From f313e14e4ef2c3f933505bb16527313ce09e618c Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Tue, 12 Jul 2011 08:50:58 -0400 Subject: [PATCH 1/7] Now deletes the dump directory on ant clean Moving diffengine tests from private to public --- build.xml | 1 + .../diffengine/DiffEngineUnitTest.java | 229 ++++++++++++++++ .../walkers/diffengine/DiffNodeUnitTest.java | 249 ++++++++++++++++++ .../diffengine/DiffableReaderUnitTest.java | 143 ++++++++++ .../diffengine/DifferenceUnitTest.java | 95 +++++++ 5 files changed, 717 insertions(+) create mode 100644 public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java create mode 100644 public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java create mode 100644 public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java create mode 100644 public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java diff --git a/build.xml b/build.xml index 80627fae0..068c69316 100644 --- a/build.xml +++ b/build.xml @@ -981,6 +981,7 @@ + diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java new file mode 100644 index 000000000..cd6c3598a --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java @@ -0,0 +1,229 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DiffEngineUnitTest extends BaseTest { + DiffEngine engine; + + @BeforeClass(enabled = true) + public void createDiffEngine() { + engine = new DiffEngine(); + } + + // -------------------------------------------------------------------------------- + // + // Difference testing routines + // + // -------------------------------------------------------------------------------- + + private class DifferenceTest extends TestDataProvider { + public DiffElement tree1, tree2; + public List differences; + + private DifferenceTest(String tree1, String tree2) { + this(tree1, tree2, Collections.emptyList()); + } + + private DifferenceTest(String tree1, String tree2, String difference) { + this(tree1, tree2, Arrays.asList(difference)); + } + + private DifferenceTest(String tree1, String tree2, List differences) { + super(DifferenceTest.class); + this.tree1 = DiffNode.fromString(tree1); + this.tree2 = DiffNode.fromString(tree2); + this.differences = differences; + } + + public String toString() { + return String.format("tree1=%s tree2=%s diff=%s", + tree1.toOneLineString(), tree2.toOneLineString(), differences); + } + } + + @DataProvider(name = "trees") + public Object[][] createTrees() { + new DifferenceTest("A=X", "A=X"); + new DifferenceTest("A=X", "A=Y", "A:X!=Y"); + new DifferenceTest("A=X", "B=X", Arrays.asList("A:X!=MISSING", "B:MISSING!=X")); + new DifferenceTest("A=(X=1)", "B=(X=1)", Arrays.asList("A:(X=1)!=MISSING", "B:MISSING!=(X=1)")); + new DifferenceTest("A=(X=1)", "A=(X=1)"); + new DifferenceTest("A=(X=1 Y=2)", "A=(X=1 Y=2)"); + new DifferenceTest("A=(X=1 Y=2 B=(Z=3))", "A=(X=1 Y=2 B=(Z=3))"); + new DifferenceTest("A=(X=1)", "A=(X=2)", "A.X:1!=2"); + new DifferenceTest("A=(X=1 Y=2 B=(Z=3))", "A=(X=1 Y=2 B=(Z=4))", "A.B.Z:3!=4"); + new DifferenceTest("A=(X=1)", "A=(X=1 Y=2)", "A.Y:MISSING!=2"); + new DifferenceTest("A=(X=1 Y=2 B=(Z=3))", "A=(X=1 Y=2)", "A.B:(Z=3)!=MISSING"); + return DifferenceTest.getTests(DifferenceTest.class); + } + + @Test(enabled = true, dataProvider = "trees") + public void testDiffs(DifferenceTest test) { + logger.warn("Test tree1: " + test.tree1.toOneLineString()); + logger.warn("Test tree2: " + test.tree2.toOneLineString()); + + List diffs = engine.diff(test.tree1, test.tree2); + logger.warn("Test expected diff : " + test.differences); + logger.warn("Observed diffs : " + diffs); + } + + // -------------------------------------------------------------------------------- + // + // Low-level routines for summarizing differences + // + // -------------------------------------------------------------------------------- + + @Test(enabled = true) + public void testLongestCommonPostfix() { + testLongestCommonPostfixHelper("A", "A", 1); + testLongestCommonPostfixHelper("A", "B", 0); + testLongestCommonPostfixHelper("A.B", "A.B", 2); + testLongestCommonPostfixHelper("A.B.C", "A.B.C", 3); + testLongestCommonPostfixHelper("A.B.C", "X.B.C", 2); + testLongestCommonPostfixHelper("A.B.C", "X.Y.C", 1); + testLongestCommonPostfixHelper("A.B.C", "X.Y.Z", 0); + testLongestCommonPostfixHelper("A.B.C", "A.X.C", 1); + testLongestCommonPostfixHelper("A.B.C", "A.X.Z", 0); + testLongestCommonPostfixHelper("A.B.C", "A.B.Z", 0); + } + + public void testLongestCommonPostfixHelper(String p1, String p2, int expected) { + String[] parts1 = p1.split("\\."); + String[] parts2 = p2.split("\\."); + int obs = DiffEngine.longestCommonPostfix(parts1, parts2); + Assert.assertEquals(obs, expected, "p1=" + p1 + " p2=" + p2 + " failed"); + } + + @Test(enabled = true, dependsOnMethods = "testLongestCommonPostfix") + public void testSummarizePath() { + testSummarizePathHelper("A", "A", "A"); + testSummarizePathHelper("A", "B", "*"); + testSummarizePathHelper("A.B", "A.B", "A.B"); + testSummarizePathHelper("A.B", "X.B", "*.B"); + testSummarizePathHelper("A.B", "X.Y", "*.*"); + testSummarizePathHelper("A.B.C", "A.B.C", "A.B.C"); + testSummarizePathHelper("A.B.C", "X.B.C", "*.B.C"); + testSummarizePathHelper("A.B.C", "X.Y.C", "*.*.C"); + testSummarizePathHelper("A.B.C", "X.Y.Z", "*.*.*"); + testSummarizePathHelper("A.B.C", "A.X.C", "*.*.C"); + testSummarizePathHelper("A.B.C", "A.X.Z", "*.*.*"); + testSummarizePathHelper("A.B.C", "A.B.Z", "*.*.*"); + } + + public void testSummarizePathHelper(String p1, String p2, String expected) { + String[] parts1 = DiffEngine.diffNameToPath(p1); + String[] parts2 = DiffEngine.diffNameToPath(p2); + int obs = DiffEngine.longestCommonPostfix(parts1, parts2); + String path = DiffEngine.summarizedPath(parts2, obs); + Assert.assertEquals(path, expected, "p1=" + p1 + " p2=" + p2 + " failed"); + } + + // -------------------------------------------------------------------------------- + // + // High-level difference summary + // + // -------------------------------------------------------------------------------- + + private class SummarizeDifferenceTest extends TestDataProvider { + List diffs = new ArrayList(); + List expecteds = new ArrayList(); + + public SummarizeDifferenceTest() { super(SummarizeDifferenceTest.class); } + + public SummarizeDifferenceTest addDiff(String... diffsToAdd) { + diffs.addAll(Arrays.asList(diffsToAdd)); + return this; + } + + public SummarizeDifferenceTest addSummary(String... expectedSummary) { + expecteds.addAll(Arrays.asList(expectedSummary)); + return this; + } + + public String toString() { + return String.format("diffs=%s => expected=%s", diffs, expecteds); + } + + public void test() { + List diffPaths = new ArrayList(diffs.size()); + for ( String diff : diffs ) { diffPaths.add(DiffEngine.diffNameToPath(diff)); } + + List sumDiffs = engine.summarizedDifferencesOfPaths(diffPaths); + + Assert.assertEquals(sumDiffs.size(), expecteds.size(), "Unexpected number of summarized differences: " + sumDiffs); + + for ( int i = 0; i < sumDiffs.size(); i++ ) { + DiffEngine.SummarizedDifference sumDiff = sumDiffs.get(i); + String expected = expecteds.get(i); + String[] pathCount = expected.split(":"); + String path = pathCount[0]; + int count = Integer.valueOf(pathCount[1]); + Assert.assertEquals(sumDiff.getPath(), path, "Unexpected path at: " + expected + " obs=" + sumDiff + " all=" + sumDiffs); + Assert.assertEquals(sumDiff.getCount(), count, "Unexpected counts at: " + expected + " obs=" + sumDiff + " all=" + sumDiffs); + } + } + } + + @DataProvider(name = "summaries") + public Object[][] createSummaries() { + new SummarizeDifferenceTest().addDiff("A", "A").addSummary("A:2"); + new SummarizeDifferenceTest().addDiff("A", "B").addSummary("A:1", "B:1"); + new SummarizeDifferenceTest().addDiff("A", "A", "A").addSummary("A:3"); + new SummarizeDifferenceTest().addDiff("A", "A", "A", "B").addSummary("A:3", "B:1"); + new SummarizeDifferenceTest().addDiff("A", "A", "A", "B", "B").addSummary("A:3", "B:2"); + new SummarizeDifferenceTest().addDiff("A", "A", "A", "B", "B", "C").addSummary("A:3", "B:2", "C:1"); + new SummarizeDifferenceTest().addDiff("A.X", "A.X").addSummary("A.X:2"); + new SummarizeDifferenceTest().addDiff("A.X", "A.X", "B.X").addSummary("*.X:3", "A.X:2", "B.X:1"); + new SummarizeDifferenceTest().addDiff("A.X", "A.X", "B.X", "B.X").addSummary("*.X:4", "A.X:2", "B.X:2"); + new SummarizeDifferenceTest().addDiff("A.B.C", "X.B.C").addSummary("*.B.C:2", "A.B.C:1", "X.B.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "X.Y.C", "X.Y.C").addSummary("*.*.C:3", "X.Y.C:2", "A.B.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "A.X.C", "X.Y.C").addSummary("*.*.C:3", "A.B.C:1", "A.X.C:1", "X.Y.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "A.X.C", "B.X.C").addSummary("*.*.C:3", "*.X.C:2", "A.B.C:1", "A.X.C:1", "B.X.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "A.X.C", "B.X.C", "B.X.C").addSummary("*.*.C:4", "*.X.C:3", "B.X.C:2", "A.B.C:1", "A.X.C:1"); + + return SummarizeDifferenceTest.getTests(SummarizeDifferenceTest.class); + } + + + @Test(enabled = true, dependsOnMethods = "testSummarizePath", dataProvider = "summaries") + public void testSummarizeDifferences(SummarizeDifferenceTest test) { + test.test(); + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java new file mode 100644 index 000000000..534416d29 --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java @@ -0,0 +1,249 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DiffNodeUnitTest extends BaseTest { + // Data is: + // MY_ROOT + // fields: A=A, B=B + // nodes: C, D + // C: fields: E=E, nodes: none + // D: fields: F=F, G=G, nodes: none + static DiffNode MY_ROOT = DiffNode.rooted("MY_ROOT"); + static DiffValue Value_A = new DiffValue("A", MY_ROOT, "A"); + static DiffValue Value_B = new DiffValue("B", MY_ROOT, "B"); + static DiffNode NODE_C = DiffNode.empty("C", MY_ROOT); + static DiffNode NODE_D = DiffNode.empty("D", MY_ROOT); + static DiffValue Value_E = new DiffValue("E", NODE_C, "E"); + static DiffValue Value_F = new DiffValue("F", NODE_D, "F"); + static DiffValue Value_G = new DiffValue("G", NODE_D, "G"); + + static { + MY_ROOT.add(Value_A); + MY_ROOT.add(Value_B); + MY_ROOT.add(NODE_C); + MY_ROOT.add(NODE_D); + NODE_C.add(Value_E); + NODE_D.add(Value_F); + NODE_D.add(Value_G); + } + + + // -------------------------------------------------------------------------------- + // + // Element testing routines + // + // -------------------------------------------------------------------------------- + + private class ElementTest extends TestDataProvider { + public DiffElement elt; + public String name; + public String fullName; + public DiffElement parent; + + private ElementTest(DiffValue elt, DiffValue parent, String name, String fullName) { + this(elt.getBinding(), parent.getBinding(), name, fullName); + } + + private ElementTest(DiffElement elt, DiffElement parent, String name, String fullName) { + super(ElementTest.class); + this.elt = elt; + this.name = name; + this.fullName = fullName; + this.parent = parent; + } + + public String toString() { + return String.format("ElementTest elt=%s name=%s fullName=%s parent=%s", + elt.toOneLineString(), name, fullName, parent.getName()); + } + } + + @DataProvider(name = "elementdata") + public Object[][] createElementData() { + new ElementTest(MY_ROOT.getBinding(), DiffElement.ROOT, "MY_ROOT", "MY_ROOT"); + new ElementTest(NODE_C, MY_ROOT, "C", "MY_ROOT.C"); + new ElementTest(NODE_D, MY_ROOT, "D", "MY_ROOT.D"); + new ElementTest(Value_A, MY_ROOT, "A", "MY_ROOT.A"); + new ElementTest(Value_B, MY_ROOT, "B", "MY_ROOT.B"); + new ElementTest(Value_E, NODE_C, "E", "MY_ROOT.C.E"); + new ElementTest(Value_F, NODE_D, "F", "MY_ROOT.D.F"); + new ElementTest(Value_G, NODE_D, "G", "MY_ROOT.D.G"); + return TestDataProvider.getTests(ElementTest.class); + } + + @Test(enabled = true, dataProvider = "elementdata") + public void testElementMethods(ElementTest test) { + Assert.assertNotNull(test.elt.getName()); + Assert.assertNotNull(test.elt.getParent()); + Assert.assertEquals(test.elt.getName(), test.name); + Assert.assertEquals(test.elt.getParent(), test.parent); + Assert.assertEquals(test.elt.fullyQualifiedName(), test.fullName); + } + + // -------------------------------------------------------------------------------- + // + // DiffValue testing routines + // + // -------------------------------------------------------------------------------- + + private class LeafTest extends TestDataProvider { + public DiffValue diffvalue; + public Object value; + + private LeafTest(DiffValue diffvalue, Object value) { + super(LeafTest.class); + this.diffvalue = diffvalue; + this.value = value; + } + + public String toString() { + return String.format("LeafTest diffvalue=%s value=%s", diffvalue.toOneLineString(), value); + } + } + + @DataProvider(name = "leafdata") + public Object[][] createLeafData() { + new LeafTest(Value_A, "A"); + new LeafTest(Value_B, "B"); + new LeafTest(Value_E, "E"); + new LeafTest(Value_F, "F"); + new LeafTest(Value_G, "G"); + return TestDataProvider.getTests(LeafTest.class); + } + + @Test(enabled = true, dataProvider = "leafdata") + public void testLeafMethods(LeafTest test) { + Assert.assertNotNull(test.diffvalue.getValue()); + Assert.assertEquals(test.diffvalue.getValue(), test.value); + } + + // -------------------------------------------------------------------------------- + // + // Node testing routines + // + // -------------------------------------------------------------------------------- + + private class NodeTest extends TestDataProvider { + public DiffNode node; + public Set fields; + public Set subnodes; + public Set allNames; + + private NodeTest(DiffNode node, List fields, List subnodes) { + super(NodeTest.class); + this.node = node; + this.fields = new HashSet(fields); + this.subnodes = new HashSet(subnodes); + this.allNames = new HashSet(fields); + allNames.addAll(subnodes); + } + + public String toString() { + return String.format("NodeTest node=%s fields=%s subnodes=%s", + node.toOneLineString(), fields, subnodes); + } + } + + @DataProvider(name = "nodedata") + public Object[][] createData1() { + new NodeTest(MY_ROOT, Arrays.asList("A", "B"), Arrays.asList("C", "D")); + new NodeTest(NODE_C, Arrays.asList("E"), Collections.emptyList()); + new NodeTest(NODE_D, Arrays.asList("F", "G"), Collections.emptyList()); + return TestDataProvider.getTests(NodeTest.class); + } + + @Test(enabled = true, dataProvider = "nodedata") + public void testNodeAccessors(NodeTest test) { + Assert.assertNotNull(test.node.getElements()); + + for ( String name : test.allNames ) { + DiffElement elt = test.node.getElement(name); + Assert.assertNotNull(elt, "Failed to find field " + elt + " in " + test.node); + Assert.assertEquals(elt.getName(), name); + Assert.assertEquals(elt.getValue().isAtomic(), test.fields.contains(name), "Failed atomic/compound expectation: " + test.node); + } + } + + // NOTE: add routines are being implicitly tested by the creation of the data structures + + @Test(enabled = true, dataProvider = "nodedata") + public void testCounts(NodeTest test) { + Assert.assertEquals(test.node.getElements().size(), test.allNames.size()); + Assert.assertEquals(test.node.getElementNames(), test.allNames); + } + + // -------------------------------------------------------------------------------- + // + // fromString testing routines + // + // -------------------------------------------------------------------------------- + + private class FromStringTest extends TestDataProvider { + public String string; + public DiffElement expected; + + private FromStringTest(String string, DiffElement expected) { + super(FromStringTest.class); + this.string = string; + this.expected = expected; + } + + public String toString() { + return String.format("FromStringTest string=%s expected=%s", string, expected.toOneLineString()); + } + } + + @DataProvider(name = "fromstringdata") + public Object[][] createFromData() { + new FromStringTest("A=A", Value_A.getBinding()); + new FromStringTest("B=B", Value_B.getBinding()); + new FromStringTest("C=(E=E)", NODE_C.getBinding()); + new FromStringTest("D=(F=F G=G)", NODE_D.getBinding()); + return TestDataProvider.getTests(FromStringTest.class); + } + + @Test(enabled = true, dataProvider = "fromstringdata") + public void parseFromString(FromStringTest test) { + logger.warn("Testing from string: " + test.string); + DiffElement elt = DiffNode.fromString(test.string); + Assert.assertEquals(elt.toOneLineString(), test.expected.toOneLineString()); + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java new file mode 100644 index 000000000..5738b643f --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java @@ -0,0 +1,143 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + + +import net.sf.samtools.SAMRecord; +import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.sting.utils.variantcontext.Allele; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.Test; + +import java.io.File; +import java.util.*; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DiffableReaderUnitTest extends BaseTest { + DiffEngine engine; + + File vcfFile = new File(testDir + "diffTestMaster.vcf"); + File bamFile = new File(testDir + "exampleBAM.bam"); + + @BeforeClass(enabled = true) + public void createDiffEngine() { + engine = new DiffEngine(); + } + + @Test(enabled = true) + public void testPluggableDiffableReaders() { + logger.warn("testPluggableDiffableReaders"); + Map readers = engine.getReaders(); + Assert.assertNotNull(readers); + Assert.assertTrue(readers.size() > 0); + Assert.assertNotNull(readers.get("VCF")); + for ( Map.Entry e : engine.getReaders().entrySet() ) { + logger.warn("Found diffable reader: " + e.getKey()); + Assert.assertEquals(e.getValue().getName(), e.getKey()); + Assert.assertEquals(e.getValue(), engine.getReader(e.getKey())); + } + } + + private static void testLeaf(DiffNode rec, String field, Object expected) { + DiffElement value = rec.getElement(field); + Assert.assertNotNull(value, "Expected to see leaf named " + field + " in rec " + rec); + Assert.assertEquals(value.getValue().getValue(), expected, "Expected to leaf named " + field + " to have value " + expected + " in rec " + rec); + } + + @Test(enabled = true, dependsOnMethods = "testPluggableDiffableReaders") + public void testVCF1() { + logger.warn("testVCF1"); + DiffableReader vcfReader = engine.getReader("VCF"); + Assert.assertTrue(vcfReader.canRead(vcfFile)); + Assert.assertFalse(vcfReader.canRead(bamFile)); + + DiffElement diff = vcfReader.readFromFile(vcfFile); + Assert.assertNotNull(diff); + + Assert.assertEquals(diff.getName(), vcfFile.getName()); + Assert.assertSame(diff.getParent(), DiffElement.ROOT); + + DiffNode node = diff.getValueAsNode(); + Assert.assertEquals(node.getElements().size(), 9); + + // chr1 2646 rs62635284 G A 0.15 PASS AC=2;AF=1.00;AN=2 GT:AD:DP:GL:GQ 1/1:53,75:3:-12.40,-0.90,-0.00:9.03 + DiffNode rec1 = node.getElement("chr1:2646").getValueAsNode(); + testLeaf(rec1, "CHROM", "chr1"); + testLeaf(rec1, "POS", 2646); + testLeaf(rec1, "ID", "rs62635284"); + testLeaf(rec1, "REF", Allele.create("G", true)); + testLeaf(rec1, "ALT", new HashSet(Arrays.asList(Allele.create("A")))); + testLeaf(rec1, "QUAL", 0.15); + testLeaf(rec1, "FILTER", Collections.emptySet()); + testLeaf(rec1, "AC", "2"); + testLeaf(rec1, "AF", "1.00"); + testLeaf(rec1, "AN", "2"); + } + + @Test(enabled = true, dependsOnMethods = "testPluggableDiffableReaders") + public void testBAM() { + logger.warn("testBAM"); + DiffableReader bamReader = engine.getReader("BAM"); + Assert.assertTrue(bamReader.canRead(bamFile)); + Assert.assertFalse(bamReader.canRead(vcfFile)); + + DiffElement diff = bamReader.readFromFile(bamFile); + Assert.assertNotNull(diff); + + Assert.assertEquals(diff.getName(), bamFile.getName()); + Assert.assertSame(diff.getParent(), DiffElement.ROOT); + + DiffNode node = diff.getValueAsNode(); + Assert.assertEquals(node.getElements().size(), 33); + + // 30PPJAAXX090125:1:42:512:1817#0 99 chr1 200 0 76M = + // 255 -130 ACCCTAACCCTAACCCTAACCCTAACCATAACCCTAAGACTAACCCTAAACCTAACCCTCATAATCGAAATACAAC + // BBBBC@C?AABCBB<63>=B@>+B9-9+)2B8,+@327B5A>90((>-+''3?(/'''A)(''19('7.,**%)3: + // PG:Z:0 RG:Z:exampleBAM.bam SM:Z:exampleBAM.bam + + DiffNode rec1 = node.getElement("30PPJAAXX090125:1:42:512:1817#0_1").getValueAsNode(); + testLeaf(rec1, "NAME", "30PPJAAXX090125:1:42:512:1817#0"); + testLeaf(rec1, "FLAGS", 99); + testLeaf(rec1, "RNAME", "chr1"); + testLeaf(rec1, "POS", 200); + testLeaf(rec1, "MAPQ", 0); + testLeaf(rec1, "CIGAR", "76M"); + testLeaf(rec1, "RNEXT", "chr1"); + testLeaf(rec1, "PNEXT", 255); + testLeaf(rec1, "TLEN", -130); + testLeaf(rec1, "SEQ", "ACCCTAACCCTAACCCTAACCCTAACCATAACCCTAAGACTAACCCTAAACCTAACCCTCATAATCGAAATACAAC"); + testLeaf(rec1, "QUAL", "BBBBC@C?AABCBB<63>=B@>+B9-9+)2B8,+@327B5A>90((>-+''3?(/'''A)(''19('7.,**%)3:"); + testLeaf(rec1, "PG", "0"); + testLeaf(rec1, "RG", "exampleBAM.bam"); + testLeaf(rec1, "SM", "exampleBAM.bam"); + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java new file mode 100644 index 000000000..da272ec30 --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java @@ -0,0 +1,95 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.Arrays; +import java.util.Collections; +import java.util.List; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DifferenceUnitTest extends BaseTest { + // -------------------------------------------------------------------------------- + // + // testing routines + // + // -------------------------------------------------------------------------------- + + private class DifferenceTest extends TestDataProvider { + public DiffElement tree1, tree2; + public String difference; + + private DifferenceTest(String tree1, String tree2, String difference) { + this(DiffNode.fromString(tree1), DiffNode.fromString(tree2), difference); + } + + private DifferenceTest(DiffElement tree1, DiffElement tree2, String difference) { + super(DifferenceTest.class); + this.tree1 = tree1; + this.tree2 = tree2; + this.difference = difference; + } + + public String toString() { + return String.format("tree1=%s tree2=%s diff=%s", + tree1 == null ? "null" : tree1.toOneLineString(), + tree2 == null ? "null" : tree2.toOneLineString(), + difference); + } + } + + @DataProvider(name = "data") + public Object[][] createTrees() { + new DifferenceTest("A=X", "A=Y", "A:X!