Final version of PairHMMs with correct edge conditions

-- Uses 1/N for N potential start sites as the probability of starting at any one of the potential start sites
-- Add flag that says to use the original edge condition, respected by all subclasses.  This brings the new code back to the original state, but with all of the cleanup I've done
-- Only test configurations where the read length <= haplotype length.  I think this is actually the contract, but we'll talk about this tomorrow
-- Fix egregious bug with the myLog10SumLog10 function doing the exact opposite of the requested arguments, so that doExact really meant don't do exact
-- PairHMM now exposes computeReadLikelihoodGivenHaplotypeLog10 but subclasses must overload subComputeReadLikelihoodGivenHaplotypeLog10.  This protected function does the work, and the public function will do argument and result QC
-- Have to be more tolerant of reference (approximate) HMM.  All unit tests from the original HMM implementations pass now
-- Added locs of docs
-- Generalize unit tests with multiple equivalent matches of read to haplotype
-- Added runtime argument checking for initial and computeReadLikelihoodGivenHaplotypeLog10
-- Functions to dumpMatrices for debugging
-- Fix nasty bug (without original unit tests) in LoglessPairHMM
-- Max read and haplotype lengths only worked in previous code if they were exactly equal to the provided read and haplotype sizes.  Fixed bug.  Added unit test to ensure this doesn't break again.
-- Added dupString(string, n) method to Utils
-- Added TODOs for next commit.  Need to compute number of potential start sites not in initialize but in the calc routine since this number depends not on the max sizes but the actual read sizes
-- Unit tests for the hapStartIndex functionality of PairHMM
-- Moved computeFirstDifferingPosition to PairHMM, and added unit tests
-- Added extensive unit tests for the hapStartIndex functionality of computeReadLikelihoodGivenHaplotypeLog10
-- Still TODOs left in the code that I'll fix up
-- Logless now compute constants, if they haven't been yet initialized, even if you forgot to say so
-- General: the likelihood penalty for potential start sites is now properly computed against the actual read and reference bases, not the maximum.  This involved moving some initialize() code into the computeLikelihoods function.  That's ok because all of the potential log10 functions are actually going to cached versions, so the slowdown is minimal
-- Added some unit tests to ensure that common errors (providing haplotypes too long, reads too long, not initializing the HMM) are captured as errors
This commit is contained in:
Mark DePristo 2013-02-06 22:14:23 -05:00
parent 09595cdeb9
commit e40d83f00e
6 changed files with 576 additions and 138 deletions

View File

@ -147,7 +147,7 @@ public class LikelihoodCalculationEngine {
for( int jjj = 0; jjj < numHaplotypes; jjj++ ) {
final Haplotype haplotype = haplotypes.get(jjj);
final int haplotypeStart = ( previousHaplotypeSeen == null ? 0 : computeFirstDifferingPosition(haplotype.getBases(), previousHaplotypeSeen.getBases()) );
final int haplotypeStart = ( previousHaplotypeSeen == null ? 0 : PairHMM.findFirstPositionWhereHaplotypesDiffer(haplotype.getBases(), previousHaplotypeSeen.getBases()) );
previousHaplotypeSeen = haplotype;
perReadAlleleLikelihoodMap.add(read, alleleVersions.get(haplotype),
@ -158,15 +158,6 @@ public class LikelihoodCalculationEngine {
return perReadAlleleLikelihoodMap;
}
private static int computeFirstDifferingPosition( final byte[] b1, final byte[] b2 ) {
for( int iii = 0; iii < b1.length && iii < b2.length; iii++ ) {
if( b1[iii] != b2[iii] ) {
return iii;
}
}
return Math.min(b1.length, b2.length);
}
@Requires({"alleleOrdering.size() > 0"})
@Ensures({"result.length == result[0].length", "result.length == alleleOrdering.size()"})
public static double[][] computeDiploidHaplotypeLikelihoods( final String sample,

View File

@ -46,22 +46,25 @@
package org.broadinstitute.sting.utils.pairhmm;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
import org.broadinstitute.sting.utils.QualityUtils;
import java.util.Arrays;
/**
* Created with IntelliJ IDEA.
