypeMaxLength ) { + super.initialize(readMaxLength, haplotypeMaxLength); for( int iii=0; iii < paddedMaxReadLength; iii++ ) { Arrays.fill(matchMatrix[iii], Double.NEGATIVE_INFINITY); Arrays.fill(insertionMatrix[iii], Double.NEGATIVE_INFINITY); Arrays.fill(deletionMatrix[iii], Double.NEGATIVE_INFINITY); } + + transition = new double[paddedMaxReadLength][6]; + prior = new double[paddedMaxReadLength][paddedMaxHaplotypeLength]; } /** @@ -86,38 +97,91 @@ public class Log10PairHMM extends PairHMM { final byte[] overallGCP, final int hapStartIndex, final boolean recacheReadValues ) { - // the initial condition -- must be in subComputeReadLikelihoodGivenHaplotypeLog10 because it needs that actual - // read and haplotypes, not the maximum - final double initialValue = Math.log10((double) 1/haplotypeBases.length); - matchMatrix[1][1] = initialValue; - // M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment - final int X_METRIC_LENGTH = readBases.length + 2; - final int Y_METRIC_LENGTH = haplotypeBases.length + 2; - - // ensure that all the qual scores have valid values - for( int iii = 0; iii < readQuals.length; iii++ ) { - readQuals[iii] = ( readQuals[iii] < QualityUtils.MIN_USABLE_Q_SCORE ? QualityUtils.MIN_USABLE_Q_SCORE : (readQuals[iii] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : readQuals[iii]) ); - } - - // simple rectangular version of update loop, slow - for( int iii = 1; iii < X_METRIC_LENGTH; iii++ ) { - for( int jjj = hapStartIndex + 1; jjj < Y_METRIC_LENGTH; jjj++ ) { - if( (iii == 1 && jjj == 1) ) { continue; } - updateCell(iii, jjj, haplotypeBases, readBases, readQuals, insertionGOP, deletionGOP, overallGCP, - matchMatrix, insertionMatrix, deletionMatrix); + if (previousHaplotypeBases == null || previousHaplotypeBases.length != haplotypeBases.length) { + // set the initial value (free deletions in the beginning) for the first row in the deletion matrix + final double initialValue = Math.log10(1.0 / haplotypeBases.length); + for( int j = 0; j < paddedHaplotypeLength; j++ ) { + deletionMatrix[0][j] = initialValue; } } - // final probability is the log10 sum of the last element in all three state arrays - final int endI = X_METRIC_LENGTH - 1; - double result = myLog10SumLog10(new double[]{matchMatrix[endI][1], insertionMatrix[endI][1]}); - for (int j = 2; j < Y_METRIC_LENGTH; j++) - result = myLog10SumLog10(new double[]{result, matchMatrix[endI][j], insertionMatrix[endI][j]}); + if ( ! constantsAreInitialized || recacheReadValues ) + initializeProbabilities(insertionGOP, deletionGOP, overallGCP); + initializePriors(haplotypeBases, readBases, readQuals, hapStartIndex); - return result; + for (int i = 1; i < paddedReadLength; i++) { + // +1 here is because hapStartIndex is 0-based, but our matrices are 1 based + for (int j = hapStartIndex+1; j < paddedHaplotypeLength; j++) { + updateCell(i, j, prior[i][j], transition[i]); + } + } + + // final probability is the log10 sum of the last element in the Match and Insertion state arrays + // this way we ignore all paths that ended in deletions! (huge) + // but we have to sum all the paths ending in the M and I matrices, because they're no longer extended. + final int endI = paddedReadLength - 1; + double finalSumProbabilities = myLog10SumLog10(new double[]{matchMatrix[endI][1], insertionMatrix[endI][1]}); + for (int j = 2; j < paddedHaplotypeLength; j++) + finalSumProbabilities = myLog10SumLog10(new double[]{finalSumProbabilities, matchMatrix[endI][j], insertionMatrix[endI][j]}); + + return finalSumProbabilities; } + /** + * Initializes the matrix that holds all the constants related to the editing + * distance between the read and the haplotype. + * + * @param haplotypeBases the bases of the haplotype + * @param readBases the bases of the read + * @param readQuals the base quality scores of the read + * @param startIndex where to start updating the distanceMatrix (in case this read is similar to the previous read) + */ + public void initializePriors(final byte[] haplotypeBases, final byte[] readBases, final byte[] readQuals, final int