zzh
/
gatk-3.8
1
0
Fork 0
Code Issues Pull Requests Packages Projects Releases Wiki Activity

Use base List and Map types in the GenotypingEngineUnitTest.

This commit is contained in:
Ryan Poplin 2013-01-31 10:12:18 -05:00
parent 404ee9a6e4
commit ca6968d038
1 changed files with 23 additions and 23 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

46
protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngineUnitTest.java
View File

@ -93,7 +93,7 @@ public class GenotypingEngineUnitTest extends BaseTest {
haplotypeAlleles.add( Allele.create("AACA", false) ); haplotypeAlleles.add( Allele.create("AACA", false) );
haplotypeAlleles.add( Allele.create("CATA", false) ); haplotypeAlleles.add( Allele.create("CATA", false) );
haplotypeAlleles.add( Allele.create("CACA", false) ); haplotypeAlleles.add( Allele.create("CACA", false) );
final ArrayList<Haplotype> haplotypes = new ArrayList<Haplotype>(); final List<Haplotype> haplotypes = new ArrayList<Haplotype>();
haplotypes.add(new Haplotype("AATA".getBytes())); haplotypes.add(new Haplotype("AATA".getBytes()));
haplotypes.add(new Haplotype("AACA".getBytes())); haplotypes.add(new Haplotype("AACA".getBytes()));
haplotypes.add(new Haplotype("CATA".getBytes())); haplotypes.add(new Haplotype("CATA".getBytes()));
@ -101,11 +101,11 @@ public class GenotypingEngineUnitTest extends BaseTest {
final List<Allele> haplotypeAllelesForSample = new ArrayList<Allele>(); final List<Allele> haplotypeAllelesForSample = new ArrayList<Allele>();
haplotypeAllelesForSample.add( Allele.create("CATA", false) ); haplotypeAllelesForSample.add( Allele.create("CATA", false) );
haplotypeAllelesForSample.add( Allele.create("CACA", false) ); haplotypeAllelesForSample.add( Allele.create("CACA", false) );
final ArrayList<ArrayList<Haplotype>> alleleMapper = new ArrayList<ArrayList<Haplotype>>(); final List<List<Haplotype>> alleleMapper = new ArrayList<List<Haplotype>>();
ArrayList<Haplotype> Aallele = new ArrayList<Haplotype>(); List<Haplotype> Aallele = new ArrayList<Haplotype>();
Aallele.add(haplotypes.get(0)); Aallele.add(haplotypes.get(0));
Aallele.add(haplotypes.get(1)); Aallele.add(haplotypes.get(1));
ArrayList<Haplotype> Callele = new ArrayList<Haplotype>(); List<Haplotype> Callele = new ArrayList<Haplotype>();
Callele.add(haplotypes.get(2)); Callele.add(haplotypes.get(2));
Callele.add(haplotypes.get(3)); Callele.add(haplotypes.get(3));
alleleMapper.add(Aallele); alleleMapper.add(Aallele);
@ -135,7 +135,7 @@ public class GenotypingEngineUnitTest extends BaseTest {
haplotypeAlleles.add( Allele.create("TACA", false) ); haplotypeAlleles.add( Allele.create("TACA", false) );
haplotypeAlleles.add( Allele.create("TTCA", false) ); haplotypeAlleles.add( Allele.create("TTCA", false) );
haplotypeAlleles.add( Allele.create("TTTA", false) ); haplotypeAlleles.add( Allele.create("TTTA", false) );
final ArrayList<Haplotype> haplotypes = new ArrayList<Haplotype>(); final List<Haplotype> haplotypes = new ArrayList<Haplotype>();
haplotypes.add(new Haplotype("AATA".getBytes())); haplotypes.add(new Haplotype("AATA".getBytes()));
haplotypes.add(new Haplotype("AACA".getBytes())); haplotypes.add(new Haplotype("AACA".getBytes()));
haplotypes.add(new Haplotype("CATA".getBytes())); haplotypes.add(new Haplotype("CATA".getBytes()));
@ -146,14 +146,14 @@ public class GenotypingEngineUnitTest extends BaseTest {
final List<Allele> haplotypeAllelesForSample = new ArrayList<Allele>(); final List<Allele> haplotypeAllelesForSample = new ArrayList<Allele>();
haplotypeAllelesForSample.add( Allele.create("TTTA", false) ); haplotypeAllelesForSample.add( Allele.create("TTTA", false) );
haplotypeAllelesForSample.add( Allele.create("AATA", true) ); haplotypeAllelesForSample.add( Allele.create("AATA", true) );
final ArrayList<ArrayList<Haplotype>> alleleMapper = new ArrayList<ArrayList<Haplotype>>(); final List<List<Haplotype>> alleleMapper = new ArrayList<List<Haplotype>>();