* User: rpoplin, carneiro
* Date: 10/16/12
*/
public class LoglessCachingPairHMM extends PairHMM {
protected static final double SCALE_FACTOR_LOG10 = 300.0;
double[][] constantMatrix = null; // The cache
double[][] distanceMatrix = null; // The cache
boolean constantsAreInitialized = false;
/**
* Cached data structure that describes the first row's edge condition in the HMM
*/
protected static final double [] firstRowConstantMatrix = {
QualityUtils.qualToProb((byte) (DEFAULT_GOP + DEFAULT_GOP)),
QualityUtils.qualToProb(DEFAULT_GCP),
@ -71,53 +74,48 @@ public class LoglessCachingPairHMM extends PairHMM {
1.0
};
/**
* {@inheritDoc}
*/
@Override
public void initialize( final int READ_MAX_LENGTH, final int HAPLOTYPE_MAX_LENGTH ) {
super.initialize(READ_MAX_LENGTH, HAPLOTYPE_MAX_LENGTH);
public void initialize( final int readMaxLength, final int haplotypeMaxLength) {
super.initialize(readMaxLength, haplotypeMaxLength);
constantMatrix = new double[X_METRIC_LENGTH][6];
distanceMatrix = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
// TODO -- this shouldn't be necessary
for( int iii=0; iii < X_METRIC_LENGTH; iii++ ) {
Arrays.fill(matchMetricArray[iii], 0.0);
Arrays.fill(XMetricArray[iii], 0.0);
Arrays.fill(YMetricArray[iii], 0.0);
}
// the initial condition
matchMetricArray[1][1] = Math.pow(10.0, SCALE_FACTOR_LOG10) / nPotentialXStarts; // Math.log10(1.0);
firstRowConstantMatrix[4] = firstRowConstantMatrix[5] = 1.0;
// fill in the first row
for( int jjj = 2; jjj < Y_METRIC_LENGTH; jjj++ ) {
updateCell(1, jjj, 1.0, firstRowConstantMatrix, matchMetricArray, XMetricArray, YMetricArray);
}
constantMatrix = new double[X_METRIC_MAX_LENGTH][6];
distanceMatrix = new double[X_METRIC_MAX_LENGTH][Y_METRIC_MAX_LENGTH];
}
/**
* {@inheritDoc}
*/
@Override
public double computeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues ) {
if ( recacheReadValues )
initializeConstants( insertionGOP, deletionGOP, overallGCP );
public double subComputeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues ) {
if ( ! constantsAreInitialized || recacheReadValues )
initializeConstants( haplotypeBases.length, readBases.length, insertionGOP, deletionGOP, overallGCP );
initializeDistanceMatrix( haplotypeBases, readBases, readQuals, hapStartIndex );
for (int i = 2; i < X_METRIC_LENGTH; i++) {
for (int j = hapStartIndex+1; j < Y_METRIC_LENGTH; j++) {
// NOTE NOTE NOTE -- because of caching we need to only operate over X and Y according to this
// read and haplotype lengths, not the max lengths
final int readXMetricLength = readBases.length + 2;
final int hapYMetricLength = haplotypeBases.length + 2;
for (int i = 2; i < readXMetricLength; i++) {
// +1 here is because hapStartIndex is 0-based, but our matrices are 1 based
for (int j = hapStartIndex+1; j < hapYMetricLength; j++) {
updateCell(i, j, distanceMatrix[i][j], constantMatrix[i], matchMetricArray, XMetricArray, YMetricArray);
}
}
// final probability is the log10 sum of the last element in all three state arrays
final int endI = X_METRIC_LENGTH - 1;
final int endJ = Y_METRIC_LENGTH - 1;
final int endI = readXMetricLength - 1;
final int endJ = hapYMetricLength - 1;
return Math.log10( matchMetricArray[endI][endJ] + XMetricArray[endI][endJ] + YMetricArray[endI][endJ] ) - SCALE_FACTOR_LOG10;
}
@ -152,13 +150,32 @@ public class LoglessCachingPairHMM extends PairHMM {
/**
* Initializes the matrix that holds all the constants related to quality scores.
*
* @param haplotypeSize the number of bases in the haplotype we are testing
* @param readSize the number of bases in the read we are testing
* @param insertionGOP insertion quality scores of the read
* @param deletionGOP deletion quality scores of the read
* @param overallGCP overall gap continuation penalty
*/
public void initializeConstants( final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP ) {
@Requires({
"haplotypeSize > 0",
"readSize > 0",
"insertionGOP != null && insertionGOP.length == readSize",
"deletionGOP != null && deletionGOP.length == readSize",
"overallGCP != null && overallGCP.length == readSize"
})
@Ensures("constantsAreInitialized")
private void initializeConstants( final int haplotypeSize,
final int readSize,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP ) {
// the initial condition -- must be here because it needs that actual read and haplotypes, not the maximum in init
matchMetricArray[1][1] = Math.pow(10.0, SCALE_FACTOR_LOG10) / getNPotentialXStarts(haplotypeSize, readSize);
// fill in the first row
for( int jjj = 2; jjj < Y_METRIC_MAX_LENGTH; jjj++ ) {
updateCell(1, jjj, 1.0, firstRowConstantMatrix, matchMetricArray, XMetricArray, YMetricArray);
}
final int l = insertionGOP.length;
constantMatrix[1] = firstRowConstantMatrix;
@ -173,6 +190,9 @@ public class LoglessCachingPairHMM extends PairHMM {
}
constantMatrix[l+1][4] = 1.0;
constantMatrix[l+1][5] = 1.0;
// note that we initialized the constants
constantsAreInitialized = true;
}
/**

View File

@ -52,6 +52,7 @@ package org.broadinstitute.sting.utils.pairhmm;
import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.QualityUtils;
import org.broadinstitute.sting.utils.Utils;
import org.testng.Assert;
@ -64,16 +65,15 @@ import java.util.List;