startIndex) { + + // initialize the pBaseReadLog10 matrix for all combinations of read x haplotype bases + // Abusing the fact that java initializes arrays with 0.0, so no need to fill in rows and columns below 2. + + for (int i = 0; i < readBases.length; i++) { + final byte x = readBases[i]; + final byte qual = readQuals[i]; + for (int j = startIndex; j < haplotypeBases.length; j++) { + final byte y = haplotypeBases[j]; + prior[i+1][j+1] = ( x == y || x == (byte) 'N' || y == (byte) 'N' ? + QualityUtils.qualToProbLog10(qual) : QualityUtils.qualToErrorProbLog10(qual) ); + } + } + } + + /** + * Initializes the matrix that holds all the constants related to quality scores. + * + * @param insertionGOP insertion quality scores of the read + * @param deletionGOP deletion quality scores of the read + * @param overallGCP overall gap continuation penalty + */ + @Requires({ + "insertionGOP != null", + "deletionGOP != null", + "overallGCP != null" + }) + @Ensures("constantsAreInitialized") + private void initializeProbabilities(final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP) { + for (int i = 0; i < insertionGOP.length; i++) { + final int qualIndexGOP = Math.min(insertionGOP[i] + deletionGOP[i], Byte.MAX_VALUE); + transition[i+1][matchToMatch] = QualityUtils.qualToProbLog10((byte) qualIndexGOP); + transition[i+1][indelToMatch] = QualityUtils.qualToProbLog10(overallGCP[i]); + transition[i+1][matchToInsertion] = QualityUtils.qualToErrorProbLog10(insertionGOP[i]); + transition[i+1][insertionToInsertion] = QualityUtils.qualToErrorProbLog10(overallGCP[i]); + transition[i+1][matchToDeletion] = QualityUtils.qualToErrorProbLog10(deletionGOP[i]); + transition[i+1][deletionToDeletion] = QualityUtils.qualToErrorProbLog10(overallGCP[i]); + } + + // note that we initialized the constants + constantsAreInitialized = true; + } + + /** * Compute the log10SumLog10 of the values * @@ -136,37 +200,24 @@ public class Log10PairHMM extends PairHMM { return doExactLog10 ? MathUtils.log10sumLog10(values) : MathUtils.approximateLog10SumLog10(values); } - private void updateCell( final int indI, final int indJ, final byte[] haplotypeBases, final byte[] readBases, - final byte[] readQuals, final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP, - final double[][] matchMatrix, final double[][] insertionMatrix, final double[][] deletionMatrix ) { + /** + * Updates a cell in the HMM matrix + * + * The read and haplotype indices are offset by one because the state arrays have an extra column to hold the + * initial conditions - // the read and haplotype indices are offset by one because the state arrays have an extra column to hold the initial conditions - final int im1 = indI - 1; - final int jm1 = indJ - 1; + * @param indI row index in the matrices to update + * @param indJ column index in the matrices to update + * @param prior the likelihood editing distance matrix for the read x haplotype + * @param transition an array with the six transition relevant to this location + */ + private void updateCell( final int indI, final int indJ, final double prior, final double[] transition) { - // update the match array - double pBaseReadLog10 = 0.0; // Math.log10(1.0); - if( im1 > 0 && jm1 > 0 ) { // the emission probability is applied when leaving the state - final byte x = readBases[im1-1]; - final byte y = haplotypeBases[jm1-1]; - final byte qual = readQuals[im1-1]; - pBaseReadLog10 = ( x == y || x == (byte) 'N' || y == (byte) 'N' ? QualityUtils.qualToProbLog10(qual) : QualityUtils.qualToErrorProbLog10(qual) ); - } - final int qualIndexGOP = ( im1 == 0 ? DEFAULT_GOP + DEFAULT_GOP : ( insertionGOP[im1-1] + deletionGOP[im1-1] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : insertionGOP[im1-1] + deletionGOP[im1-1]) ); - final double d0 = QualityUtils.qualToProbLog10((byte)qualIndexGOP); - final double e0 = ( im1 == 0 ? QualityUtils.qualToProbLog10(DEFAULT_GCP) : QualityUtils.qualToProbLog10(overallGCP[im1-1]) ); - matchMatrix[indI][indJ] = pBaseReadLog10 + myLog10SumLog10(new double[]{matchMatrix[indI - 1][indJ - 1] + d0, insertionMatrix[indI - 1][indJ - 1] + e0, deletionMatrix[indI - 1][indJ - 1] + e0}); - - // update the X (insertion) array - final double d1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GOP) : QualityUtils.qualToErrorProbLog10(insertionGOP[im1-1]) ); - final double e1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GCP) : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]) ); - final double qBaseReadLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0 - insertionMatrix[indI][indJ] = qBaseReadLog10 + myLog10SumLog10(new double[]{matchMatrix[indI - 1][indJ] + d1, insertionMatrix[indI - 1][indJ] + e1}); - - // update the Y (deletion) array, with penalty of zero on the left and right flanks to allow for a local alignment within the haplotype - final double d2 = ( im1 == 0 ) ? 0.0 : QualityUtils.qualToErrorProbLog10(deletionGOP[im1-1]); - final double e2 = ( im1 == 0 ) ? 0.0 : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]); - final double qBaseRefLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0 - deletionMatrix[indI][indJ] = qBaseRefLog10 + myLog10SumLog10(new double[]{matchMatrix[indI][indJ - 1] + d2, deletionMatrix[indI][indJ - 1] + e2}); + matchMatrix[indI][indJ] = prior + + myLog10SumLog10(new double[]{matchMatrix[indI - 1][indJ - 1] + transition[matchToMatch], + insertionMatrix[indI - 1][indJ - 1] + transition[indelToMatch], + deletionMatrix[indI - 1][indJ - 1] + transition[indelToMatch]}); + insertionMatrix[indI][indJ] = myLog10SumLog10(new double[] {matchMatrix[indI - 1][indJ] + transition[matchToInsertion], insertionMatrix[indI - 1][indJ] + transition[insertionToInsertion]}); + deletionMatrix[indI][indJ] = myLog10SumLog10(new double[] {matchMatrix[indI][indJ - 1] + transition[matchToDeletion], deletionMatrix[indI][indJ - 1] + transition[deletionToDeletion]}); } } diff --git a/public/java/src/org/broadinstitute/sting/utils/pairhmm/PairHMM.java b/public/java/src/org/broadinstitute/sting/utils/pairhmm/PairHMM.java index f71819a69..33cd191f6 100644 --- a/public/java/src/org/broadinstitute/sting/utils/pairhmm/PairHMM.java +++ b/public/java/src/org/broadinstitute/sting/utils/pairhmm/PairHMM.java @@ -40,9 +40,11 @@ import java.util.Arrays; public abstract class PairHMM { protected final static Logger logger = Logger.getLogger(PairHMM.class); - protected static final Byte MAX_CACHED_QUAL = Byte.MAX_VALUE; - protected static final byte DEFAULT_GOP = (byte) 45; - protected static final byte DEFAULT_GCP = (byte) 10; + protected double[][] transition = null; // The transition probabilities cache + protected double[][] prior = null; // The prior probabilities cache + protected boolean constantsAreInitialized = false; + + protected byte[] previousHaplotypeBases; public enum HMM_IMPLEMENTATION { /* Very slow implementation which uses very accurate log10 sum functions. Only meant to be used as a reference test implementation */ @@ -58,14 +60,18 @@ public abstract class PairHMM { protected double[][] deletionMatrix = null; protected int maxHaplotypeLength, maxReadLength; protected int paddedMaxReadLength, paddedMaxHaplotypeLength; + protected int paddedReadLength, paddedHaplotypeLength; private boolean initialized = false; /** * Initialize this PairHMM, making it suitable to run against a read and haplotype with given lengths + * + * Note: Do not worry about padding, just provide the true max length of the read and haplotype. The HMM will take care of the padding. + * * @param haplotypeMaxLength the max length of haplotypes we want to use with this PairHMM * @param readMaxLength the max length of reads we want to use with this PairHMM */ - public void initialize( final int haplotypeMaxLength, final int readMaxLength ) { + public void initialize( final int readMaxLength, final int haplotypeMaxLength ) { if ( readMaxLength <= 0 ) throw new IllegalArgumentException("READ_MAX_LENGTH must be > 0 but got " + readMaxLength); if ( haplotypeMaxLength <= 0 ) throw new IllegalArgumentException("HAPLOTYPE_MAX_LENGTH must be > 0 but got " + haplotypeMaxLength); @@ -73,15 +79,21 @@ public abstract