=Y"); + new DifferenceTest("A=Y", "A=X", "A:Y!=X"); + new DifferenceTest(DiffNode.fromString("A=X"), null, "A:X!=MISSING"); + new DifferenceTest(null, DiffNode.fromString("A=X"), "A:MISSING!=X"); + return DifferenceTest.getTests(DifferenceTest.class); + } + + @Test(enabled = true, dataProvider = "data") + public void testDiffToString(DifferenceTest test) { + logger.warn("Test tree1: " + (test.tree1 == null ? "null" : test.tree1.toOneLineString())); + logger.warn("Test tree2: " + (test.tree2 == null ? "null" : test.tree2.toOneLineString())); + logger.warn("Test expected diff : " + test.difference); + Difference diff = new Difference(test.tree1, test.tree2); + logger.warn("Observed diffs : " + diff); + Assert.assertEquals(diff.toString(), test.difference, "Observed diff string " + diff + " not equal to expected difference string " + test.difference ); + + } +} \ No newline at end of file From 8056a3fe89046d942c4b656ff8138283e0235769 Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Tue, 12 Jul 2011 08:52:31 -0400 Subject: [PATCH 2/7] getElement() now uses O(1) get from hash instead of linear O(n) search. Enables us to read large files easily. --- .../sting/gatk/walkers/diffengine/DiffNode.java | 10 ++++++---- 1 file changed, 6 insertions(+), 4 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java index 0720e18c0..3e1be8609 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java @@ -107,11 +107,13 @@ public class DiffNode extends DiffValue { return getElements(false); } + /** + * Returns the element bound to name, or null if no such binding exists + * @param name + * @return + */ public DiffElement getElement(String name) { - for ( DiffElement elt : getElements() ) - if ( elt.getName().equals(name) ) - return elt; - return null; + return getElementMap().get(name); } /** From 05212aea62b2f78f7a739257bac86fd0b16d2c5b Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Tue, 12 Jul 2011 08:53:19 -0400 Subject: [PATCH 3/7] reader now takes an argument for the maximum number of elements to read from the file. --- .../walkers/diffengine/BAMDiffableReader.java | 5 ++--- .../gatk/walkers/diffengine/DiffEngine.java | 7 ++++++- .../walkers/diffengine/DiffObjectsWalker.java | 17 ++++++++++------- .../gatk/walkers/diffengine/DiffableReader.java | 2 +- .../walkers/diffengine/VCFDiffableReader.java | 10 ++++++++-- .../diffengine/DiffableReaderUnitTest.java | 4 ++-- 6 files changed, 29 insertions(+), 16 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java index f7a395d9d..a5ebf27bb 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java @@ -51,12 +51,11 @@ import java.util.zip.GZIPInputStream; * Class implementing diffnode reader for VCF */ public class BAMDiffableReader implements DiffableReader { - private final static int MAX_RECORDS_TO_READ = 1000; @Override public String getName() { return "BAM"; } @Override - public DiffElement readFromFile(File file) { + public DiffElement readFromFile(File file, int maxElementsToRead) { final SAMFileReader reader = new SAMFileReader(file, null); // null because we don't want it to look for the index reader.setValidationStringency(SAMFileReader.ValidationStringency.SILENT); @@ -65,7 +64,7 @@ public class BAMDiffableReader implements DiffableReader { int count = 0; while ( iterator.hasNext() ) { - if ( count++ > MAX_RECORDS_TO_READ ) + if ( count++ > maxElementsToRead && maxElementsToRead != -1) break; final SAMRecord record = iterator.next(); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java index ba2713bff..54a7a464d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java @@ -385,12 +385,17 @@ public class DiffEngine { return findReaderForFile(file) != null; } + public DiffElement createDiffableFromFile(File file) { + return createDiffableFromFile(file, -1); + } + + public DiffElement createDiffableFromFile(File file, int maxElementsToRead) { DiffableReader reader = findReaderForFile(file); if ( reader == null ) throw new UserException("Unsupported file type: " + file); else - return reader.readFromFile(file); + return reader.readFromFile(file, maxElementsToRead); } public static boolean simpleDiffFiles(File masterFile, File testFile, DiffEngine.SummaryReportParams params) { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java index a08108db2..fe411b195 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java @@ -48,11 +48,14 @@ public class DiffObjectsWalker extends RodWalker { @Output(doc="File to which results should be written",required=true) protected PrintStream out; - @Argument(fullName="maxRecords", shortName="M", doc="Max. number of records to process", required=false) - int MAX_RECORDS = 0; + @Argument(fullName="maxObjectsToRead", shortName="motr", doc="Max. number of objects to read from the files. -1 [default] means unlimited", required=false) + int MAX_OBJECTS_TO_READ = -1; - @Argument(fullName="maxCount1Records", shortName="M1", doc="Max. number of records occuring exactly once in the file to process", required=false) - int MAX_COUNT1_RECORDS = 0; + @Argument(fullName="maxDiffs", shortName="M", doc="Max. number of diffs to process", required=false) + int MAX_DIFFS = 0; + + @Argument(fullName="maxCount1Diffs", shortName="M1", doc="Max. number of diffs occuring exactly once in the file to process", required=false) + int MAX_COUNT1_DIFFS = 0; @Argument(fullName="minCountForDiff", shortName="MCFD", doc="Min number of observations for a records to display", required=false) int minCountForDiff = 1; @@ -91,9 +94,9 @@ public class DiffObjectsWalker extends RodWalker { @Override public void onTraversalDone(Integer sum) { out.printf("Reading master file %s%n", masterFile); - DiffElement master = diffEngine.createDiffableFromFile(masterFile); + DiffElement master = diffEngine.createDiffableFromFile(masterFile, MAX_OBJECTS_TO_READ); out.printf("Reading test file %s%n", testFile); - DiffElement test = diffEngine.createDiffableFromFile(testFile); + DiffElement test = diffEngine.createDiffableFromFile(testFile, MAX_OBJECTS_TO_READ); // out.printf("Master diff objects%n"); // out.println(master.toString()); @@ -107,7 +110,7 @@ public class DiffObjectsWalker extends RodWalker { out.printf("DIFF: %s%n", diff.toString()); } - DiffEngine.SummaryReportParams params = new DiffEngine.SummaryReportParams(out, MAX_RECORDS, MAX_COUNT1_RECORDS, minCountForDiff); + DiffEngine.SummaryReportParams params = new DiffEngine.SummaryReportParams(out, MAX_DIFFS, MAX_COUNT1_DIFFS, minCountForDiff); diffEngine.reportSummarizedDifferences(diffs, params); } } \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReader.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReader.java index 84c2eed10..af5771c55 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReader.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReader.java @@ -43,7 +43,7 @@ public interface DiffableReader { @Ensures("result != null") @Requires("file != null") - public DiffElement readFromFile(File file); + public DiffElement readFromFile(File file, int maxElementsToRead); @Requires("file != null") public boolean canRead(File file); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java index 743178538..06d14366f 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java @@ -51,15 +51,21 @@ public class VCFDiffableReader implements DiffableReader { public String getName() { return "VCF"; } @Override - public DiffElement readFromFile(File file) { + public DiffElement readFromFile(File file, int maxElementsToRead) { DiffNode root = DiffNode.rooted(file.getName()); try { LineReader lineReader = new AsciiLineReader(new FileInputStream(file)); VCFCodec vcfCodec = new VCFCodec(); - VCFHeader header = (VCFHeader)vcfCodec.readHeader(lineReader); + + // must be read as state is stored in reader itself + vcfCodec.readHeader(lineReader); String line = lineReader.readLine(); + int count = 0; while ( line != null ) { + if ( count++ > maxElementsToRead && maxElementsToRead != -1) + break; + VariantContext vc = (VariantContext)vcfCodec.decode(line); String name = vc.getChr() + ":" + vc.getStart(); DiffNode vcRoot = DiffNode.empty(name, root); diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java index 5738b643f..baa2f0383 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java @@ -80,7 +80,7 @@ public class DiffableReaderUnitTest extends BaseTest { Assert.assertTrue(vcfReader.canRead(vcfFile)); Assert.assertFalse(vcfReader.canRead(bamFile)); - DiffElement diff = vcfReader.readFromFile(vcfFile); + DiffElement diff = vcfReader.readFromFile(vcfFile, -1); Assert.assertNotNull(diff); Assert.assertEquals(diff.getName(), vcfFile.getName()); @@ -110,7 +110,7 @@ public class DiffableReaderUnitTest extends BaseTest { Assert.assertTrue(bamReader.canRead(bamFile)); Assert.assertFalse(bamReader.canRead(vcfFile)); - DiffElement diff = bamReader.readFromFile(bamFile); + DiffElement diff = bamReader.readFromFile(bamFile, -1); Assert.assertNotNull(diff); Assert.assertEquals(diff.getName(), bamFile.getName()); From ccedd6ff4c942c20c1a57f6a6bf65c5cb63b6e16 Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Tue, 12 Jul 2011 15:20:28 -0400 Subject: [PATCH 4/7] Difference is now the general form -- used to be SummarizedDifference. The old Difference class is now a subclass of Difference that includes pointers to specific the master and test DiffElements. Added a size() function that calculates the number of elements tree from a DiffElement. --- .../gatk/walkers/diffengine/DiffElement.java | 4 + .../gatk/walkers/diffengine/DiffEngine.java | 142 +++++------------- .../gatk/walkers/diffengine/DiffNode.java | 7 + .../walkers/diffengine/DiffObjectsWalker.java | 7 +- .../gatk/walkers/diffengine/DiffValue.java | 1 + .../gatk/walkers/diffengine/Difference.java | 83 +++++++--- .../diffengine/SpecificDifference.java | 59 ++++++++ .../diffengine/DiffEngineUnitTest.java | 6 +- .../diffengine/DifferenceUnitTest.java | 2 +- 9 files changed, 176 insertions(+), 135 deletions(-) create mode 100644 public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/SpecificDifference.java diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffElement.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffElement.java index eff24bb88..4c3f7bd95 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffElement.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffElement.java @@ -115,4 +115,8 @@ public class DiffElement { else throw new ReviewedStingException("Illegal request conversion of a DiffValue into a DiffNode: " + this); } + + public int size() { + return 1 + getValue().size(); + } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java index 54a7a464d..6d85df71d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java @@ -24,11 +24,9 @@ package org.broadinstitute.sting.gatk.walkers.diffengine; -import com.google.java.contract.Requires; import org.apache.log4j.Logger; import org.broadinstitute.sting.gatk.report.GATKReport; import org.broadinstitute.sting.gatk.report.GATKReportTable; -import org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.VariantStratifier; import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.classloader.PluginManager; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; @@ -60,7 +58,7 @@ public class DiffEngine { // // -------------------------------------------------------------------------------- - public List diff(DiffElement master, DiffElement test) { + public List diff(DiffElement master, DiffElement test) { DiffValue masterValue = master.getValue(); DiffValue testValue = test.getValue(); @@ -70,14 +68,14 @@ public class DiffEngine { return diff(masterValue, testValue); } else { // structural difference in types. one is node, other is leaf - return Arrays.asList(new Difference(master, test)); + return Arrays.asList(new SpecificDifference(master, test)); } } - public List diff(DiffNode master, DiffNode test) { + public List diff(DiffNode master, DiffNode test) { Set allNames = new HashSet(master.getElementNames()); allNames.addAll(test.getElementNames()); - List diffs = new ArrayList(); + List diffs = new ArrayList(); for ( String name : allNames ) { DiffElement masterElt = master.getElement(name); @@ -86,7 +84,7 @@ public class DiffEngine { throw new ReviewedStingException("BUG: unexceptedly got two null elements for field: " + name); } else if ( masterElt == null || testElt == null ) { // if either is null, we are missing a value // todo -- should one of these be a special MISSING item? - diffs.add(new Difference(masterElt, testElt)); + diffs.add(new SpecificDifference(masterElt, testElt)); } else { diffs.addAll(diff(masterElt, testElt)); } @@ -95,11 +93,11 @@ public class DiffEngine { return diffs; } - public List diff(DiffValue master, DiffValue test) { + public List diff(DiffValue master, DiffValue test) { if ( master.getValue().equals(test.getValue()) ) { return Collections.emptyList(); } else { - return Arrays.asList(new Difference(master.getBinding(), test.getBinding())); + return Arrays.asList(new SpecificDifference(master.getBinding(), test.getBinding())); } } @@ -147,64 +145,68 @@ public class DiffEngine { * @param params determines how we display the items * @param diffs */ - public void reportSummarizedDifferences(List diffs, SummaryReportParams params ) { + public void reportSummarizedDifferences(List diffs, SummaryReportParams params ) { printSummaryReport(summarizeDifferences(diffs), params ); } - public List summarizeDifferences(List diffs) { - List diffPaths = new ArrayList(diffs.size()); - - for ( Difference diff1 : diffs ) { - diffPaths.add(diffNameToPath(diff1.getFullyQualifiedName())); - } - - return summarizedDifferencesOfPaths(diffPaths); + public List summarizeDifferences(List diffs) { + return summarizedDifferencesOfPaths(diffs); } final protected static String[] diffNameToPath(String diffName) { return diffName.split("\\."); } - protected List summarizedDifferencesOfPaths(List diffPaths) { - Map summaries = new HashMap(); + protected List summarizedDifferencesOfPathsFromString(List singletonDiffs) { + List diffs = new ArrayList(); + + for ( String diff : singletonDiffs ) { + diffs.add(new Difference(diff)); + } + + return summarizedDifferencesOfPaths(diffs); + } + + protected List summarizedDifferencesOfPaths(List