import java.util.Random;
public class PairHMMUnitTest extends BaseTest {
private final static boolean ALLOW_READS_LONGER_THAN_HAPLOTYPE = true;
private final static boolean DEBUG = false;
final static boolean EXTENSIVE_TESTING = false; // TODO -- should be true
PairHMM exactHMM = new Log10PairHMM(true); // the log truth implementation
PairHMM originalHMM = new Log10PairHMM(false); // the reference implementation
PairHMM loglessHMM = new LoglessCachingPairHMM();
final static boolean EXTENSIVE_TESTING = true;
final PairHMM exactHMM = new Log10PairHMM(true); // the log truth implementation
final PairHMM originalHMM = new Log10PairHMM(false); // the reference implementation
final PairHMM loglessHMM = new LoglessCachingPairHMM();
private List<PairHMM> getHMMs() {
// TODO -- re-enable loglessHMM tests
return Arrays.asList(exactHMM, originalHMM);
//return Arrays.asList(exactHMM, originalHMM, cachingHMM, loglessHMM);
return Arrays.asList(exactHMM, originalHMM, loglessHMM);
}
// --------------------------------------------------------------------------------
@ -109,8 +109,9 @@ public class PairHMMUnitTest extends BaseTest {
readBasesWithContext = asBytes(read, false, false);
}
public double expectedLogL() {
return (expectedQual / -10.0) + 0.03 ;
public double expectedLogL(final PairHMM hmm) {
return (expectedQual / -10.0) + 0.03 +
hmm.getNPotentialXStartsLikelihoodPenaltyLog10(refBasesWithContext.length, readBasesWithContext.length);
}
public double getTolerance(final PairHMM hmm) {
@ -127,7 +128,7 @@ public class PairHMMUnitTest extends BaseTest {
}
public double toleranceFromReference() {
return 1E-4;
return 1E-3; // has to be very tolerant -- this approximation is quite approximate
}
public double toleranceFromExact() {
@ -239,10 +240,10 @@ public class PairHMMUnitTest extends BaseTest {
for( int iii = 0; iii < readSize; iii++) {
read += (char) BaseUtils.BASES[random.nextInt(4)];
}
new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, -0, gcp);
new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, -0, gcp, true, false);
new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, -0, gcp, false, true);
new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, -0, gcp, true, true);
for ( final boolean leftFlank : Arrays.asList(true, false) )
for ( final boolean rightFlank : Arrays.asList(true, false) )
new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, -0, gcp, leftFlank, rightFlank);
}
}
}
@ -254,26 +255,32 @@ public class PairHMMUnitTest extends BaseTest {
@Test(enabled = !DEBUG, dataProvider = "BasicLikelihoodTestProvider")
public void testBasicLikelihoods(BasicLikelihoodTestProvider cfg) {
final double exactLogL = cfg.calcLogL( exactHMM, true );
for ( final PairHMM hmm : getHMMs() ) {
double actualLogL = cfg.calcLogL( hmm, true );
double expectedLogL = cfg.expectedLogL();
if ( ALLOW_READS_LONGER_THAN_HAPLOTYPE || cfg.read.length() <= cfg.ref.length() ) {
final double exactLogL = cfg.calcLogL( exactHMM, true );
for ( final PairHMM hmm : getHMMs() ) {
double actualLogL = cfg.calcLogL( hmm, true );
double expectedLogL = cfg.expectedLogL(hmm);
// compare to our theoretical expectation with appropriate tolerance
Assert.assertEquals(actualLogL, expectedLogL, cfg.toleranceFromTheoretical(), "Failed with hmm " + hmm);
// compare to the exact reference implementation with appropriate tolerance
Assert.assertEquals(actualLogL, exactLogL, cfg.getTolerance(hmm), "Failed with hmm " + hmm);
// compare to our theoretical expectation with appropriate tolerance
Assert.assertEquals(actualLogL, expectedLogL, cfg.toleranceFromTheoretical(), "Failed with hmm " + hmm);
// compare to the exact reference implementation with appropriate tolerance
Assert.assertEquals(actualLogL, exactLogL, cfg.getTolerance(hmm), "Failed with hmm " + hmm);
Assert.assertTrue(MathUtils.goodLog10Probability(actualLogL), "Bad log10 likelihood " + actualLogL);
}
}
}
@Test(enabled = !DEBUG, dataProvider = "OptimizedLikelihoodTestProvider")
public void testOptimizedLikelihoods(BasicLikelihoodTestProvider cfg) {
double exactLogL = cfg.calcLogL( exactHMM, false );
if ( ALLOW_READS_LONGER_THAN_HAPLOTYPE || cfg.read.length() <= cfg.ref.length() ) {
double exactLogL = cfg.calcLogL( exactHMM, false );
for ( final PairHMM hmm : getHMMs() ) {
double calculatedLogL = cfg.calcLogL( hmm, false );
// compare to the exact reference implementation with appropriate tolerance
Assert.assertEquals(calculatedLogL, exactLogL, cfg.getTolerance(hmm), String.format("Test: logL calc=%.2f expected=%.2f for %s with hmm %s", calculatedLogL, exactLogL, cfg.toString(), hmm));
for ( final PairHMM hmm : getHMMs() ) {
double calculatedLogL = cfg.calcLogL( hmm, false );
// compare to the exact reference implementation with appropriate tolerance
Assert.assertEquals(calculatedLogL, exactLogL, cfg.getTolerance(hmm), String.format("Test: logL calc=%.2f expected=%.2f for %s with hmm %s", calculatedLogL, exactLogL, cfg.toString(), hmm));
Assert.assertTrue(MathUtils.goodLog10Probability(calculatedLogL), "Bad log10 likelihood " + calculatedLogL);
}
}
}
@ -304,7 +311,8 @@ public class PairHMMUnitTest extends BaseTest {