class PairHMM { maxReadLength = readMaxLength; // M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment - paddedMaxReadLength = readMaxLength + 2; - paddedMaxHaplotypeLength = haplotypeMaxLength + 2; + paddedMaxReadLength = readMaxLength + 1; + paddedMaxHaplotypeLength = haplotypeMaxLength + 1; matchMatrix = new double[paddedMaxReadLength][paddedMaxHaplotypeLength]; insertionMatrix = new double[paddedMaxReadLength][paddedMaxHaplotypeLength]; deletionMatrix = new double[paddedMaxReadLength][paddedMaxHaplotypeLength]; + + previousHaplotypeBases = null; + + constantsAreInitialized = false; initialized = true; } + + /** * Compute the total probability of read arising from haplotypeBases given base substitution, insertion, and deletion * probabilities. @@ -98,8 +110,6 @@ public abstract class PairHMM { * @param insertionGOP the phred-scaled per base insertion quality scores of read. Must be the same length as readBases * @param deletionGOP the phred-scaled per base deletion quality scores of read. Must be the same length as readBases * @param overallGCP the phred-scaled gap continuation penalties scores of read. Must be the same length as readBases - * @param hapStartIndex start the hmm calculation at this offset in haplotype bases. Used in the caching calculation - * where multiple haplotypes are used, and they only diff starting at hapStartIndex * @param recacheReadValues if false, we don't recalculate any cached results, assuming that readBases and its associated * parameters are the same, and only the haplotype bases are changing underneath us * @return the log10 probability of read coming from the haplotype under the provided error model @@ -110,7 +120,6 @@ public abstract class PairHMM { final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP, - final int hapStartIndex, final boolean recacheReadValues ) { if ( ! initialized ) throw new IllegalStateException("Must call initialize before calling computeReadLikelihoodGivenHaplotypeLog10"); if ( haplotypeBases == null ) throw new IllegalArgumentException("haplotypeBases cannot be null"); @@ -121,14 +130,22 @@ public abstract class PairHMM { if ( insertionGOP.length != readBases.length ) throw new IllegalArgumentException("Read bases and read insertion quals aren't the same size: " + readBases.length + " vs " + insertionGOP.length); if ( deletionGOP.length != readBases.length ) throw new IllegalArgumentException("Read bases and read deletion quals aren't the same size: " + readBases.length + " vs " + deletionGOP.length); if ( overallGCP.length != readBases.length ) throw new IllegalArgumentException("Read bases and overall GCP aren't the same size: " + readBases.length + " vs " + overallGCP.length); - if ( hapStartIndex < 0 || hapStartIndex > haplotypeBases.length ) throw new IllegalArgumentException("hapStartIndex is bad, must be between 0 and haplotype length " + haplotypeBases.length + " but got " + hapStartIndex); + + paddedReadLength = readBases.length + 1; + paddedHaplotypeLength = haplotypeBases.length + 1; + + final int hapStartIndex = (previousHaplotypeBases == null || haplotypeBases.length != previousHaplotypeBases.length ) ? 0 : findFirstPositionWhereHaplotypesDiffer(haplotypeBases, previousHaplotypeBases); double result = subComputeReadLikelihoodGivenHaplotypeLog10(haplotypeBases, readBases, readQuals, insertionGOP, deletionGOP, overallGCP, hapStartIndex, recacheReadValues); - if ( MathUtils.goodLog10Probability(result) ) - return result; - else + if ( ! MathUtils.goodLog10Probability(result) ) throw new IllegalStateException("PairHMM Log Probability cannot be greater than 0: " + String.format("haplotype: %s, read: %s, result: %f", Arrays.toString(haplotypeBases), Arrays.toString(readBases), result)); + + // Warning: Careful if using the PairHMM in parallel! (this update has to be taken care of). + // Warning: This assumes no downstream modification of the haplotype bases (saves us from copying the array). It is okay for the haplotype caller and the Unified Genotyper. + previousHaplotypeBases = haplotypeBases; + + return result; } /**