ArrayList<Haplotype> Aallele = new ArrayList<Haplotype>(); List<Haplotype> Aallele = new ArrayList<Haplotype>();
Aallele.add(haplotypes.get(0)); Aallele.add(haplotypes.get(0));
Aallele.add(haplotypes.get(1)); Aallele.add(haplotypes.get(1));
ArrayList<Haplotype> Callele = new ArrayList<Haplotype>(); List<Haplotype> Callele = new ArrayList<Haplotype>();
Callele.add(haplotypes.get(2)); Callele.add(haplotypes.get(2));
Callele.add(haplotypes.get(3)); Callele.add(haplotypes.get(3));
ArrayList<Haplotype> Tallele = new ArrayList<Haplotype>(); List<Haplotype> Tallele = new ArrayList<Haplotype>();
Tallele.add(haplotypes.get(4)); Tallele.add(haplotypes.get(4));
Tallele.add(haplotypes.get(5)); Tallele.add(haplotypes.get(5));
Tallele.add(haplotypes.get(6)); Tallele.add(haplotypes.get(6));
@ -187,16 +187,16 @@ public class GenotypingEngineUnitTest extends BaseTest {
private class BasicGenotypingTestProvider extends TestDataProvider { private class BasicGenotypingTestProvider extends TestDataProvider {
byte[] ref; byte[] ref;
byte[] hap; byte[] hap;
HashMap<Integer,Byte> expected; Map<Integer,Byte> expected;
public BasicGenotypingTestProvider(String refString, String hapString, HashMap<Integer, Byte> expected) { public BasicGenotypingTestProvider(String refString, String hapString, Map<Integer, Byte> expected) {
super(BasicGenotypingTestProvider.class, String.format("Haplotype to VCF test: ref = %s, alignment = %s", refString,hapString)); super(BasicGenotypingTestProvider.class, String.format("Haplotype to VCF test: ref = %s, alignment = %s", refString,hapString));
ref = refString.getBytes(); ref = refString.getBytes();
hap = hapString.getBytes(); hap = hapString.getBytes();
this.expected = expected; this.expected = expected;
} }
public HashMap<Integer,VariantContext> calcAlignment() { public Map<Integer,VariantContext> calcAlignment() {
final SWPairwiseAlignment alignment = new SWPairwiseAlignment(ref, hap); final SWPairwiseAlignment alignment = new SWPairwiseAlignment(ref, hap);
return GenotypingEngine.generateVCsFromAlignment( new Haplotype(hap), alignment.getAlignmentStart2wrt1(), alignment.getCigar(), ref, hap, genomeLocParser.createGenomeLoc("4",1,1+ref.length), "name"); return GenotypingEngine.generateVCsFromAlignment( new Haplotype(hap), alignment.getAlignmentStart2wrt1(), alignment.getCigar(), ref, hap, genomeLocParser.createGenomeLoc("4",1,1+ref.length), "name");
} }
@ -206,14 +206,14 @@ public class GenotypingEngineUnitTest extends BaseTest {
public Object[][] makeBasicGenotypingTests() { public Object[][] makeBasicGenotypingTests() {
for( int contextSize : new int[]{0,1,5,9,24,36} ) { for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>(); Map<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1 + contextSize, (byte)'M'); map.put(1 + contextSize, (byte)'M');
final String context = Utils.dupString('G', contextSize); final String context = Utils.dupString('G', contextSize);
new BasicGenotypingTestProvider(context + "AGCTCGCATCGCGAGCATCGACTAGCCGATAG" + context, "CGCTCGCATCGCGAGCATCGACTAGCCGATAG", map); new BasicGenotypingTestProvider(context + "AGCTCGCATCGCGAGCATCGACTAGCCGATAG" + context, "CGCTCGCATCGCGAGCATCGACTAGCCGATAG", map);
} }
for( int contextSize : new int[]{0,1,5,9,24,36} ) { for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>(); Map<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(2 + contextSize, (byte)'M'); map.put(2 + contextSize, (byte)'M');
map.put(21 + contextSize, (byte)'M'); map.put(21 + contextSize, (byte)'M');
final String context = Utils.dupString('G', contextSize); final String context = Utils.dupString('G', contextSize);
@ -221,7 +221,7 @@ public class GenotypingEngineUnitTest extends BaseTest {
} }
for( int contextSize : new int[]{0,1,5,9,24,36} ) { for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>(); Map<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1 + contextSize, (byte)'M'); map.put(1 + contextSize, (byte)'M');