System.out.format("H:%s\nR: %s\n Pos:%d Result:%4.2f\n",new String(haplotype1), new String(mread), k,res1);
Assert.assertEquals(res1, -2.0, 1e-2);
// - log10 is because of number of start positions
Assert.assertEquals(res1, -2.0 - Math.log10(originalHMM.getNPotentialXStarts(haplotype1.length, mread.length)), 1e-2);
}
}
@ -335,7 +343,8 @@ public class PairHMMUnitTest extends BaseTest {
System.out.format("H:%s\nR: %s\n Pos:%d Result:%4.2f\n",new String(haplotype1), new String(mread), k,res1);
Assert.assertEquals(res1, -2.0, 1e-2);
// - log10 is because of number of start positions
Assert.assertEquals(res1, -2.0 - Math.log10(originalHMM.getNPotentialXStarts(haplotype1.length, mread.length)), 1e-2);
}
}
@ -343,19 +352,22 @@ public class PairHMMUnitTest extends BaseTest {
public Object[][] makeHMMProvider() {
List<Object[]> tests = new ArrayList<Object[]>();
// TODO -- reenable
// for ( final PairHMM hmm : getHMMs() )
// tests.add(new Object[]{hmm});
tests.add(new Object[]{loglessHMM});
for ( final int readSize : Arrays.asList(1, 2, 5, 10) ) {
for ( final int refSize : Arrays.asList(1, 2, 5, 10) ) {
if ( refSize > readSize ) {
for ( final PairHMM hmm : getHMMs() )
tests.add(new Object[]{hmm, readSize, refSize});
}
}
}
return tests.toArray(new Object[][]{});
}
// TODO -- generalize provider to include read and ref base sizes
@Test(dataProvider = "HMMProvider")
void testMultipleReadMatchesInHaplotype(final PairHMM hmm) {
byte[] readBases = "AAAAAAAAAAAA".getBytes();
byte[] refBases = "CCAAAAAAAAAAAAAAGGA".getBytes();
@Test(enabled = !DEBUG, dataProvider = "HMMProvider")
void testMultipleReadMatchesInHaplotype(final PairHMM hmm, final int readSize, final int refSize) {
byte[] readBases = Utils.dupBytes((byte)'A', readSize);
byte[] refBases = ("CC" + new String(Utils.dupBytes((byte)'A', refSize)) + "GGA").getBytes();
byte baseQual = 20;
byte insQual = 37;
byte delQual = 37;
@ -369,10 +381,10 @@ public class PairHMMUnitTest extends BaseTest {
Assert.assertTrue(d <= 0.0, "Likelihoods should be <= 0 but got "+ d);
}
@Test(dataProvider = "HMMProvider")
void testAllMatchingRead(final PairHMM hmm) {
byte[] readBases = "AAA".getBytes();
byte[] refBases = "AAAAA".getBytes();
@Test(enabled = !DEBUG, dataProvider = "HMMProvider")
void testAllMatchingRead(final PairHMM hmm, final int readSize, final int refSize) {
byte[] readBases = Utils.dupBytes((byte)'A', readSize);
byte[] refBases = Utils.dupBytes((byte)'A', refSize);
byte baseQual = 20;
byte insQual = 100;
byte delQual = 100;
@ -386,4 +398,243 @@ public class PairHMMUnitTest extends BaseTest {
final double expected = Math.log10(Math.pow(1.0 - QualityUtils.qualToErrorProb(baseQual), readBases.length));
Assert.assertEquals(d, expected, 1e-3, "Likelihoods should sum to just the error prob of the read");
}
@DataProvider(name = "HMMProviderWithBigReads")
public Object[][] makeBigReadHMMProvider() {
List<Object[]> tests = new ArrayList<Object[]>();
final String read1 = "ACCAAGTAGTCACCGT";
final String ref1 = "ACCAAGTAGTCACCGTAACG";
for ( final int nReadCopies : Arrays.asList(1, 2, 10, 20, 50) ) {
for ( final int nRefCopies : Arrays.asList(1, 2, 10, 20, 100) ) {
if ( nRefCopies > nReadCopies ) {
for ( final PairHMM hmm : getHMMs() ) {
final String read = Utils.dupString(read1, nReadCopies);
final String ref = Utils.dupString(ref1, nRefCopies);
tests.add(new Object[]{hmm, read, ref});
}
}
}
}
return tests.toArray(new Object[][]{});
}
@Test(enabled = !DEBUG, dataProvider = "HMMProviderWithBigReads")
void testReallyBigReads(final PairHMM hmm, final String read, final String ref) {
byte[] readBases = read.getBytes();
byte[] refBases = ref.getBytes();
byte baseQual = 30;
byte insQual = 40;
byte delQual = 40;
byte gcp = 10;
hmm.initialize(readBases.length, refBases.length);
double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases,
Utils.dupBytes(baseQual, readBases.length),
Utils.dupBytes(insQual, readBases.length),
Utils.dupBytes(delQual, readBases.length),
Utils.dupBytes(gcp, readBases.length), 0, true);
Assert.assertTrue(MathUtils.goodLog10Probability(d), "Likelihoods = " + d +" was bad for a read with " + read.length() + " bases and ref with " + ref.length() + " bases");
}
@Test(enabled = !DEBUG)
void testPreviousBadValue() {
byte[] readBases = "A".getBytes();
byte[] refBases = "AT".getBytes();
byte baseQual = 30;
byte insQual = 40;
byte delQual = 40;
byte gcp = 10;
exactHMM.initialize(readBases.length, refBases.length);
double d = exactHMM.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases,
Utils.dupBytes(baseQual, readBases.length),
Utils.dupBytes(insQual, readBases.length),
Utils.dupBytes(delQual, readBases.length),
Utils.dupBytes(gcp, readBases.length), 0, true);
//exactHMM.dumpMatrices();
loglessHMM.initialize(readBases.length, refBases.length);
double logless = loglessHMM.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases,
Utils.dupBytes(baseQual, readBases.length),
Utils.dupBytes(insQual, readBases.length),
Utils.dupBytes(delQual, readBases.length),
Utils.dupBytes(gcp, readBases.length), 0, true);
loglessHMM.dumpMatrices();
}
@DataProvider(name = "JustHMMProvider")
public Object[][] makeJustHMMProvider() {
List<Object[]> tests = new ArrayList<Object[]>();