singletonDiffs) { + Map summaries = new HashMap(); // create the initial set of differences - for ( int i = 0; i < diffPaths.size(); i++ ) { + for ( int i = 0; i < singletonDiffs.size(); i++ ) { for ( int j = 0; j <= i; j++ ) { - String[] diffPath1 = diffPaths.get(i); - String[] diffPath2 = diffPaths.get(j); - if ( diffPath1.length == diffPath2.length ) { - int lcp = longestCommonPostfix(diffPath1, diffPath2); - String path = lcp > 0 ? summarizedPath(diffPath2, lcp) : Utils.join(".", diffPath2); + Difference diffPath1 = singletonDiffs.get(i); + Difference diffPath2 = singletonDiffs.get(j); + if ( diffPath1.length() == diffPath2.length() ) { + int lcp = longestCommonPostfix(diffPath1.getParts(), diffPath2.getParts()); + String path = lcp > 0 ? summarizedPath(diffPath2.getParts(), lcp) : diffPath2.getPath(); addSummary(summaries, path, true); } } } // count differences - for ( String[] diffPath : diffPaths ) { - for ( SummarizedDifference sumDiff : summaries.values() ) { - if ( sumDiff.matches(diffPath) ) + for ( Difference diffPath : singletonDiffs ) { + for ( Difference sumDiff : summaries.values() ) { + if ( sumDiff.matches(diffPath.getParts()) ) addSummary(summaries, sumDiff.getPath(), false); } } - List sortedSummaries = new ArrayList(summaries.values()); + List sortedSummaries = new ArrayList(summaries.values()); Collections.sort(sortedSummaries); return sortedSummaries; } - private static void addSummary(Map summaries, String path, boolean onlyCatalog) { + private static void addSummary(Map summaries, String path, boolean onlyCatalog) { if ( summaries.containsKey(path) ) { if ( ! onlyCatalog ) summaries.get(path).incCount(); } else { - SummarizedDifference sumDiff = new SummarizedDifference(path); + Difference sumDiff = new Difference(path); summaries.put(sumDiff.getPath(), sumDiff); } } - protected void printSummaryReport(List sortedSummaries, SummaryReportParams params ) { + protected void printSummaryReport(List sortedSummaries, SummaryReportParams params ) { GATKReport report = new GATKReport(); final String tableName = "diffences"; report.addTable(tableName, "Summarized differences between the master and test files.\nSee http://www.broadinstitute.org/gsa/wiki/index.php/DiffObjectsWalker_and_SummarizedDifferences for more information"); @@ -213,7 +215,7 @@ public class DiffEngine { table.addColumn("NumberOfOccurrences", 0); int count = 0, count1 = 0; - for ( SummarizedDifference diff : sortedSummaries ) { + for ( Difference diff : sortedSummaries ) { if ( diff.getCount() < params.minSumDiffToShow ) // in order, so break as soon as the count is too low break; @@ -261,76 +263,6 @@ public class DiffEngine { return Utils.join(".", parts); } - /** - * TODO -- all of the algorithms above should use SummarizedDifference instead - * TODO -- of some SummarizedDifferences and some low-level String[] - */ - public static class SummarizedDifference implements Comparable { - final String path; // X.Y.Z - final String[] parts; - int count = 0; - - public SummarizedDifference(String path) { - this.path = path; - this.parts = diffNameToPath(path); - } - - public void incCount() { count++; } - - public int getCount() { - return count; - } - - /** - * The fully qualified path object A.B.C etc - * @return - */ - public String getPath() { - return path; - } - - /** - * @return the length of the parts of this summary - */ - public int length() { - return this.parts.length; - } - - /** - * Returns true if the string parts matches this summary. Matches are - * must be equal() everywhere where this summary isn't *. - * @param otherParts - * @return - */ - public boolean matches(String[] otherParts) { - if ( otherParts.length != length() ) - return false; - - // TODO optimization: can start at right most non-star element - for ( int i = 0; i < length(); i++ ) { - String part = parts[i]; - if ( ! part.equals("*") && ! part.equals(otherParts[i]) ) - return false; - } - - return true; - } - - @Override - public String toString() { - return String.format("%s:%d", getPath(), getCount()); - } - - @Override - public int compareTo(SummarizedDifference other) { - // sort first highest to lowest count, then by lowest to highest path - int countCmp = Integer.valueOf(count).compareTo(other.count); - return countCmp != 0 ? -1 * countCmp : path.compareTo(other.path); - } - - - } - // -------------------------------------------------------------------------------- // // plugin manager @@ -404,7 +336,7 @@ public class DiffEngine { if ( diffEngine.canRead(masterFile) && diffEngine.canRead(testFile) ) { DiffElement master = diffEngine.createDiffableFromFile(masterFile); DiffElement test = diffEngine.createDiffableFromFile(testFile); - List diffs = diffEngine.diff(master, test); + List diffs = diffEngine.diff(master, test); diffEngine.reportSummarizedDifferences(diffs, params); return true; } else { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java index 3e1be8609..2f48de2d3 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java @@ -153,6 +153,13 @@ public class DiffNode extends DiffValue { add(new DiffElement(name, this.getBinding(), new DiffValue(value))); } + public int size() { + int count = 0; + for ( DiffElement value : getElements() ) + count += value.size(); + return count; + } + // --------------------------------------------------------------------------- // // toString diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java index fe411b195..ecb836af9 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java @@ -24,7 +24,6 @@ package org.broadinstitute.sting.gatk.walkers.diffengine; -import org.apache.xmlbeans.impl.tool.Diff; import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; @@ -95,18 +94,20 @@ public class DiffObjectsWalker extends RodWalker { public void onTraversalDone(Integer sum) { out.printf("Reading master file %s%n", masterFile); DiffElement master = diffEngine.createDiffableFromFile(masterFile, MAX_OBJECTS_TO_READ); + out.printf(" Read %d objects%n", master.size()); out.printf("Reading test file %s%n", testFile); DiffElement test = diffEngine.createDiffableFromFile(testFile, MAX_OBJECTS_TO_READ); + out.printf(" Read %d objects%n", test.size()); // out.printf("Master diff objects%n"); // out.println(master.toString()); // out.printf("Test diff objects%n"); // out.println(test.toString()); - List diffs = diffEngine.diff(master, test); + List diffs = diffEngine.diff(master, test); if ( showItemizedDifferences ) { out.printf("Itemized results%n"); - for ( Difference diff : diffs ) + for ( SpecificDifference diff : diffs ) out.printf("DIFF: %s%n", diff.toString()); } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffValue.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffValue.java index 7245e9e8d..3750496a1 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffValue.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffValue.java @@ -87,4 +87,5 @@ public class DiffValue { public boolean isAtomic() { return true; } public boolean isCompound() { return ! isAtomic(); } + public int size() { return 1; } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/Difference.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/Difference.java index 6627a4cc5..efc6ef160 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/Difference.