map.put(20 + contextSize, (byte)'I'); map.put(20 + contextSize, (byte)'I');
final String context = Utils.dupString('G', contextSize); final String context = Utils.dupString('G', contextSize);
@ -229,7 +229,7 @@ public class GenotypingEngineUnitTest extends BaseTest {
} }
for( int contextSize : new int[]{0,1,5,9,24,36} ) { for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>(); Map<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1 + contextSize, (byte)'M'); map.put(1 + contextSize, (byte)'M');
map.put(20 + contextSize, (byte)'D'); map.put(20 + contextSize, (byte)'D');
final String context = Utils.dupString('G', contextSize); final String context = Utils.dupString('G', contextSize);
@ -237,7 +237,7 @@ public class GenotypingEngineUnitTest extends BaseTest {
} }
for( int contextSize : new int[]{1,5,9,24,36} ) { for( int contextSize : new int[]{1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>(); Map<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1, (byte)'M'); map.put(1, (byte)'M');
map.put(20, (byte)'D'); map.put(20, (byte)'D');
final String context = Utils.dupString('G', contextSize); final String context = Utils.dupString('G', contextSize);
@ -245,7 +245,7 @@ public class GenotypingEngineUnitTest extends BaseTest {
} }
for( int contextSize : new int[]{0,1,5,9,24,36} ) { for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>(); Map<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(2 + contextSize, (byte)'M'); map.put(2 + contextSize, (byte)'M');
map.put(20 + contextSize, (byte)'I'); map.put(20 + contextSize, (byte)'I');
map.put(30 + contextSize, (byte)'D'); map.put(30 + contextSize, (byte)'D');
@ -254,7 +254,7 @@ public class GenotypingEngineUnitTest extends BaseTest {
} }
for( int contextSize : new int[]{0,1,5,9,24,36} ) { for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>(); Map<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1 + contextSize, (byte)'M'); map.put(1 + contextSize, (byte)'M');
map.put(20 + contextSize, (byte)'D'); map.put(20 + contextSize, (byte)'D');
map.put(28 + contextSize, (byte)'M'); map.put(28 + contextSize, (byte)'M');
@ -267,8 +267,8 @@ public class GenotypingEngineUnitTest extends BaseTest {
@Test(dataProvider = "BasicGenotypingTestProvider", enabled = true) @Test(dataProvider = "BasicGenotypingTestProvider", enabled = true)
public void testHaplotypeToVCF(BasicGenotypingTestProvider cfg) { public void testHaplotypeToVCF(BasicGenotypingTestProvider cfg) {
HashMap<Integer,VariantContext> calculatedMap = cfg.calcAlignment(); Map<Integer,VariantContext> calculatedMap = cfg.calcAlignment();
HashMap<Integer,Byte> expectedMap = cfg.expected; Map<Integer,Byte> expectedMap = cfg.expected;
logger.warn(String.format("Test: %s", cfg.toString())); logger.warn(String.format("Test: %s", cfg.toString()));
if(!compareVCMaps(calculatedMap, expectedMap)) { if(!compareVCMaps(calculatedMap, expectedMap)) {
logger.warn("calc map = " + calculatedMap); logger.warn("calc map = " + calculatedMap);
@ -420,9 +420,9 @@ public class GenotypingEngineUnitTest extends BaseTest {
} }
/** /**
* Private function to compare HashMap of VCs, it only checks the types and start locations of the VariantContext * Private function to compare Map of VCs, it only checks the types and start locations of the VariantContext
*/ */
private boolean compareVCMaps(HashMap<Integer, VariantContext> calc, HashMap<Integer, Byte> expected) { private boolean compareVCMaps(Map<Integer, VariantContext> calc, Map<Integer, Byte> expected) {
if( !calc.keySet().equals(expected.keySet()) ) { return false; } // sanity check if( !calc.keySet().equals(expected.keySet()) ) { return false; } // sanity check
for( Integer loc : expected.keySet() ) { for( Integer loc : expected.keySet() ) {
Byte type = expected.get(loc); Byte type = expected.get(loc);