for ( final PairHMM hmm : getHMMs() ) {
tests.add(new Object[]{hmm});
}
return tests.toArray(new Object[][]{});
}
@Test(enabled = !DEBUG, dataProvider = "JustHMMProvider")
void testMaxLengthsBiggerThanProvidedRead(final PairHMM hmm) {
for ( int nExtraMaxSize = 0; nExtraMaxSize < 100; nExtraMaxSize++ ) {
byte[] readBases = "CTATCTTAGTAAGCCCCCATACCTGCAAATTTCAGGATGTCTCCTCCAAAAATCAACA".getBytes();
byte[] refBases = "CTATCTTAGTAAGCCCCCATACCTGCAAATTTCAGGATGTCTCCTCCAAAAATCAAAACTTCTGAGAAAAAAAAAAAAAATTAAATCAAACCCTGATTCCTTAAAGGTAGTAAAAAAACATCATTCTTTCTTAGTGGAATAGAAACTAGGTCAAAAGAACAGTGATTC".getBytes();
byte gcp = 10;
byte[] quals = new byte[]{35,34,31,32,35,34,32,31,36,30,31,32,36,34,33,32,32,32,33,32,30,35,33,35,36,36,33,33,33,32,32,32,37,33,36,35,33,32,34,31,36,35,35,35,35,33,34,31,31,30,28,27,26,29,26,25,29,29};
byte[] insQual = new byte[]{46,46,46,46,46,47,45,46,45,48,47,44,45,48,46,43,43,42,48,48,45,47,47,48,48,47,48,45,38,47,45,39,47,48,47,47,48,46,49,48,49,48,46,47,48,44,44,43,39,32,34,36,46,48,46,44,45,45};
byte[] delQual = new byte[]{44,44,44,43,45,44,43,42,45,46,45,43,44,47,45,40,40,40,45,46,43,45,45,44,46,46,46,43,35,44,43,36,44,45,46,46,44,44,47,43,47,45,45,45,46,45,45,46,44,35,35,35,45,47,45,44,44,43};
final int maxHaplotypeLength = refBases.length + nExtraMaxSize;
final int maxReadLength = readBases.length + nExtraMaxSize;
hmm.initialize(maxReadLength, maxHaplotypeLength);
double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases,
quals,
insQual,
delQual,
Utils.dupBytes(gcp, readBases.length), 0, true);
Assert.assertTrue(MathUtils.goodLog10Probability(d), "Likelihoods = " + d +" was bad for a read with " + readBases.length + " bases and ref with " + refBases.length + " bases");
}
}
@DataProvider(name = "HaplotypeIndexingProvider")
public Object[][] makeHaplotypeIndexingProvider() {
List<Object[]> tests = new ArrayList<Object[]>();
final String root1 = "ACGTGTCAAACCGGGTT";
final String root2 = "ACGTGTCACACTGGGTT"; // differs in two locations
final String read1 = "ACGTGTCACACTGGATT"; // 1 diff from 2, 2 diff from root1
final String read2 = root1; // same as root1
final String read3 = root2; // same as root2
final String read4 = "ACGTGTCACACTGGATTCGAT";
final String read5 = "CCAGTAACGTGTCACACTGGATTCGAT";
// for ( final String read : Arrays.asList(read2) ) {
for ( final String read : Arrays.asList(read1, read2, read3, read4, read5) ) {
for ( final PairHMM hmm : getHMMs() ) {
// int readLength = read.length(); {
for ( int readLength = 10; readLength < read.length(); readLength++ ) {
final String myRead = read.substring(0, readLength);
tests.add(new Object[]{hmm, root1, root2, myRead});
}
}
}
return tests.toArray(new Object[][]{});
}
@Test(enabled = !DEBUG, dataProvider = "HaplotypeIndexingProvider")
void testHaplotypeIndexing(final PairHMM hmm, final String root1, final String root2, final String read) {
final double TOLERANCE = 1e-9;
final String prefix = "AACCGGTTTTTGGGCCCAAACGTACGTACAGTTGGTCAACATCGATCAGGTTCCGGAGTAC";
final int maxReadLength = read.length();
final int maxHaplotypeLength = prefix.length() + root1.length();
// the initialization occurs once, at the start of the evalution of reads
hmm.initialize(maxReadLength, maxHaplotypeLength);
for ( int prefixStart = prefix.length(); prefixStart >= 0; prefixStart-- ) {
final String myPrefix = prefix.substring(prefixStart, prefix.length());
final String hap1 = myPrefix + root1;
final String hap2 = myPrefix + root2;
final int hapStart = PairHMM.findFirstPositionWhereHaplotypesDiffer(hap1.getBytes(), hap2.getBytes());
final double actual1 = testHaplotypeIndexingCalc(hmm, hap1, read, 0, true);
final double actual2 = testHaplotypeIndexingCalc(hmm, hap2, read, hapStart, false);
final double expected2 = testHaplotypeIndexingCalc(hmm, hap2, read, 0, true);
Assert.assertEquals(actual2, expected2, TOLERANCE, "Caching calculation failed for read " + read + " against haplotype with prefix '" + myPrefix
+ "' expected " + expected2 + " but got " + actual2 + " with hapStart of " + hapStart);
}
}
private double testHaplotypeIndexingCalc(final PairHMM hmm, final String hap, final String read, final int hapStart, final boolean recache) {
final byte[] readBases = read.getBytes();
final byte[] baseQuals = Utils.dupBytes((byte)30, readBases.length);
final byte[] insQuals = Utils.dupBytes((byte)45, readBases.length);
final byte[] delQuals = Utils.dupBytes((byte)40, readBases.length);
final byte[] gcp = Utils.dupBytes((byte)10, readBases.length);
double d = hmm.computeReadLikelihoodGivenHaplotypeLog10(
hap.getBytes(), readBases, baseQuals, insQuals, delQuals, gcp,
hapStart, recache);
Assert.assertTrue(MathUtils.goodLog10Probability(d), "Likelihoods = " + d + " was bad for read " + read + " and ref " + hap + " with hapStart " + hapStart);
return d;
}
@Test(enabled = !DEBUG)
public void testFindFirstPositionWhereHaplotypesDiffer() {
for ( int haplotypeSize1 = 10; haplotypeSize1 < 30; haplotypeSize1++ ) {
for ( int haplotypeSize2 = 10; haplotypeSize2 < 50; haplotypeSize2++ ) {
final int maxLength = Math.max(haplotypeSize1, haplotypeSize2);
final int minLength = Math.min(haplotypeSize1, haplotypeSize2);
for ( int differingSite = 0; differingSite < maxLength + 1; differingSite++) {
