Merge pull request #754 from broadinstitute/rhl_variant_array_exception

Do not process a variant if it is too large (> readLength), and log an e...
This commit is contained in:
rpoplin 2014-10-21 12:01:52 -04:00
commit c4fcd70a88
4 changed files with 97 additions and 12 deletions

View File

@ -51,6 +51,7 @@
package org.broadinstitute.gatk.tools.walkers.simulatereads; package org.broadinstitute.gatk.tools.walkers.simulatereads;
import org.apache.log4j.Logger;
import cern.jet.random.Poisson; import cern.jet.random.Poisson;
import cern.jet.random.engine.MersenneTwister; import cern.jet.random.engine.MersenneTwister;
import htsjdk.samtools.SAMFileHeader; import htsjdk.samtools.SAMFileHeader;
@ -108,6 +109,7 @@ import java.util.*;
@Reference(window=@Window(start=-200,stop=200)) @Reference(window=@Window(start=-200,stop=200))
public class SimulateReadsForVariants extends RodWalker<Integer, Integer> { public class SimulateReadsForVariants extends RodWalker<Integer, Integer> {
private static Logger logger = Logger.getLogger(SimulateReadsForVariants.class);
@ArgumentCollection protected StandardVariantContextInputArgumentCollection variantCollection = new StandardVariantContextInputArgumentCollection(); @ArgumentCollection protected StandardVariantContextInputArgumentCollection variantCollection = new StandardVariantContextInputArgumentCollection();
/** /**
@ -248,20 +250,21 @@ public class SimulateReadsForVariants extends RodWalker<Integer, Integer> {
if ( vc == null || !vc.isBiallelic() ) if ( vc == null || !vc.isBiallelic() )
return 0; return 0;
if ( verbose ) logger.info(String.format("Generating reads for %s", vc)); if ( !generateReadsForVariant(vc, ref, useAFAsAlleleFraction) )
return 0;
generateReadsForVariant(vc, ref, useAFAsAlleleFraction); if ( verbose ) logger.info(String.format("Generating reads for %s", vc));
return 1; return 1;
} }
/** /**
* Contstructs an artifical haplotype given an allele and original reference context * Constructs an artificial haplotype given an allele and original reference context
* *
* @param allele the allele to model (can be reference) * @param allele the allele to model (can be reference)
* @param refLength the length of the reference allele * @param refLength the length of the reference allele
* @param ref the original reference context * @param ref the original reference context
* @return a non-null ArtificialHaplotype * @return the artificial haplotype or null if the readLength parameter is too small to hold the allele and reference
*/ */
private ArtificialHaplotype constructHaplotype(final Allele allele, final int refLength, final ReferenceContext ref) { private ArtificialHaplotype constructHaplotype(final Allele allele, final int refLength, final ReferenceContext ref) {
@ -269,24 +272,63 @@ public class SimulateReadsForVariants extends RodWalker<Integer, Integer> {
final int alleleLength = allele.getBases().length; final int alleleLength = allele.getBases().length;
final int halfAlleleLength = (alleleLength + 1) / 2; final int halfAlleleLength = (alleleLength + 1) / 2;
final int refContextLength = ref.getBases().length;
// this is how far back to move from the event to start copying bases // this is how far back to move from the event to start copying bases
final int offset = halfReadLength - halfAlleleLength; final int offset = halfReadLength - halfAlleleLength;
// number of bases copied to the haplotype
int copiedCount = 0;
// copy bases before the event // copy bases before the event
final int locusPosOnRefContext = (int)(ref.getLocus().getStart() - ref.getWindow().getStart()); final int locusPosOnRefContext = (int)(ref.getLocus().getStart() - ref.getWindow().getStart());
int posOnRefContext = locusPosOnRefContext - offset; int posOnRefContext = locusPosOnRefContext - offset;
if ( offset >= 0 && posOnRefContext >= 0 && posOnRefContext + offset <= refContextLength )
{
System.arraycopy(ref.getBases(), posOnRefContext, haplotype, 0, offset); System.arraycopy(ref.getBases(), posOnRefContext, haplotype, 0, offset);
int copiedCount = offset; copiedCount = offset;
}
else
{
String msg = new String("Can not copy reference bases to haplotype: ");
if ( offset < 0 )
msg += "Read length(" + readLength + ") < Allele length(" + alleleLength + ")";
else
msg += "Reference position(" + posOnRefContext + ") < 0";
logger.info(msg);
return null;
}
// copy the event bases // copy the event bases
if ( copiedCount + alleleLength <= readLength )
{
System.arraycopy(allele.getBases(), 0, haplotype, copiedCount, alleleLength); System.arraycopy(allele.getBases(), 0, haplotype, copiedCount, alleleLength);
copiedCount += alleleLength; copiedCount += alleleLength;
}
else
{
String msg = new String("Can not copy allele bases to haplotype: ");
msg += "Read length(" + readLength + ") < Allele length(" + alleleLength + ") + copied count(" + copiedCount + ")";
logger.info(msg);
return null;
}
// copy bases after the event // copy bases after the event
posOnRefContext = locusPosOnRefContext + refLength; posOnRefContext = locusPosOnRefContext + refLength;
final int remainder = readLength - copiedCount; final int remainder = readLength - copiedCount;
if ( remainder > 0 && posOnRefContext + remainder <= refContextLength )
{
System.arraycopy(ref.getBases(), posOnRefContext, haplotype, copiedCount, remainder); System.arraycopy(ref.getBases(), posOnRefContext, haplotype, copiedCount, remainder);
copiedCount += remainder;
}
else
{
String msg = new String("Can not copy remaining reference bases to haplotype: ");
msg += "Read length(" + readLength + ") <= Copied count(" + copiedCount + ")";
logger.info(msg);
return null;
}
final String cigar; final String cigar;
if ( refLength == alleleLength ) if ( refLength == alleleLength )
@ -303,12 +345,17 @@ public class SimulateReadsForVariants extends RodWalker<Integer, Integer> {
* @param vc the (bi-allelic) variant context for which to generate artificial reads * @param vc the (bi-allelic) variant context for which to generate artificial reads
* @param ref the original reference context * @param ref the original reference context
* @param useAFAsAlleleFraction use AF tag to indicate allele fraction * @param useAFAsAlleleFraction use AF tag to indicate allele fraction
* @return true if successful generation of artificial reads for the variant, false otherwise
*/ */
private void generateReadsForVariant(final VariantContext vc, final ReferenceContext ref, final boolean useAFAsAlleleFraction) { private boolean generateReadsForVariant(final VariantContext vc, final ReferenceContext ref, final boolean useAFAsAlleleFraction) {
final int refLength = vc.getReference().getBases().length; final int refLength = vc.getReference().getBases().length;
final ArtificialHaplotype refHap = constructHaplotype(vc.getReference(), refLength, ref); final ArtificialHaplotype refHap = constructHaplotype(vc.getReference(), refLength, ref);
if ( refHap == null )
return false;
final ArtificialHaplotype altHap = constructHaplotype(vc.getAlternateAllele(0), refLength, ref); final ArtificialHaplotype altHap = constructHaplotype(vc.getAlternateAllele(0), refLength, ref);
if ( altHap == null )
return false;
final double refAlleleFraction = (useAFAsAlleleFraction)?1-vc.getAttributeAsDouble(VCFConstants.ALLELE_FREQUENCY_KEY, 0.5):0.5; final double refAlleleFraction = (useAFAsAlleleFraction)?1-vc.getAttributeAsDouble(VCFConstants.ALLELE_FREQUENCY_KEY, 0.5):0.5;
@ -328,6 +375,8 @@ public class SimulateReadsForVariants extends RodWalker<Integer, Integer> {
writeRead(readBases, vc.getChr(), vc.getStart() - haplotype.offset, haplotype.cigar, g.getSampleName(), gi++ % 2 == 0); writeRead(readBases, vc.getChr(), vc.getStart() - haplotype.offset, haplotype.cigar, g.getSampleName(), gi++ % 2 == 0);
} }
} }
return true;
} }
/** /**