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/Difference.java @@ -24,35 +24,72 @@ package org.broadinstitute.sting.gatk.walkers.diffengine; -/** - * Created by IntelliJ IDEA. - * User: depristo - * Date: 7/4/11 - * Time: 12:53 PM - * - * Represents a specific difference between two specific DiffElements - */ -public class Difference { - DiffElement master, test; +public class Difference implements Comparable { + final String path; // X.Y.Z + final String[] parts; + int count = 0; - public Difference(DiffElement master, DiffElement test) { - if ( master == null && test == null ) throw new IllegalArgumentException("Master and test both cannot be null"); - this.master = master; - this.test = test; + public Difference(String path) { + this.path = path; + this.parts = DiffEngine.diffNameToPath(path); } + public String[] getParts() { + return parts; + } + + public void incCount() { count++; } + + public int getCount() { + return count; + } + + /** + * The fully qualified path object A.B.C etc + * @return + */ + public String getPath() { + return path; + } + + /** + * @return the length of the parts of this summary + */ + public int length() { + return this.parts.length; + } + + /** + * Returns true if the string parts matches this summary. Matches are + * must be equal() everywhere where this summary isn't *. + * @param otherParts + * @return + */ + public boolean matches(String[] otherParts) { + if ( otherParts.length != length() ) + return false; + + // TODO optimization: can start at right most non-star element + for ( int i = 0; i < length(); i++ ) { + String part = parts[i]; + if ( ! part.equals("*") && ! part.equals(otherParts[i]) ) + return false; + } + + return true; + } + + @Override public String toString() { - return String.format("%s:%s!=%s", - getFullyQualifiedName(), - getOneLineString(master), - getOneLineString(test)); + return String.format("%s:%d", getPath(), getCount()); } - public String getFullyQualifiedName() { - return (master == null ? test : master).fullyQualifiedName(); + @Override + public int compareTo(Difference other) { + // sort first highest to lowest count, then by lowest to highest path + int countCmp = Integer.valueOf(count).compareTo(other.count); + return countCmp != 0 ? -1 * countCmp : path.compareTo(other.path); } - private static String getOneLineString(DiffElement elt) { - return elt == null ? "MISSING" : elt.getValue().toOneLineString(); - } + } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/SpecificDifference.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/SpecificDifference.java new file mode 100644 index 000000000..2fe9b47f8 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/SpecificDifference.java @@ -0,0 +1,59 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +/** + * Created by IntelliJ IDEA. + * User: depristo + * Date: 7/4/11 + * Time: 12:53 PM + * + * Represents a specific difference between two specific DiffElements + */ +public class SpecificDifference extends Difference { + DiffElement master, test; + + public SpecificDifference(DiffElement master, DiffElement test) { + super(createName(master, test)); + if ( master == null && test == null ) throw new IllegalArgumentException("Master and test both cannot be null"); + this.master = master; + this.test = test; + } + + public String toString() { + return String.format("%s:%s!=%s", + getPath(), + getOneLineString(master), + getOneLineString(test)); + } + + private static String createName(DiffElement master, DiffElement test) { + return (master == null ? test : master).fullyQualifiedName(); + } + + private static String getOneLineString(DiffElement elt) { + return elt == null ? "MISSING" : elt.getValue().toOneLineString(); + } +} diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java index cd6c3598a..96dfec6e8 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java @@ -99,7 +99,7 @@ public class DiffEngineUnitTest extends BaseTest { logger.warn("Test tree1: " + test.tree1.toOneLineString()); logger.warn("Test tree2: " + test.tree2.toOneLineString()); - List diffs = engine.diff(test.tree1, test.tree2); + List diffs = engine.diff(test.tree1, test.tree2); logger.warn("Test expected diff : " + test.differences); logger.warn("Observed diffs : " + diffs); } @@ -185,12 +185,12 @@ public class DiffEngineUnitTest extends BaseTest { List diffPaths = new ArrayList(diffs.size()); for ( String diff : diffs ) { diffPaths.add(DiffEngine.diffNameToPath(diff)); } - List sumDiffs = engine.summarizedDifferencesOfPaths(diffPaths); + List sumDiffs = engine.summarizedDifferencesOfPathsFromString(diffs); Assert.assertEquals(sumDiffs.size(), expecteds.size(), "Unexpected number of summarized differences: " + sumDiffs); for ( int i = 0; i < sumDiffs.size(); i++ ) { - DiffEngine.SummarizedDifference sumDiff = sumDiffs.get(i); + Difference sumDiff = sumDiffs.get(i); String expected = expecteds.get(i); String[] pathCount = expected.split(":"); String path = pathCount[0]; diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java index da272ec30..64579a01b 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java @@ -87,7 +87,7 @@ public class DifferenceUnitTest extends BaseTest { logger.warn("Test tree1: " + (test.tree1 == null ? "null" : test.tree1.toOneLineString())); logger.warn("Test tree2: " + (test.tree2 == null ? "null" : test.tree2.toOneLineString())); logger.warn("Test expected diff : " + test.difference); - Difference diff = new Difference(test.tree1, test.tree2); + SpecificDifference diff = new SpecificDifference(test.tree1, test.tree2); logger.warn("Observed diffs : " + diff); Assert.assertEquals(diff.toString(), test.difference, "Observed diff string " + diff + " not equal to expected difference string " + test.difference ); From 5077c94d85929bad35fcc00bbeab0b8036aabe4a Mon Sep 17 00:00:00 2001 From: Ryan Poplin Date: Tue, 12 Jul 2011 15:39:07 -0400 Subject: [PATCH 5/7] Adding MappingQualityUnavailableReadFilter to the SNP and indel CountCovariates --- .../recalibration/CountCovariatesWalker.java | 3 +- .../RecalibrationWalkersIntegrationTest.java | 91 +++---------------- 2 files changed, 15 insertions(+), 79 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/recalibration/CountCovariatesWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/recalibration/CountCovariatesWalker.java index 6673bec92..c21f548b3 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/recalibration/CountCovariatesWalker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/recalibration/CountCovariatesWalker.java @@ -27,6 +27,7 @@ package org.broadinstitute.sting.gatk.walkers.recalibration; import org.broad.tribble.bed.BEDCodec; import org.broad.tribble.dbsnp.DbSNPCodec; +import org.broadinstitute.sting.gatk.filters.MappingQualityUnavailableReadFilter; import org.broadinstitute.sting.utils.codecs.vcf.VCF3Codec; import org.broadinstitute.sting.utils.codecs.vcf.VCFCodec; import org.broadinstitute.sting.commandline.Gather; @@ -75,7 +76,7 @@ import java.util.Map; @BAQMode(ApplicationTime = BAQ.ApplicationTime.FORBIDDEN) @By( DataSource.READS ) // Only look at covered loci, not every loci of the reference file -@ReadFilters( {MappingQualityZeroReadFilter.class} ) // Filter out all reads with zero mapping quality +@ReadFilters( {MappingQualityZeroReadFilter.class, MappingQualityUnavailableReadFilter.class} ) // Filter out all reads with zero or unavailable