for ( final boolean oneIsDiff : Arrays.asList(true, false) ) {
final byte[] hap1 = Utils.dupBytes((byte)'A', haplotypeSize1);
final byte[] hap2 = Utils.dupBytes((byte)'A', haplotypeSize2);
final int expected = oneIsDiff
? makeDiff(hap1, differingSite, minLength)
: makeDiff(hap2, differingSite, minLength);
final int actual = PairHMM.findFirstPositionWhereHaplotypesDiffer(hap1, hap2);
Assert.assertEquals(actual, expected, "Bad differing site for " + new String(hap1) + " vs. " + new String(hap2));
}
}
}
}
}
private int makeDiff(final byte[] bytes, final int site, final int minSize) {
if ( site < bytes.length ) {
bytes[site] = 'C';
return Math.min(site, minSize);
} else
return minSize;
}
@DataProvider(name = "UninitializedHMMs")
public Object[][] makeUninitializedHMMs() {
List<Object[]> tests = new ArrayList<Object[]>();
tests.add(new Object[]{new LoglessCachingPairHMM()});
tests.add(new Object[]{new Log10PairHMM(true)});
return tests.toArray(new Object[][]{});
}
@Test(enabled = true, expectedExceptions = IllegalStateException.class, dataProvider = "UninitializedHMMs")
public void testNoInitializeCall(final PairHMM hmm) {
byte[] readBases = "A".getBytes();
byte[] refBases = "AT".getBytes();
byte[] baseQuals = Utils.dupBytes((byte)30, readBases.length);
// didn't call initialize => should exception out
double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases,
baseQuals, baseQuals, baseQuals, baseQuals, 0, true);
}
@Test(enabled = true, expectedExceptions = IllegalArgumentException.class, dataProvider = "JustHMMProvider")
public void testHapTooLong(final PairHMM hmm) {
byte[] readBases = "AAA".getBytes();
byte[] refBases = "AAAT".getBytes();
byte[] baseQuals = Utils.dupBytes((byte)30, readBases.length);
hmm.initialize(3, 3);
double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases,
baseQuals, baseQuals, baseQuals, baseQuals, 0, true);
}
@Test(enabled = true, expectedExceptions = IllegalArgumentException.class, dataProvider = "JustHMMProvider")
public void testReadTooLong(final PairHMM hmm) {
byte[] readBases = "AAA".getBytes();
byte[] refBases = "AAAT".getBytes();
byte[] baseQuals = Utils.dupBytes((byte)30, readBases.length);
hmm.initialize(2, 3);
double d = hmm.computeReadLikelihoodGivenHaplotypeLog10( refBases, readBases,
baseQuals, baseQuals, baseQuals, baseQuals, 0, true);
}
}

View File

@ -308,6 +308,22 @@ public class Utils {
return join(separator, Arrays.asList(objects));
}
/**
* Create a new string thats a n duplicate copies of s
* @param s the string to duplicate
* @param nCopies how many copies?
* @return a string
*/
public static String dupString(final String s, int nCopies) {
if ( s == null || s.equals("") ) throw new IllegalArgumentException("Bad s " + s);
if ( nCopies < 1 ) throw new IllegalArgumentException("nCopies must be >= 1 but got " + nCopies);
final StringBuilder b = new StringBuilder();
for ( int i = 0; i < nCopies; i++ )
b.append(s);
return b.toString();
}
public static String dupString(char c, int nCopies) {
char[] chars = new char[nCopies];
Arrays.fill(chars, c);

View File

@ -25,7 +25,6 @@
package org.broadinstitute.sting.utils.pairhmm;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.QualityUtils;
@ -39,6 +38,9 @@ import java.util.Arrays;
* Date: 3/1/12
*/
public class Log10PairHMM extends PairHMM {
/**
* Should we use exact log10 calculation (true), or an approximation (false)?
*/
private final boolean doExactLog10;
/**
@ -58,29 +60,35 @@ public class Log10PairHMM extends PairHMM {
return doExactLog10;
}
/**
* {@inheritDoc}
*/
@Override
public void initialize( final int READ_MAX_LENGTH, final int HAPLOTYPE_MAX_LENGTH ) {
super.initialize(READ_MAX_LENGTH, HAPLOTYPE_MAX_LENGTH);
public void initialize( final int readMaxLength, final int haplotypeMaxLength) {
super.initialize(readMaxLength, haplotypeMaxLength);
for( int iii=0; iii < X_METRIC_LENGTH; iii++ ) {
for( int iii=0; iii < X_METRIC_MAX_LENGTH; iii++ ) {
Arrays.fill(matchMetricArray[iii], Double.NEGATIVE_INFINITY);
Arrays.fill(XMetricArray[iii], Double.NEGATIVE_INFINITY);
Arrays.fill(YMetricArray[iii], Double.NEGATIVE_INFINITY);
}
// the initial condition
matchMetricArray[1][1] = 0.0; //Math.log10(1.0 / nPotentialXStarts);
}
/**
* {@inheritDoc}
*/
@Override
public double computeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues ) {
public double subComputeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues ) {
// the initial condition -- must be in subComputeReadLikelihoodGivenHaplotypeLog10 because it needs that actual
// read and haplotypes, not the maximum
matchMetricArray[1][1] = getNPotentialXStartsLikelihoodPenaltyLog10(haplotypeBases.length, readBases.length);
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = readBases.length + 2;
@ -106,13 +114,22 @@ public class Log10PairHMM extends PairHMM {
return myLog10SumLog10(new double[]{matchMetricArray[endI][endJ], XMetricArray[endI][endJ], YMetricArray[endI][endJ]});
}
/**
* Compute the log10SumLog10 of the values
*
* NOTE NOTE NOTE
*
* Log10PairHMM depends critically on this function tolerating values that are all -Infinity
* and the sum returning -Infinity. Note good. Needs to be fixed.
