From ca6968d038b5ca8ed449fbc49b75f0e8c726834e Mon Sep 17 00:00:00 2001 From: Ryan Poplin Date: Thu, 31 Jan 2013 10:12:18 -0500 Subject: [PATCH] Use base List and Map types in the GenotypingEngineUnitTest. --- .../GenotypingEngineUnitTest.java | 46 +++++++++---------- 1 file changed, 23 insertions(+), 23 deletions(-) diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngineUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngineUnitTest.java index f82c0a8ba..8b09e91ae 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngineUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngineUnitTest.java @@ -93,7 +93,7 @@ public class GenotypingEngineUnitTest extends BaseTest { haplotypeAlleles.add( Allele.create("AACA", false) ); haplotypeAlleles.add( Allele.create("CATA", false) ); haplotypeAlleles.add( Allele.create("CACA", false) ); - final ArrayList haplotypes = new ArrayList(); + final List haplotypes = new ArrayList(); haplotypes.add(new Haplotype("AATA".getBytes())); haplotypes.add(new Haplotype("AACA".getBytes())); haplotypes.add(new Haplotype("CATA".getBytes())); @@ -101,11 +101,11 @@ public class GenotypingEngineUnitTest extends BaseTest { final List haplotypeAllelesForSample = new ArrayList(); haplotypeAllelesForSample.add( Allele.create("CATA", false) ); haplotypeAllelesForSample.add( Allele.create("CACA", false) ); - final ArrayList> alleleMapper = new ArrayList>(); - ArrayList Aallele = new ArrayList(); + final List> alleleMapper = new ArrayList>(); + List Aallele = new ArrayList(); Aallele.add(haplotypes.get(0)); Aallele.add(haplotypes.get(1)); - ArrayList Callele = new ArrayList(); + List Callele = new ArrayList(); Callele.add(haplotypes.get(2)); Callele.add(haplotypes.get(3)); alleleMapper.add(Aallele); @@ -135,7 +135,7 @@ public class GenotypingEngineUnitTest extends BaseTest { haplotypeAlleles.add( Allele.create("TACA", false) ); haplotypeAlleles.add( Allele.create("TTCA", false) ); haplotypeAlleles.add( Allele.create("TTTA", false) ); - final ArrayList haplotypes = new ArrayList(); + final List haplotypes = new ArrayList(); haplotypes.add(new Haplotype("AATA".getBytes())); haplotypes.add(new Haplotype("AACA".getBytes())); haplotypes.add(new Haplotype("CATA".getBytes())); @@ -146,14 +146,14 @@ public class GenotypingEngineUnitTest extends BaseTest { final List haplotypeAllelesForSample = new ArrayList(); haplotypeAllelesForSample.add( Allele.create("TTTA", false) ); haplotypeAllelesForSample.add( Allele.create("AATA", true) ); - final ArrayList> alleleMapper = new ArrayList>(); - ArrayList Aallele = new ArrayList(); + final List> alleleMapper = new ArrayList>(); + List Aallele = new ArrayList(); Aallele.add(haplotypes.get(0)); Aallele.add(haplotypes.get(1)); - ArrayList Callele = new ArrayList(); + List Callele = new ArrayList(); Callele.add(haplotypes.get(2)); Callele.add(haplotypes.get(3)); - ArrayList Tallele = new ArrayList(); + List Tallele = new ArrayList(); Tallele.add(haplotypes.get(4)); Tallele.add(haplotypes.get(5)); Tallele.add(haplotypes.get(6)); @@ -187,16 +187,16 @@ public class GenotypingEngineUnitTest extends BaseTest { private class BasicGenotypingTestProvider extends TestDataProvider { byte[] ref; byte[] hap; - HashMap expected; + Map expected; - public BasicGenotypingTestProvider(String refString, String hapString, HashMap expected) { + public BasicGenotypingTestProvider(String refString, String hapString, Map expected) { super(BasicGenotypingTestProvider.class, String.format("Haplotype to VCF test: ref = %s, alignment = %s", refString,hapString)); ref = refString.getBytes(); hap = hapString.getBytes(); this.expected = expected; } - public HashMap calcAlignment() { + public