View File

@ -110,4 +110,24 @@ public class SimulateReadsForVariantsIntegrationTest extends WalkerTest {
} }
@Test
public void testLongInsertFailure() {
WalkerTestSpec spec = new WalkerTestSpec(
"-T SimulateReadsForVariants --no_pg_tag -R " + b37KGReference + " -V " + publicTestDir + "forLongInsert.vcf -o %s",
1,
Arrays.asList("bb412c1fc8f95523dd2fc623d53dbeec"));
executeTest("testLongInsertFailure", spec);
}
@Test
public void testLongInsertSuccess() {
WalkerTestSpec spec = new WalkerTestSpec(
"-RL 269 -T SimulateReadsForVariants --no_pg_tag -R " + b37KGReference + " -V " + publicTestDir + "forLongInsert.vcf -o %s",
1,
Arrays.asList("9236320c470cd8d6759c21b79206f63f"));
executeTest("testLongInsertSuccess", spec);
}
} }

View File

@ -0,0 +1,16 @@
##fileformat=VCFv4.1
##fileDate=20140820
##source=mutatrix population genome simulator
##seed=100
##reference=ref.fasta
##phasing=true
##commandline=mutatrix ref.fasta --file-prefix mutations/ --sample-prefix 0 -n 1 --ploidy 2 --random-seed 100 --snp-rate 0.001
##INFO=<ID=AC,Number=A,Type=Integer,Description="Alternate allele count">
##INFO=<ID=TYPE,Number=A,Type=String,Description="Type of each allele (snp, ins, del, mnp, complex)">
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples at the site">
##INFO=<ID=NA,Number=1,Type=Integer,Description="Number of alternate alleles">
##INFO=<ID=LEN,Number=A,Type=Integer,Description="Length of each alternate allele">
##INFO=<ID=MICROSAT,Number=0,Type=Flag,Description="Generated at a sequence repeat loci">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 01
20 10000000 . T TGTCTTAGTGTCGTATGGGCTTCCATATTCAACTTTCTTCTATAAGTAGAATATCTACACGTGATGCTCTGGTCTTTCTACTACACGTCTATTGTAGCTTAATCTTTTCCTCGGGGGGGAAGAGGCTGTTTAGAATCATACCTCCAACCGACATTAACCCTGTTGGATTATAACTAGGGGCAAATCCGGATATTGGTATACGGCCCTATTATTCTATGGGTCTACGCACCTAGTAGGCACCCACGCAGTCTCTGGCCCGACCCCA 99 . AC=2;LEN=264;NA=1;NS=1;TYPE=ins GT 1|1