*
* NOTE NOTE NOTE
*
* @param values an array of log10 probabilities that need to be summed
* @return the log10 of the sum of the probabilities
*/
@Requires("values != null")
@Ensures("MathUtils.goodLog10Probability(result)")
private double myLog10SumLog10(final double[] values) {
if ( doExactLog10 )
return MathUtils.log10sumLog10(values);
else
return MathUtils.approximateLog10SumLog10(values);
return doExactLog10 ? MathUtils.log10sumLog10(values) : MathUtils.approximateLog10SumLog10(values);
}
private void updateCell( final int indI, final int indJ, final byte[] haplotypeBases, final byte[] readBases,

View File

@ -27,20 +27,25 @@ package org.broadinstitute.sting.utils.pairhmm;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
import org.apache.log4j.Logger;
import org.broadinstitute.sting.utils.MathUtils;
/**
* Created with IntelliJ IDEA.
* Util class for performing the pair HMM for local alignment. Figure 4.3 in Durbin 1998 book.
*
* User: rpoplin
* Date: 10/16/12
*/
public abstract class PairHMM {
protected final static Logger logger = Logger.getLogger(PairHMM.class);
protected static final Byte MAX_CACHED_QUAL = Byte.MAX_VALUE;
protected static final byte DEFAULT_GOP = (byte) 45;
protected static final byte DEFAULT_GCP = (byte) 10;
public enum HMM_IMPLEMENTATION {
/* Very slow implementation which uses very accurate log10 sum functions. Only meant to be used as a reference test implementation */
EXACT, // TODO -- merge with original, using boolean parameter to determine accuracy of HMM
EXACT,
/* PairHMM as implemented for the UnifiedGenotyper. Uses log10 sum functions accurate to only 1E-4 */
ORIGINAL,
/* Optimized version of the PairHMM which caches per-read computations and operations in real space to avoid costly sums of log10'ed likelihoods */
@ -50,34 +55,172 @@ public abstract class PairHMM {
protected double[][] matchMetricArray = null;
protected double[][] XMetricArray = null;
protected double[][] YMetricArray = null;
protected int X_METRIC_LENGTH, Y_METRIC_LENGTH;
protected int nPotentialXStarts = 0;
protected int maxHaplotypeLength, maxReadLength;
protected int X_METRIC_MAX_LENGTH, Y_METRIC_MAX_LENGTH;
private boolean initialized = false;
/**
* Initialize this PairHMM, making it suitable to run against a read and haplotype with given lengths
* @param readMaxLength the max length of reads we want to use with this PairHMM
* @param haplotypeMaxLength the max length of haplotypes we want to use with this PairHMM
*/
public void initialize( final int readMaxLength, final int haplotypeMaxLength ) {
if ( readMaxLength <= 0 ) throw new IllegalArgumentException("READ_MAX_LENGTH must be > 0 but got " + readMaxLength);
if ( haplotypeMaxLength <= 0 ) throw new IllegalArgumentException("HAPLOTYPE_MAX_LENGTH must be > 0 but got " + haplotypeMaxLength);
maxHaplotypeLength = haplotypeMaxLength;
maxReadLength = readMaxLength;
public void initialize( final int READ_MAX_LENGTH, final int HAPLOTYPE_MAX_LENGTH ) {
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
X_METRIC_LENGTH = READ_MAX_LENGTH + 2;
Y_METRIC_LENGTH = HAPLOTYPE_MAX_LENGTH + 2;
X_METRIC_MAX_LENGTH = readMaxLength + 2;
Y_METRIC_MAX_LENGTH = haplotypeMaxLength + 2;
// the number of potential start sites for the read against the haplotype
// for example, a 3 bp read against a 5 bp haplotype could potentially start at 1, 2, 3 = 5 - 3 + 1 = 3
nPotentialXStarts = HAPLOTYPE_MAX_LENGTH - READ_MAX_LENGTH + 1;
// TODO -- add meaningful runtime checks on params
matchMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
XMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
YMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
matchMetricArray = new double[X_METRIC_MAX_LENGTH][Y_METRIC_MAX_LENGTH];
XMetricArray = new double[X_METRIC_MAX_LENGTH][Y_METRIC_MAX_LENGTH];
YMetricArray = new double[X_METRIC_MAX_LENGTH][Y_METRIC_MAX_LENGTH];
initialized = true;
}
/**
* Compute the total probability of read arising from haplotypeBases given base substitution, insertion, and deletion
* probabilities.
*
* Note on using hapStartIndex. This allows you to compute the exact true likelihood of a full haplotypes
* given a read, assuming that the previous calculation read over a full haplotype, recaching the read values,
* starting only at the place where the new haplotype bases and the previous haplotype bases different. This
* index is 0-based, and can be computed with findFirstPositionWhereHaplotypesDiffer given the two haplotypes.
* Note that this assumes that the read and all associated quals values are the same.
*
* @param haplotypeBases the full sequence (in standard SAM encoding) of the haplotype, must be >= than read bases in length
* @param readBases the bases (in standard encoding) of the read, must be <= haplotype bases in length
* @param readQuals the phred-scaled per base substitition quality scores of read. Must be the same length as readBases
* @param insertionGOP the phred-scaled per base insertion quality scores of read. Must be the same length as readBases
* @param deletionGOP the phred-scaled per base deletion quality scores of read. Must be the same length as readBases
* @param overallGCP the phred-scaled gap continuation penalties scores of read. Must be the same length as readBases
* @param hapStartIndex start the hmm calculation at this offset in haplotype bases. Used in the caching calculation
* where multiple haplotypes are used, and they only diff starting at hapStartIndex
* @param recacheReadValues if false, we don't recalculate any cached results, assuming that readBases and its associated
* parameters are the same, and only the haplotype bases are changing underneath us
* @return the log10 probability of read coming from the haplotype under the provided error model
*/
public final double computeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues ) {
if ( ! initialized ) throw new IllegalStateException("Must call initialize before calling computeReadLikelihoodGivenHaplotypeLog10");
if ( haplotypeBases == null ) throw new IllegalArgumentException("haplotypeBases cannot be null");
if ( haplotypeBases.length > maxHaplotypeLength ) throw new IllegalArgumentException("Haplotype bases is too long, got " + haplotypeBases.length + " but max is " + maxHaplotypeLength);
if ( readBases == null ) throw new IllegalArgumentException("readBases cannot be null");
if ( readBases.length > maxReadLength ) throw new IllegalArgumentException("readBases is too long, got " + readBases.length + " but max is " + maxReadLength);
if ( readQuals.length != readBases.length ) throw new IllegalArgumentException("Read bases and read quals aren't the same size: " + readBases.length + " vs " + readQuals.length);
if ( insertionGOP.length != readBases.length ) throw new IllegalArgumentException("Read bases and read insertion quals aren't the same size: " + readBases.length + " vs " + insertionGOP.length);
if ( deletionGOP.length != readBases.length ) throw new IllegalArgumentException("Read bases and read deletion quals aren't the same size: " + readBases.length + " vs " + deletionGOP.length);
if ( overallGCP.length != readBases.length ) throw new IllegalArgumentException("Read bases and overall GCP aren't the same size: " + readBases.length + " vs " + overallGCP.length);
if ( hapStartIndex < 0 || hapStartIndex > haplotypeBases.length ) throw new IllegalArgumentException("hapStartIndex is bad, must be between 0 and haplotype length " + haplotypeBases.length + " but got " + hapStartIndex);
final double result = subComputeReadLikelihoodGivenHaplotypeLog10(haplotypeBases, readBases, readQuals, insertionGOP, deletionGOP, overallGCP, hapStartIndex, recacheReadValues);
if ( MathUtils.goodLog10Probability(result) )
return result;
else
throw new IllegalStateException("Bad likelihoods detected: " + result);
// return result;
}
/**
* To be overloaded by subclasses to actually do calculation for #computeReadLikelihoodGivenHaplotypeLog10
*/
@Requires({"readBases.length == readQuals.length", "readBases.length == insertionGOP.length", "readBases.length == deletionGOP.length",
"readBases.length == overallGCP.length", "matchMetricArray!=null", "XMetricArray!=null", "YMetricArray!=null"})
@Ensures({"!Double.isInfinite(result)", "!Double.isNaN(result)", "result <= 0.0"}) // Result should be a proper log10 likelihood
public abstract double computeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues );
protected abstract double subComputeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues );
/**
* How many potential starting locations are a read with readSize bases against a haplotype with haplotypeSize bases?
*
* for example, a 3 bp read against a 5 bp haplotype could potentially start at 1, 2, 3 = 5 - 3 + 1 = 3
* the max value is necessary in the case where the read is longer than the haplotype, in which case
* there's a single unique start site by assumption
*
* @param haplotypeSize the number of bases in the haplotype we are testing
* @param readSize the number of bases in the read we are testing
* @return a positive integer >= 1
*/
@Ensures("result >= 1")
protected int getNPotentialXStarts(final int haplotypeSize, final int readSize) {
return Math.max(haplotypeSize - readSize + 1, 1);
}
/**
* The the log10 probability penalty for the number of potential start sites of the read aginst the haplotype
*
* @param haplotypeSize the number of bases in the haplotype we are testing
* @param readSize the number of bases in the read we are testing
* @return a log10 probability
*/
@Ensures("MathUtils.goodLog10Probability(result)")
protected double getNPotentialXStartsLikelihoodPenaltyLog10(final int haplotypeSize, final int readSize) {
return - Math.log10(getNPotentialXStarts(haplotypeSize, readSize));
}
/**
* Print out the core hmm matrices for debugging
*/
protected void dumpMatrices() {
dumpMatrix("matchMetricArray", matchMetricArray);
dumpMatrix("XMetricArray", XMetricArray);
dumpMatrix("YMetricArray", YMetricArray);
}
/**
* Print out in a human readable form the matrix for debugging
* @param name the name of this matrix
* @param matrix the matrix of values
*/
@Requires({"name != null", "matrix != null"})
private void dumpMatrix(final String name, final double[][] matrix) {
System.out.printf("%s%n", name);
for ( int i = 0; i < matrix.length; i++) {
System.out.printf("\t%s[%d]", name, i);
for ( int j = 0; j < matrix[i].length; j++ ) {
if ( Double.isInfinite(matrix[i][j]) )
System.out.printf(" %15s", String.format("%f", matrix[i][j]));
else
System.out.printf(" % 15.5e", matrix[i][j]);
}
System.out.println();
}
}
/**
* Compute the first position at which two haplotypes differ
*
* If the haplotypes are exact copies of each other, returns the min length of the two haplotypes.
*
* @param haplotype1 the first haplotype1
* @param haplotype2 the second haplotype1
* @return the index of the first position in haplotype1 and haplotype2 where the byte isn't the same
*/
public static int findFirstPositionWhereHaplotypesDiffer(final byte[] haplotype1, final byte[] haplotype2) {
if ( haplotype1 == null || haplotype1.length == 0 ) throw new IllegalArgumentException("Haplotype1 is bad " + haplotype1);
if ( haplotype2 == null || haplotype2.length == 0 ) throw new IllegalArgumentException("Haplotype2 is bad " + haplotype2);
for( int iii = 0; iii < haplotype1.length && iii < haplotype2.length; iii++ ) {
if( haplotype1[iii] != haplotype2[iii] ) {
return iii;
}
}
return Math.min(haplotype1.length, haplotype2.length);
}
}