Map calcAlignment() { final SWPairwiseAlignment alignment = new SWPairwiseAlignment(ref, hap); return GenotypingEngine.generateVCsFromAlignment( new Haplotype(hap), alignment.getAlignmentStart2wrt1(), alignment.getCigar(), ref, hap, genomeLocParser.createGenomeLoc("4",1,1+ref.length), "name"); } @@ -206,14 +206,14 @@ public class GenotypingEngineUnitTest extends BaseTest { public Object[][] makeBasicGenotypingTests() { for( int contextSize : new int[]{0,1,5,9,24,36} ) { - HashMap map = new HashMap(); + Map map = new HashMap(); map.put(1 + contextSize, (byte)'M'); final String context = Utils.dupString('G', contextSize); new BasicGenotypingTestProvider(context + "AGCTCGCATCGCGAGCATCGACTAGCCGATAG" + context, "CGCTCGCATCGCGAGCATCGACTAGCCGATAG", map); } for( int contextSize : new int[]{0,1,5,9,24,36} ) { - HashMap map = new HashMap(); + Map map = new HashMap(); map.put(2 + contextSize, (byte)'M'); map.put(21 + contextSize, (byte)'M'); final String context = Utils.dupString('G', contextSize); @@ -221,7 +221,7 @@ public class GenotypingEngineUnitTest extends BaseTest { } for( int contextSize : new int[]{0,1,5,9,24,36} ) { - HashMap map = new HashMap(); + Map map = new HashMap(); map.put(1 + contextSize, (byte)'M'); map.put(20 + contextSize, (byte)'I'); final String context = Utils.dupString('G', contextSize); @@ -229,7 +229,7 @@ public class GenotypingEngineUnitTest extends BaseTest { } for( int contextSize : new int[]{0,1,5,9,24,36} ) { - HashMap map = new HashMap(); + Map map = new HashMap(); map.put(1 + contextSize, (byte)'M'); map.put(20 + contextSize, (byte)'D'); final String context = Utils.dupString('G', contextSize); @@ -237,7 +237,7 @@ public class GenotypingEngineUnitTest extends BaseTest { } for( int contextSize : new int[]{1,5,9,24,36} ) { - HashMap map = new HashMap(); + Map map = new HashMap(); map.put(1, (byte)'M'); map.put(20, (byte)'D'); final String context = Utils.dupString('G', contextSize); @@ -245,7 +245,7 @@ public class GenotypingEngineUnitTest extends BaseTest { } for( int contextSize : new int[]{0,1,5,9,24,36} ) { - HashMap map = new HashMap(); + Map map = new HashMap(); map.put(2 + contextSize, (byte)'M'); map.put(20 + contextSize, (byte)'I'); map.put(30 + contextSize, (byte)'D'); @@ -254,7 +254,7 @@ public class GenotypingEngineUnitTest extends BaseTest { } for( int contextSize : new int[]{0,1,5,9,24,36} ) { - HashMap map = new HashMap(); + Map map = new HashMap(); map.put(1 + contextSize, (byte)'M'); map.put(20 + contextSize, (byte)'D'); map.put(28 + contextSize, (byte)'M'); @@ -267,8 +267,8 @@ public class GenotypingEngineUnitTest extends BaseTest { @Test(dataProvider = "BasicGenotypingTestProvider", enabled = true) public void testHaplotypeToVCF(BasicGenotypingTestProvider cfg) { - HashMap calculatedMap = cfg.calcAlignment(); - HashMap expectedMap = cfg.expected; + Map calculatedMap = cfg.calcAlignment(); + Map expectedMap = cfg.expected; logger.warn(String.format("Test: %s", cfg.toString())); if(!compareVCMaps(calculatedMap, expectedMap)) { logger.warn("calc map = " + calculatedMap); @@ -420,9 +420,9 @@ public class GenotypingEngineUnitTest extends BaseTest { } /** - * Private function to compare HashMap of VCs, it only checks the types and start locations of the VariantContext + * Private function to compare Map of VCs, it only checks the types and start locations of the VariantContext */ - private boolean compareVCMaps(HashMap calc, HashMap expected) { + private boolean compareVCMaps(Map calc, Map expected) { if( !calc.keySet().equals(expected.keySet()) ) { return false; } // sanity check for( Integer loc : expected.keySet() ) { Byte type = expected.get(loc);