mapping quality @Requires( {DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES} ) // This walker requires both -I input.bam and -R reference.fasta @PartitionBy(PartitionType.LOCUS) public class CountCovariatesWalker extends LocusWalker implements TreeReducible { diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/recalibration/RecalibrationWalkersIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/recalibration/RecalibrationWalkersIntegrationTest.java index b0f76229b..129161da3 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/recalibration/RecalibrationWalkersIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/recalibration/RecalibrationWalkersIntegrationTest.java @@ -19,9 +19,9 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { public void testCountCovariates1() { HashMap e = new HashMap(); e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "7b5832d4b2a23b8ef2bb639eb59bfa88" ); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "f4f8a49bb5764d2a8f61e055f64dcce4"); + e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "9c006f8e9fb5752b1c139f5a8cc7ea88"); e.put( validationDataLocation + "NA12873.454.SRP000031.2009_06.chr1.10_20mb.bam", "e6f7b4ab9aa291022e0ba8b7dbe4c77e" ); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.bam", "570506533f079d738d70934dfe1c02cd" ); + e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.bam", "e6b98af01c5a08e4954b79ec42db6fc3" ); for ( String parallelism : Arrays.asList("", " -nt 4")) { for ( Map.Entry entry : e.entrySet() ) { @@ -53,9 +53,9 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { public void testTableRecalibrator1() { HashMap e = new HashMap(); e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "0278cce4cfdab869dc0c11d6852a984b" ); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "344d4252143df8c2cce6b568747553a5"); + e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "6797d7ffa4ef6c48413719ba32696ccf"); e.put( validationDataLocation + "NA12873.454.SRP000031.2009_06.chr1.10_20mb.bam", "2bb3374dde131791d7638031ae3b3e10" ); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.bam", "064c4a7bdd23974c3a9c5f924540df76" ); + e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.bam", "1f9d8944b73169b367cb83b0d22e5432" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -107,7 +107,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testTableRecalibratorMaxQ70() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "344d4252143df8c2cce6b568747553a5" ); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "0278cce4cfdab869dc0c11d6852a984b" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -133,12 +133,10 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { } } - - @Test public void testCountCovariatesSolidIndelsRemoveRefBias() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "0a6cdb9611e5880ea6611205080aa267" ); + e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "c9ea5f995e1e2b7a5688533e678dcedc" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -164,7 +162,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testTableRecalibratorSolidIndelsRemoveRefBias() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "9bc7e1ad223ba759fe5e8ddb4c07369c" ); + e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "993fae4270e7e1e15986f270acf247af" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -189,13 +187,10 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { } } - - - @Test public void testCountCovariatesVCF() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "3700eaf567e4937f442fc777a226d6ad"); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "170f0c3cc4b8d72c539136effeec9a16"); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -219,7 +214,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testCountCovariatesBED() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "6803891a3398821fc8a37e19ea8e5a00"); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "b460478d9683e827784e42bc352db8bb"); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -243,7 +238,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testCountCovariatesVCFPlusDBsnp() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "f224c42fbc4026db973ccc91265ab5c7"); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "a3d892bd60d8f679affda3c1e3af96c1"); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -268,69 +263,10 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { } } - @Test - public void testCountCovariatesNoReadGroups() { - HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12762.SOLID.SRP000031.2009_07.chr1.10_20mb.bam", "c024e03f019aeceaf364fa58c8295ad8" ); - - for ( Map.Entry entry : e.entrySet() ) { - String bam = entry.getKey(); - String md5 = entry.getValue(); - - WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( - "-R " + b36KGReference + - " --DBSNP " + GATKDataLocation + "dbsnp_129_b36.rod" + - " -T CountCovariates" + - " -I " + bam + - " -L 1:10,000,000-10,200,000" + - " -cov ReadGroupCovariate" + - " -cov QualityScoreCovariate" + - " -cov CycleCovariate" + - " -cov DinucCovariate" + - " --default_read_group DefaultReadGroup" + - " --default_platform illumina" + - " --solid_recal_mode SET_Q_ZERO" + - " -recalFile %s", - 1, // just one output file - Arrays.asList(md5)); - List result = executeTest("testCountCovariatesNoReadGroups", spec).getFirst(); - paramsFilesNoReadGroupTest.put(bam, result.get(0).getAbsolutePath()); - } - } - - @Test - public void testTableRecalibratorNoReadGroups() { - HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12762.SOLID.SRP000031.2009_07.chr1.10_20mb.bam", "1eefbe7ac0376fc1ed1392d85242171e" ); - - for ( Map.Entry entry : e.entrySet() ) { - String bam = entry.getKey(); - String md5 = entry.getValue(); - String paramsFile = paramsFilesNoReadGroupTest.get(bam); - System.out.printf("PARAMS FOR %s is %s%n", bam, paramsFile); - if ( paramsFile != null ) { - WalkerTestSpec spec = new WalkerTestSpec( - "-R " + b36KGReference + - " -T TableRecalibration" + - " -I " + bam + - " -L 1:10,100,000-10,300,000" + - " -o %s" + - " --no_pg_tag" + - " --solid_recal_mode SET_Q_ZERO" + - " --default_read_group DefaultReadGroup" + - " --default_platform illumina" + - " -recalFile " + paramsFile, - 1, // just one output file - Arrays.asList(md5)); - executeTest("testTableRecalibratorNoReadGroups", spec); - } - } - } - @Test public void testCountCovariatesNoIndex() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.noindex.bam", "cfc31bb6f51436d1c3b34f62bb801dc8" ); + e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.noindex.bam", "284ccac1f8fe485e52c86333cac7c2d4" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -356,7 +292,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testTableRecalibratorNoIndex() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.noindex.bam", "83b848a16034c2fb423d1bb0f5be7784" ); + e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.noindex.bam", "c167799c2d9cab815d7c9b23337f162e" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -380,11 +316,10 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { } } - @Test public void testCountCovariatesFailWithoutDBSNP() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", ""); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", ""); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey();