diff --git a/ivy.xml b/ivy.xml index b197d0714..6dd5be7a8 100644 --- a/ivy.xml +++ b/ivy.xml @@ -52,7 +52,7 @@ - + diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/AdvancedRecalibrationEngine.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/AdvancedRecalibrationEngine.java index 9eca81852..d714ca185 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/AdvancedRecalibrationEngine.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/AdvancedRecalibrationEngine.java @@ -25,10 +25,14 @@ package org.broadinstitute.sting.gatk.walkers.bqsr; * OTHER DEALINGS IN THE SOFTWARE. */ +import org.broadinstitute.sting.utils.recalibration.covariates.Covariate; import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.classloader.ProtectedPackageSource; import org.broadinstitute.sting.utils.collections.NestedIntegerArray; import org.broadinstitute.sting.utils.pileup.PileupElement; +import org.broadinstitute.sting.utils.recalibration.EventType; +import org.broadinstitute.sting.utils.recalibration.ReadCovariates; +import org.broadinstitute.sting.utils.recalibration.RecalDatum; import org.broadinstitute.sting.utils.recalibration.RecalibrationTables; public class AdvancedRecalibrationEngine extends StandardRecalibrationEngine implements ProtectedPackageSource { diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SyntheticRead.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SyntheticRead.java index 9ee1a4634..3b9fc0390 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SyntheticRead.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SyntheticRead.java @@ -5,7 +5,7 @@ import net.sf.samtools.Cigar; import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; import net.sf.samtools.SAMFileHeader; -import org.broadinstitute.sting.gatk.walkers.bqsr.EventType; +import org.broadinstitute.sting.utils.recalibration.EventType; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/ErrorModel.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/ErrorModel.java index 864414de9..8e4ca9595 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/ErrorModel.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/ErrorModel.java @@ -68,10 +68,10 @@ public class ErrorModel { break; } } + haplotypeMap = new LinkedHashMap(); if (refSampleVC.isIndel()) { pairModel = new PairHMMIndelErrorModel(UAC.INDEL_GAP_OPEN_PENALTY, UAC.INDEL_GAP_CONTINUATION_PENALTY, UAC.OUTPUT_DEBUG_INDEL_INFO, !UAC.DONT_DO_BANDED_INDEL_COMPUTATION); - haplotypeMap = new LinkedHashMap(); indelLikelihoodMap = new HashMap>(); IndelGenotypeLikelihoodsCalculationModel.getHaplotypeMapFromAlleles(refSampleVC.getAlleles(), refContext, refContext.getLocus(), haplotypeMap); // will update haplotypeMap adding elements } @@ -96,7 +96,8 @@ public class ErrorModel { final int readCounts[] = new int[refSamplePileup.getNumberOfElements()]; //perReadLikelihoods = new double[readCounts.length][refSampleVC.getAlleles().size()]; final int eventLength = IndelGenotypeLikelihoodsCalculationModel.getEventLength(refSampleVC.getAlleles()); - perReadLikelihoods = pairModel.computeGeneralReadHaplotypeLikelihoods(refSamplePileup,haplotypeMap,refContext, eventLength, indelLikelihoodMap, readCounts); + if (!haplotypeMap.isEmpty()) + perReadLikelihoods = pairModel.computeGeneralReadHaplotypeLikelihoods(refSamplePileup,haplotypeMap,refContext, eventLength, indelLikelihoodMap, readCounts); } int idx = 0; for (PileupElement refPileupElement : refSamplePileup) { @@ -108,7 +109,7 @@ public class ErrorModel { if (DEBUG) System.out.println(m); isMatch |= m; } - if (refSampleVC.isIndel()) { + if (refSampleVC.isIndel() && !haplotypeMap.isEmpty()) { // ignore match/mismatch if reads, as determined by their likelihood, are not informative double[] perAlleleLikelihoods = perReadLikelihoods[idx++]; if (!isInformativeElement(perAlleleLikelihoods)) @@ -173,10 +174,10 @@ public class ErrorModel { // if test allele is ref, any base mismatch, or any insertion/deletion at start of pileup count as mismatch if (allele.isReference()) { // for a ref allele, any base mismatch or new indel is a mismatch. - if(allele.getBases().length>0 ) + if(allele.getBases().length>0) // todo - can't check vs. allele because allele is not padded so it doesn't include the reference base at this location // could clean up/simplify this when unpadding is removed - return (pileupElement.getBase() == refBase); + return (pileupElement.getBase() == refBase && !pileupElement.isBeforeInsertion() && !pileupElement.isBeforeDeletionStart()); else // either null allele to compare, or ref/alt lengths are different (indel by definition). // if we have an indel that we are comparing against a REF allele, any indel presence (of any length/content) is a mismatch diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolAFCalculationModel.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyExactAFCalculationModel.java similarity index 95% rename from protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolAFCalculationModel.java rename to protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyExactAFCalculationModel.java index b8be24cad..ba19638e0 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolAFCalculationModel.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyExactAFCalculationModel.java @@ -34,7 +34,7 @@ import org.broadinstitute.sting.utils.variantcontext.*; import java.io.PrintStream; import java.util.*; -public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { +public class GeneralPloidyExactAFCalculationModel extends AlleleFrequencyCalculationModel { static final int MAX_LENGTH_FOR_POOL_PL_LOGGING = 10; // if PL vectors longer than this # of elements, don't log them final protected UnifiedArgumentCollection UAC; @@ -42,7 +42,7 @@ public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { private final static double MAX_LOG10_ERROR_TO_STOP_EARLY = 6; // we want the calculation to be accurate to 1 / 10^6 private final static boolean VERBOSE = false; - protected PoolAFCalculationModel(UnifiedArgumentCollection UAC, int N, Logger logger, PrintStream verboseWriter) { + protected GeneralPloidyExactAFCalculationModel(UnifiedArgumentCollection UAC, int N, Logger logger, PrintStream verboseWriter) { super(UAC, N, logger, verboseWriter); ploidy = UAC.samplePloidy; this.UAC = UAC; @@ -140,7 +140,7 @@ public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { for ( final double[] likelihoods : GLs ) { final int PLindexOfBestGL = MathUtils.maxElementIndex(likelihoods); - final int[] acCount = PoolGenotypeLikelihoods.getAlleleCountFromPLIndex(1+numOriginalAltAlleles,ploidy,PLindexOfBestGL); + final int[] acCount = GeneralPloidyGenotypeLikelihoods.getAlleleCountFromPLIndex(1 + numOriginalAltAlleles, ploidy, PLindexOfBestGL); // by convention, first count coming from getAlleleCountFromPLIndex comes from reference allele for (int k=1; k < acCount.length;k++) { if (acCount[k] > 0) @@ -238,7 +238,7 @@ public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { return newPool; } - // todo - refactor, function almost identical except for log10LofK computation in PoolGenotypeLikelihoods + // todo - refactor, function almost identical except for log10LofK computation in GeneralPloidyGenotypeLikelihoods /** * * @param set ExactACset holding conformation to be computed @@ -301,7 +301,7 @@ public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { continue; - PoolGenotypeLikelihoods.updateACset(ACcountsClone, ACqueue, indexesToACset); + GeneralPloidyGenotypeLikelihoods.updateACset(ACcountsClone, ACqueue, indexesToACset); } @@ -341,14 +341,14 @@ public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { // Say L1(K) = Pr(D|AC1=K) * choose(m1,K) // and L2(K) = Pr(D|AC2=K) * choose(m2,K) - PoolGenotypeLikelihoods.SumIterator firstIterator = new PoolGenotypeLikelihoods.SumIterator(numAlleles,ploidy1); + GeneralPloidyGenotypeLikelihoods.SumIterator firstIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy1); final double[] x = originalPool.getLikelihoodsAsVector(true); while(firstIterator.hasNext()) { x[firstIterator.getLinearIndex()] += MathUtils.log10MultinomialCoefficient(ploidy1,firstIterator.getCurrentVector()); firstIterator.next(); } - PoolGenotypeLikelihoods.SumIterator secondIterator = new PoolGenotypeLikelihoods.SumIterator(numAlleles,ploidy2); + GeneralPloidyGenotypeLikelihoods.SumIterator secondIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy2); final double[] y = yy.clone(); while(secondIterator.hasNext()) { y[secondIterator.getLinearIndex()] += MathUtils.log10MultinomialCoefficient(ploidy2,secondIterator.getCurrentVector()); @@ -357,7 +357,7 @@ public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { // initialize output to -log10(choose(m1+m2,[k1 k2...]) final int outputDim = GenotypeLikelihoods.numLikelihoods(numAlleles, newPloidy); - final PoolGenotypeLikelihoods.SumIterator outputIterator = new PoolGenotypeLikelihoods.SumIterator(numAlleles,newPloidy); + final GeneralPloidyGenotypeLikelihoods.SumIterator outputIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,newPloidy); // Now, result(K) = logSum_G (L1(G)+L2(K-G)) where G are all possible vectors that sum UP to K @@ -419,7 +419,7 @@ public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { double denom = -MathUtils.log10MultinomialCoefficient(newPloidy, currentCount); // for current conformation, get all possible ways to break vector K into two components G1 and G2 - final PoolGenotypeLikelihoods.SumIterator innerIterator = new PoolGenotypeLikelihoods.SumIterator(numAlleles,ploidy2); + final GeneralPloidyGenotypeLikelihoods.SumIterator innerIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy2); set.log10Likelihoods[0] = Double.NEGATIVE_INFINITY; while (innerIterator.hasNext()) { // check if breaking current conformation into g1 and g2 is feasible. @@ -617,7 +617,7 @@ public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { if ( numOriginalAltAlleles == numNewAltAlleles) { newLikelihoods = originalLikelihoods; } else { - newLikelihoods = PoolGenotypeLikelihoods.subsetToAlleles(originalLikelihoods, ploidy, vc.getAlleles(),allelesToUse); + newLikelihoods = GeneralPloidyGenotypeLikelihoods.subsetToAlleles(originalLikelihoods, ploidy, vc.getAlleles(), allelesToUse); // might need to re-normalize newLikelihoods = MathUtils.normalizeFromLog10(newLikelihoods, false, true); @@ -668,7 +668,7 @@ public class PoolAFCalculationModel extends AlleleFrequencyCalculationModel { // find the genotype with maximum likelihoods final int PLindex = numNewAltAlleles == 0 ? 0 : MathUtils.maxElementIndex(newLikelihoods); - final int[] mlAlleleCount = PoolGenotypeLikelihoods.getAlleleCountFromPLIndex(allelesToUse.size(), numChromosomes, PLindex); + final int[] mlAlleleCount = GeneralPloidyGenotypeLikelihoods.getAlleleCountFromPLIndex(allelesToUse.size(), numChromosomes, PLindex); final ArrayList alleleFreqs = new ArrayList(); final ArrayList alleleCounts = new ArrayList(); diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolGenotypeLikelihoods.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java similarity index 97% rename from protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolGenotypeLikelihoods.java rename to protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java index 438acbacd..6b0831323 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolGenotypeLikelihoods.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java @@ -37,7 +37,7 @@ import org.broadinstitute.sting.utils.variantcontext.GenotypeLikelihoods; import java.util.*; -public abstract class PoolGenotypeLikelihoods { +public abstract class GeneralPloidyGenotypeLikelihoods { protected final int numChromosomes; private final static double MAX_LOG10_ERROR_TO_STOP_EARLY = 6; // we want the calculation to be accurate to 1 / 10^6 @@ -67,8 +67,8 @@ public abstract class PoolGenotypeLikelihoods { private static final boolean FAST_GL_COMPUTATION = true; // constructor with given logPL elements - public PoolGenotypeLikelihoods(final List alleles, final double[] logLikelihoods, final int ploidy, - final HashMap perLaneErrorModels, final boolean ignoreLaneInformation) { + public GeneralPloidyGenotypeLikelihoods(final List alleles, final double[] logLikelihoods, final int ploidy, + final HashMap perLaneErrorModels, final boolean ignoreLaneInformation) { this.alleles = alleles; this.nAlleles = alleles.size(); numChromosomes = ploidy; @@ -101,7 +101,7 @@ public abstract class PoolGenotypeLikelihoods { Arrays.fill(log10Likelihoods, MIN_LIKELIHOOD); } else { if (logLikelihoods.length != likelihoodDim) - throw new ReviewedStingException("BUG: inconsistent parameters when creating PoolGenotypeLikelihoods object"); + throw new ReviewedStingException("BUG: inconsistent parameters when creating GeneralPloidyGenotypeLikelihoods object"); log10Likelihoods = logLikelihoods; //.clone(); // is clone needed? } @@ -174,7 +174,7 @@ public abstract class PoolGenotypeLikelihoods { final int numAlleles = currentState.length; final int ploidy = restrictSumTo; - linearIndex = PoolGenotypeLikelihoods.getLinearIndex(stateVector, numAlleles, ploidy); + linearIndex = GeneralPloidyGenotypeLikelihoods.getLinearIndex(stateVector, numAlleles, ploidy); } else throw new ReviewedStingException("BUG: Not supported"); @@ -308,7 +308,7 @@ public abstract class PoolGenotypeLikelihoods { public static double[] subsetToAlleles(final double[] oldLikelihoods, final int numChromosomes, final List originalAlleles, final List allelesToSubset) { - int newPLSize = PoolGenotypeLikelihoods.getNumLikelihoodElements(allelesToSubset.size(), numChromosomes); + int newPLSize = GeneralPloidyGenotypeLikelihoods.getNumLikelihoodElements(allelesToSubset.size(), numChromosomes); double[] newPLs = new double[newPLSize]; @@ -357,7 +357,7 @@ public abstract class PoolGenotypeLikelihoods { newCount[idx] = pVec[permutationKey[idx]]; // get corresponding index from new count - int outputIdx = PoolGenotypeLikelihoods.getLinearIndex(newCount, allelesToSubset.size(), numChromosomes); + int outputIdx = GeneralPloidyGenotypeLikelihoods.getLinearIndex(newCount, allelesToSubset.size(), numChromosomes); newPLs[outputIdx] = pl; if (VERBOSE) { System.out.println("Old Key:"+Arrays.toString(pVec)); diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolGenotypeLikelihoodsCalculationModel.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsCalculationModel.java similarity index 94% rename from protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolGenotypeLikelihoodsCalculationModel.java rename to protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsCalculationModel.java index 685091678..f6ce818be 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolGenotypeLikelihoodsCalculationModel.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsCalculationModel.java @@ -39,7 +39,7 @@ import org.broadinstitute.sting.utils.variantcontext.*; import java.util.*; -public abstract class PoolGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsCalculationModel { +public abstract class GeneralPloidyGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsCalculationModel { //protected Set laneIDs; public enum Model { @@ -52,7 +52,7 @@ public abstract class PoolGenotypeLikelihoodsCalculationModel extends GenotypeLi final protected UnifiedArgumentCollection UAC; - protected PoolGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) { + protected GeneralPloidyGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) { super(UAC,logger); this.UAC = UAC; @@ -137,11 +137,11 @@ public abstract class PoolGenotypeLikelihoodsCalculationModel extends GenotypeLi protected static class PoolGenotypeData { public final String name; - public final PoolGenotypeLikelihoods GL; + public final GeneralPloidyGenotypeLikelihoods GL; public final int depth; public final List alleles; - public PoolGenotypeData(final String name, final PoolGenotypeLikelihoods GL, final int depth, final List alleles) { + public PoolGenotypeData(final String name, final GeneralPloidyGenotypeLikelihoods GL, final int depth, final List alleles) { this.name = name; this.GL = GL; this.depth = depth; @@ -236,7 +236,7 @@ public abstract class PoolGenotypeLikelihoodsCalculationModel extends GenotypeLi ReadBackedPileup pileup = AlignmentContextUtils.stratify(sample.getValue(), contextType).getBasePileup(); // create the GenotypeLikelihoods object - final PoolGenotypeLikelihoods GL = getPoolGenotypeLikelihoodObject(allAlleles, null, UAC.samplePloidy, perLaneErrorModels, useBAQedPileup, ref, UAC.IGNORE_LANE_INFO); + final GeneralPloidyGenotypeLikelihoods GL = getPoolGenotypeLikelihoodObject(allAlleles, null, UAC.samplePloidy, perLaneErrorModels, useBAQedPileup, ref, UAC.IGNORE_LANE_INFO); // actually compute likelihoods final int nGoodBases = GL.add(pileup, UAC); if ( nGoodBases > 0 ) @@ -268,7 +268,7 @@ public abstract class PoolGenotypeLikelihoodsCalculationModel extends GenotypeLi for ( PoolGenotypeData sampleData : GLs ) { // extract from multidimensional array - final double[] myLikelihoods = PoolGenotypeLikelihoods.subsetToAlleles(sampleData.GL.getLikelihoods(),sampleData.GL.numChromosomes, + final double[] myLikelihoods = GeneralPloidyGenotypeLikelihoods.subsetToAlleles(sampleData.GL.getLikelihoods(), sampleData.GL.numChromosomes, allAlleles, alleles); // normalize in log space so that max element is zero. @@ -327,7 +327,7 @@ public abstract class PoolGenotypeLikelihoodsCalculationModel extends GenotypeLi Abstract methods - must be implemented in derived classes */ - protected abstract PoolGenotypeLikelihoods getPoolGenotypeLikelihoodObject(final List alleles, + protected abstract GeneralPloidyGenotypeLikelihoods getPoolGenotypeLikelihoodObject(final List alleles, final double[] logLikelihoods, final int ploidy, final HashMap perLaneErrorModels, diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolIndelGenotypeLikelihoods.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyIndelGenotypeLikelihoods.java similarity index 92% rename from protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolIndelGenotypeLikelihoods.java rename to protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyIndelGenotypeLikelihoods.java index 33b7b8b90..4f42f820e 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolIndelGenotypeLikelihoods.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyIndelGenotypeLikelihoods.java @@ -18,7 +18,7 @@ import java.util.*; * Time: 10:06 AM * To change this template use File | Settings | File Templates. */ -public class PoolIndelGenotypeLikelihoods extends PoolGenotypeLikelihoods { +public class GeneralPloidyIndelGenotypeLikelihoods extends GeneralPloidyGenotypeLikelihoods { final PairHMMIndelErrorModel pairModel; final LinkedHashMap haplotypeMap; final ReferenceContext refContext; @@ -27,14 +27,14 @@ public class PoolIndelGenotypeLikelihoods extends PoolGenotypeLikelihoods { final byte refBase; - public PoolIndelGenotypeLikelihoods(final List alleles, - final double[] logLikelihoods, - final int ploidy, - final HashMap perLaneErrorModels, - final boolean ignoreLaneInformation, - final PairHMMIndelErrorModel pairModel, - final LinkedHashMap haplotypeMap, - final ReferenceContext referenceContext) { + public GeneralPloidyIndelGenotypeLikelihoods(final List alleles, + final double[] logLikelihoods, + final int ploidy, + final HashMap perLaneErrorModels, + final boolean ignoreLaneInformation, + final PairHMMIndelErrorModel pairModel, + final LinkedHashMap haplotypeMap, + final ReferenceContext referenceContext) { super(alleles, logLikelihoods, ploidy, perLaneErrorModels, ignoreLaneInformation); this.pairModel = pairModel; this.haplotypeMap = haplotypeMap; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolIndelGenotypeLikelihoodsCalculationModel.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyIndelGenotypeLikelihoodsCalculationModel.java similarity index 89% rename from protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolIndelGenotypeLikelihoodsCalculationModel.java rename to protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyIndelGenotypeLikelihoodsCalculationModel.java index 1fef76116..f6559f666 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolIndelGenotypeLikelihoodsCalculationModel.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyIndelGenotypeLikelihoodsCalculationModel.java @@ -32,13 +32,11 @@ import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.indels.PairHMMIndelErrorModel; import org.broadinstitute.sting.utils.*; -import org.broadinstitute.sting.utils.collections.Pair; -import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.variantcontext.*; import java.util.*; -public class PoolIndelGenotypeLikelihoodsCalculationModel extends PoolGenotypeLikelihoodsCalculationModel { +public class GeneralPloidyIndelGenotypeLikelihoodsCalculationModel extends GeneralPloidyGenotypeLikelihoodsCalculationModel { private static final int MAX_NUM_ALLELES_TO_GENOTYPE = 4; private PairHMMIndelErrorModel pairModel; @@ -59,7 +57,7 @@ public class PoolIndelGenotypeLikelihoodsCalculationModel extends PoolGenotypeLi } */ - protected PoolIndelGenotypeLikelihoodsCalculationModel(final UnifiedArgumentCollection UAC, final Logger logger) { + protected GeneralPloidyIndelGenotypeLikelihoodsCalculationModel(final UnifiedArgumentCollection UAC, final Logger logger) { super(UAC, logger); @@ -69,14 +67,14 @@ public class PoolIndelGenotypeLikelihoodsCalculationModel extends PoolGenotypeLi } - protected PoolGenotypeLikelihoods getPoolGenotypeLikelihoodObject(final List alleles, + protected GeneralPloidyGenotypeLikelihoods getPoolGenotypeLikelihoodObject(final List alleles, final double[] logLikelihoods, final int ploidy, final HashMap perLaneErrorModels, final boolean useBQAedPileup, final ReferenceContext ref, final boolean ignoreLaneInformation){ - return new PoolIndelGenotypeLikelihoods(alleles, logLikelihoods, ploidy,perLaneErrorModels,ignoreLaneInformation, pairModel, haplotypeMap, ref); + return new GeneralPloidyIndelGenotypeLikelihoods(alleles, logLikelihoods, ploidy,perLaneErrorModels,ignoreLaneInformation, pairModel, haplotypeMap, ref); } protected List getInitialAllelesToUse(final RefMetaDataTracker tracker, @@ -96,6 +94,10 @@ public class PoolIndelGenotypeLikelihoodsCalculationModel extends PoolGenotypeLi haplotypeMap.clear(); } IndelGenotypeLikelihoodsCalculationModel.getHaplotypeMapFromAlleles(alleles, ref, ref.getLocus(), haplotypeMap); + + // sanity check: if haplotype map couldn't be created, clear allele list + if (haplotypeMap.isEmpty()) + alleles.clear(); return alleles; } diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolSNPGenotypeLikelihoods.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidySNPGenotypeLikelihoods.java similarity index 94% rename from protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolSNPGenotypeLikelihoods.java rename to protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidySNPGenotypeLikelihoods.java index 1e445270f..944372907 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolSNPGenotypeLikelihoods.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidySNPGenotypeLikelihoods.java @@ -5,6 +5,7 @@ import net.sf.samtools.SAMUtils; import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.baq.BAQ; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; @@ -22,7 +23,7 @@ import static java.lang.Math.pow; * and posteriors given a pile of bases and quality scores * */ -public class PoolSNPGenotypeLikelihoods extends PoolGenotypeLikelihoods/* implements Cloneable*/ { +public class GeneralPloidySNPGenotypeLikelihoods extends GeneralPloidyGenotypeLikelihoods/* implements Cloneable*/ { final List myAlleles; final int[] alleleIndices; @@ -41,14 +42,19 @@ public class PoolSNPGenotypeLikelihoods extends PoolGenotypeLikelihoods/* implem * @param useBQAedPileup Use BAQed pileup * @param ignoreLaneInformation If true, lane info is ignored */ - public PoolSNPGenotypeLikelihoods(final List alleles, final double[] logLikelihoods, final int ploidy, - final HashMap perLaneErrorModels, final boolean useBQAedPileup,final boolean ignoreLaneInformation) { + public GeneralPloidySNPGenotypeLikelihoods(final List alleles, final double[] logLikelihoods, final int ploidy, + final HashMap perLaneErrorModels, final boolean useBQAedPileup, final boolean ignoreLaneInformation) { super(alleles, logLikelihoods, ploidy, perLaneErrorModels, ignoreLaneInformation); this.useBAQedPileup = useBQAedPileup; myAlleles = new ArrayList(alleles); - refByte = alleles.get(0).getBases()[0]; // by construction, first allele in list is always ref! + Allele refAllele = alleles.get(0); + //sanity check: by construction, first allele should ALWAYS be the reference alleles + if (!refAllele.isReference()) + throw new ReviewedStingException("BUG: First allele in list passed to GeneralPloidySNPGenotypeLikelihoods should be reference!"); + + refByte = refAllele.getBases()[0]; // by construction, first allele in list is always ref! if (myAlleles.size() < BaseUtils.BASES.length) { // likelihood only defined for subset of possible alleles. Fill then with other alleles to have all possible ones, diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolSNPGenotypeLikelihoodsCalculationModel.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidySNPGenotypeLikelihoodsCalculationModel.java similarity index 91% rename from protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolSNPGenotypeLikelihoodsCalculationModel.java rename to protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidySNPGenotypeLikelihoodsCalculationModel.java index 61f505445..30d614455 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/PoolSNPGenotypeLikelihoodsCalculationModel.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidySNPGenotypeLikelihoodsCalculationModel.java @@ -35,22 +35,22 @@ import org.broadinstitute.sting.utils.variantcontext.*; import java.util.*; -public class PoolSNPGenotypeLikelihoodsCalculationModel extends PoolGenotypeLikelihoodsCalculationModel { +public class GeneralPloidySNPGenotypeLikelihoodsCalculationModel extends GeneralPloidyGenotypeLikelihoodsCalculationModel { - protected PoolSNPGenotypeLikelihoodsCalculationModel( UnifiedArgumentCollection UAC, Logger logger) { + protected GeneralPloidySNPGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) { super(UAC, logger); } - protected PoolGenotypeLikelihoods getPoolGenotypeLikelihoodObject(final List alleles, + protected GeneralPloidyGenotypeLikelihoods getPoolGenotypeLikelihoodObject(final List alleles, final double[] logLikelihoods, final int ploidy, final HashMap perLaneErrorModels, final boolean useBQAedPileup, final ReferenceContext ref, final boolean ignoreLaneInformation) { - return new PoolSNPGenotypeLikelihoods(alleles, null, UAC.samplePloidy, perLaneErrorModels, useBQAedPileup, UAC.IGNORE_LANE_INFO); + return new GeneralPloidySNPGenotypeLikelihoods(alleles, null, UAC.samplePloidy, perLaneErrorModels, useBQAedPileup, UAC.IGNORE_LANE_INFO); } protected List getInitialAllelesToUse(final RefMetaDataTracker tracker, diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java index 6bbfb0391..1ea7354cf 100755 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java @@ -241,6 +241,7 @@ public class HaplotypeCaller extends ActiveRegionWalker implem Set samples = SampleUtils.getSAMFileSamples(getToolkit().getSAMFileHeader()); samplesList.addAll( samples ); // initialize the UnifiedGenotyper Engine which is used to call into the exact model + UAC.GLmodel = GenotypeLikelihoodsCalculationModel.Model.SNP; // the GLmodel isn't used by the HaplotypeCaller but it is dangerous to let the user change this argument UG_engine = new UnifiedGenotyperEngine(getToolkit(), UAC.clone(), logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY); UAC.OutputMode = UnifiedGenotyperEngine.OUTPUT_MODE.EMIT_VARIANTS_ONLY; // low values used for isActive determination only, default/user-specified values used for actual calling UAC.GenotypingMode = GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.DISCOVERY; // low values used for isActive determination only, default/user-specified values used for actual calling diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/PoolAFCalculationModelUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyAFCalculationModelUnitTest.java similarity index 96% rename from protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/PoolAFCalculationModelUnitTest.java rename to protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyAFCalculationModelUnitTest.java index 5a6f7df0f..983f562d2 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/PoolAFCalculationModelUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyAFCalculationModelUnitTest.java @@ -19,7 +19,7 @@ import java.util.Arrays; * Time: 7:44 AM * To change this template use File | Settings | File Templates. */ -public class PoolAFCalculationModelUnitTest extends BaseTest { +public class GeneralPloidyAFCalculationModelUnitTest extends BaseTest { static double[] AA1, AB1, BB1; static double[] AA2, AB2, AC2, BB2, BC2, CC2; @@ -138,10 +138,10 @@ public class PoolAFCalculationModelUnitTest extends BaseTest { public void testGLs(GetGLsTest cfg) { final AlleleFrequencyCalculationResult result = new AlleleFrequencyCalculationResult(cfg.numAltAlleles); - final int len = PoolGenotypeLikelihoods.getNumLikelihoodElements(1+cfg.numAltAlleles,cfg.ploidy*cfg.GLs.size()); + final int len = GeneralPloidyGenotypeLikelihoods.getNumLikelihoodElements(1 + cfg.numAltAlleles, cfg.ploidy * cfg.GLs.size()); double[] priors = new double[len]; // flat priors - PoolAFCalculationModel.combineSinglePools(cfg.GLs, 1+cfg.numAltAlleles, cfg.ploidy, priors, result); + GeneralPloidyExactAFCalculationModel.combineSinglePools(cfg.GLs, 1 + cfg.numAltAlleles, cfg.ploidy, priors, result); int nameIndex = 1; for ( int allele = 0; allele < cfg.numAltAlleles; allele++, nameIndex+=2 ) { int expectedAlleleCount = Integer.valueOf(cfg.name.substring(nameIndex, nameIndex+1)); diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/PoolGenotypeLikelihoodsUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsUnitTest.java similarity index 90% rename from protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/PoolGenotypeLikelihoodsUnitTest.java rename to protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsUnitTest.java index 74abb6b11..f95ba66b2 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/PoolGenotypeLikelihoodsUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsUnitTest.java @@ -41,7 +41,7 @@ import java.io.PrintStream; import java.util.*; -public class PoolGenotypeLikelihoodsUnitTest { +public class GeneralPloidyGenotypeLikelihoodsUnitTest { final UnifiedArgumentCollection UAC = new UnifiedArgumentCollection(); final Logger logger = Logger.getLogger(Walker.class); @@ -60,7 +60,7 @@ public class PoolGenotypeLikelihoodsUnitTest { public void testStoringLikelihoodElements() { - // basic test storing a given PL vector in a PoolGenotypeLikelihoods object and then retrieving it back + // basic test storing a given PL vector in a GeneralPloidyGenotypeLikelihoods object and then retrieving it back int ploidy = 20; int numAlleles = 4; @@ -78,7 +78,7 @@ public class PoolGenotypeLikelihoodsUnitTest { for (int k=0; k < gls.length; k++) gls[k]= (double)k; - PoolGenotypeLikelihoods gl = new PoolSNPGenotypeLikelihoods(alleles, gls,ploidy, null, false,true); + GeneralPloidyGenotypeLikelihoods gl = new GeneralPloidySNPGenotypeLikelihoods(alleles, gls,ploidy, null, false,true); double[] glnew = gl.getLikelihoods(); Assert.assertEquals(gls, glnew); @@ -90,7 +90,7 @@ public class PoolGenotypeLikelihoodsUnitTest { for (int ploidy = 2; ploidy < 10; ploidy++) { for (int nAlleles = 2; nAlleles < 10; nAlleles++) - Assert.assertEquals(PoolGenotypeLikelihoods.getNumLikelihoodElements(nAlleles,ploidy), + Assert.assertEquals(GeneralPloidyGenotypeLikelihoods.getNumLikelihoodElements(nAlleles, ploidy), GenotypeLikelihoods.numLikelihoods(nAlleles, ploidy)); } @@ -102,7 +102,7 @@ public class PoolGenotypeLikelihoodsUnitTest { // create iterator, compare linear index given by iterator with closed form function int numAlleles = 4; int ploidy = 2; - PoolGenotypeLikelihoods.SumIterator iterator = new PoolGenotypeLikelihoods.SumIterator(numAlleles, ploidy); + GeneralPloidyGenotypeLikelihoods.SumIterator iterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles, ploidy); while(iterator.hasNext()) { System.out.format("\n%d:",iterator.getLinearIndex()); @@ -111,7 +111,7 @@ public class PoolGenotypeLikelihoodsUnitTest { System.out.format("%d ",aa); - int computedIdx = PoolGenotypeLikelihoods.getLinearIndex(a, numAlleles, ploidy); + int computedIdx = GeneralPloidyGenotypeLikelihoods.getLinearIndex(a, numAlleles, ploidy); System.out.format("Computed idx = %d\n",computedIdx); iterator.next(); } @@ -140,7 +140,7 @@ public class PoolGenotypeLikelihoodsUnitTest { allelesToSubset.add(Allele.create("A",false)); allelesToSubset.add(Allele.create("C",false)); - double[] newGLs = PoolGenotypeLikelihoods.subsetToAlleles(oldLikelihoods, ploidy, + double[] newGLs = GeneralPloidyGenotypeLikelihoods.subsetToAlleles(oldLikelihoods, ploidy, originalAlleles, allelesToSubset); @@ -170,7 +170,7 @@ public class PoolGenotypeLikelihoodsUnitTest { @Test public void testIndexIterator() { int[] seed = new int[]{1,2,3,4}; - PoolGenotypeLikelihoods.SumIterator iterator = runIterator(seed,-1); + GeneralPloidyGenotypeLikelihoods.SumIterator iterator = runIterator(seed,-1); // Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed)); Assert.assertEquals(iterator.getLinearIndex(),prod(seed)-1); @@ -228,12 +228,12 @@ public class PoolGenotypeLikelihoodsUnitTest { } - private PoolGenotypeLikelihoods.SumIterator runIterator(int[] seed, int restrictSumTo) { - PoolGenotypeLikelihoods.SumIterator iterator = new PoolGenotypeLikelihoods.SumIterator(seed, restrictSumTo); + private GeneralPloidyGenotypeLikelihoods.SumIterator runIterator(int[] seed, int restrictSumTo) { + GeneralPloidyGenotypeLikelihoods.SumIterator iterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(seed, restrictSumTo); while(iterator.hasNext()) { int[] a = iterator.getCurrentVector(); - int idx = PoolGenotypeLikelihoods.getLinearIndex(a, a.length, restrictSumTo); + int idx = GeneralPloidyGenotypeLikelihoods.getLinearIndex(a, a.length, restrictSumTo); if (VERBOSE) { System.out.format("%d:",iterator.getLinearIndex()); for (int i=0; i < seed.length; i++) @@ -289,13 +289,11 @@ public class PoolGenotypeLikelihoodsUnitTest { } - // TODO -- Guillermo, this test cannot work because the ArtificialReadPileupTestProvider returns a position of chr1:5, which is less than - // TODO -- HAPLOTYPE_SIZE in IndelGenotypeLikelihoodsCalculationModel.getHaplotypeMapFromAlleles() so the HaplotypeMap is not populated. - @Test (enabled = false) + @Test public void testIndelErrorModel() { final ArtificialReadPileupTestProvider refPileupTestProvider = new ArtificialReadPileupTestProvider(1,"ref"); final byte refByte = refPileupTestProvider.getRefByte(); - final String altBases = (char)refByte + "TCA"; + final String altBases = "TCA"; final String refSampleName = refPileupTestProvider.getSampleNames().get(0); final List trueAlleles = new ArrayList(); trueAlleles.add(Allele.create(refByte, true)); @@ -316,7 +314,7 @@ public class PoolGenotypeLikelihoodsUnitTest { // get artificial alignment context for ref sample - no noise // CASE 1: Test HET insertion // Ref sample has TC insertion but pileup will have TCA inserted instead to test mismatches - Map refContext = refPileupTestProvider.getAlignmentContextFromAlleles(altBases.length(), altBases, new int[]{matches, mismatches}, false, 30); + Map refContext = refPileupTestProvider.getAlignmentContextFromAlleles(1+altBases.length(), altBases, new int[]{matches, mismatches}, false, 30); final ReadBackedPileup refPileup = refContext.get(refSampleName).getBasePileup(); final ErrorModel emodel = new ErrorModel(UAC, refPileup, refInsertionVC, refPileupTestProvider.getReferenceContext()); final double[] errorVec = emodel.getErrorModelVector().getProbabilityVector(); @@ -393,6 +391,7 @@ public class PoolGenotypeLikelihoodsUnitTest { final byte refByte = readPileupTestProvider.getRefByte(); final byte altByte = refByte == (byte)'T'? (byte) 'C': (byte)'T'; + final List allAlleles = new ArrayList(); // this contains only ref Allele up to now final Set laneIDs = new TreeSet(); laneIDs.add(GenotypeLikelihoodsCalculationModel.DUMMY_LANE); @@ -409,23 +408,28 @@ public class PoolGenotypeLikelihoodsUnitTest { for (String laneID : laneIDs) noisyErrorModels.put(laneID, Q30ErrorModel); - final int refIdx = 0; - int altIdx = 2; - - // ref allele must be first - allAlleles.add(Allele.create(refByte, true)); + // all first ref allele + allAlleles.add(Allele.create(refByte,true)); for (byte b: BaseUtils.BASES) { - if (refByte != b) { - if (b == altByte) - altIdx = allAlleles.size(); + if (refByte != b) allAlleles.add(Allele.create(b, false)); - } } + final int refIdx = 0; + int altIdx = -1; + + for (int k=0; k < allAlleles.size(); k++) + if (altByte == allAlleles.get(k).getBases()[0]) { + altIdx = k; + break; + } + + + PrintStream out = null; if (SIMULATE_NOISY_PILEUP) { try { - out = new PrintStream(new File("/humgen/gsa-scr1/delangel/GATK/Sting_unstable_mac/GLUnitTest.table")); + out = new PrintStream(new File("GLUnitTest.table")); // out = new PrintStream(new File("/Users/delangel/GATK/Sting_unstable/GLUnitTest.table")); } catch (Exception e) {} @@ -449,7 +453,7 @@ public class PoolGenotypeLikelihoodsUnitTest { // get now likelihoods for this - final PoolSNPGenotypeLikelihoods GL = new PoolSNPGenotypeLikelihoods(allAlleles, null, nSamplesPerPool*2, noiselessErrorModels, false, true); + final GeneralPloidySNPGenotypeLikelihoods GL = new GeneralPloidySNPGenotypeLikelihoods(allAlleles, null, nSamplesPerPool*2, noiselessErrorModels, false, true); final int nGoodBases = GL.add(alignmentContextMap.get("sample0000").getBasePileup(), true, false, UAC.MIN_BASE_QUALTY_SCORE); if (VERBOSE) { System.out.format("Depth:%d, AC:%d, altDepth:%d, samplesPerPool:%d\nGLs:", depth,ac,altDepth, nSamplesPerPool); @@ -478,7 +482,7 @@ public class PoolGenotypeLikelihoodsUnitTest { // get now likelihoods for this - final PoolSNPGenotypeLikelihoods noisyGL = new PoolSNPGenotypeLikelihoods(allAlleles, null, nSamplesPerPool*2, noisyErrorModels, false,true); + final GeneralPloidySNPGenotypeLikelihoods noisyGL = new GeneralPloidySNPGenotypeLikelihoods(allAlleles, null, nSamplesPerPool*2, noisyErrorModels, false,true); noisyGL.add(noisyAlignmentContextMap.get("sample0000").getBasePileup(), true, false, UAC.MIN_BASE_QUALTY_SCORE); mlPair = noisyGL.getMostLikelyACCount(); diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/PoolCallerIntegrationTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidyIntegrationTest.java similarity index 76% rename from protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/PoolCallerIntegrationTest.java rename to protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidyIntegrationTest.java index c6b1a8b7f..9b3103274 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/PoolCallerIntegrationTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperGeneralPloidyIntegrationTest.java @@ -12,33 +12,33 @@ import org.testng.annotations.Test; * Time: 11:28 AM * To change this template use File | Settings | File Templates. */ -public class PoolCallerIntegrationTest extends WalkerTest { +public class UnifiedGenotyperGeneralPloidyIntegrationTest extends WalkerTest { final static String REF = b37KGReference; final String CEUTRIO_BAM = "/humgen/gsa-hpprojects/NA12878Collection/bams/CEUTrio.HiSeq.WGS.b37.list"; final String LSV_BAM = validationDataLocation +"93pools_NA12878_ref_chr20_40m_41m.bam"; final String REFSAMPLE_MT_CALLS = comparisonDataLocation + "Unvalidated/mtDNA/NA12878.snp.vcf"; final String REFSAMPLE_NAME = "NA12878"; - final String MTINTERVALS = "MT"; + final String MTINTERVALS = "MT:1-3000"; final String LSVINTERVALS = "20:40,000,000-41,000,000"; final String NA12891_CALLS = comparisonDataLocation + "Unvalidated/mtDNA/NA12891.snp.vcf"; final String NA12878_WG_CALLS = comparisonDataLocation + "Unvalidated/NA12878/CEUTrio.HiSeq.WGS.b37_decoy.recal.ts_95.snp_indel_combined.vcf"; final String LSV_ALLELES = validationDataLocation + "ALL.chr20_40m_41m.largeScaleValidationSites.vcf"; private void PC_MT_Test(String bam, String args, String name, String md5) { - final String base = String.format("-T UnifiedGenotyper -R %s -I %s -L %s --reference_sample_calls %s -refsample %s -glm POOLSNP -ignoreLane -pnrm POOL", + final String base = String.format("-T UnifiedGenotyper -dcov 10000 -R %s -I %s -L %s --reference_sample_calls %s -refsample %s -ignoreLane ", REF, bam, MTINTERVALS, REFSAMPLE_MT_CALLS, REFSAMPLE_NAME) + " --no_cmdline_in_header -o %s"; final WalkerTestSpec spec = new WalkerTestSpec(base + " " + args, Arrays.asList(md5)); executeTest("testPoolCaller:"+name+" args=" + args, spec); } private void PC_LSV_Test(String args, String name, String model, String md5) { - final String base = String.format("-T UnifiedGenotyper -R %s -I %s -L %s --reference_sample_calls %s -refsample %s -glm %s -ignoreLane -pnrm POOL", + final String base = String.format("-T UnifiedGenotyper -dcov 10000 -R %s -I %s -L %s --reference_sample_calls %s -refsample %s -glm %s -ignoreLane ", REF, LSV_BAM, LSVINTERVALS, NA12878_WG_CALLS, REFSAMPLE_NAME, model) + " --no_cmdline_in_header -o %s"; final WalkerTestSpec spec = new WalkerTestSpec(base + " " + args, Arrays.asList(md5)); executeTest("testPoolCaller:"+name+" args=" + args, spec); } private void PC_LSV_Test_NoRef(String args, String name, String model, String md5) { - final String base = String.format("-T UnifiedGenotyper -R %s -I %s -L %s -glm %s -ignoreLane -pnrm POOL", + final String base = String.format("-T UnifiedGenotyper -dcov 10000 -R %s -I %s -L %s -glm %s -ignoreLane", REF, LSV_BAM, LSVINTERVALS, model) + " --no_cmdline_in_header -o %s"; final WalkerTestSpec spec = new WalkerTestSpec(base + " " + args, Arrays.asList(md5)); executeTest("testPoolCaller:"+name+" args=" + args, spec); @@ -46,33 +46,33 @@ public class PoolCallerIntegrationTest extends WalkerTest { @Test public void testBOTH_GGA_Pools() { - PC_LSV_Test(String.format(" -maxAlleles 2 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -alleles %s",LSV_ALLELES),"LSV_BOTH_GGA","POOLBOTH","36b8db57f65be1cc3d2d9d7f9f3f26e4"); + PC_LSV_Test(String.format(" -maxAlleles 2 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",LSV_ALLELES),"LSV_BOTH_GGA","BOTH","d76e3b910259da819f1e1b2adc68ba8d"); } @Test public void testINDEL_GGA_Pools() { - PC_LSV_Test(String.format(" -maxAlleles 1 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -alleles %s",LSV_ALLELES),"LSV_INDEL_GGA","POOLINDEL","d1339990291648495bfcf4404f051478"); + PC_LSV_Test(String.format(" -maxAlleles 1 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",LSV_ALLELES),"LSV_INDEL_GGA","INDEL","ffadcdaee613dab975197bed0fc78da3"); } @Test public void testINDEL_maxAlleles2_ploidy3_Pools_noRef() { - PC_LSV_Test_NoRef(" -maxAlleles 2 -ploidy 3","LSV_INDEL_DISC_NOREF_p3","POOLINDEL","b66e7150603310fd57ee7bf9fc590706"); + PC_LSV_Test_NoRef(" -maxAlleles 2 -ploidy 3","LSV_INDEL_DISC_NOREF_p3","INDEL","96087fe9240e3656cc2a4e0ff0174d5b"); } @Test public void testINDEL_maxAlleles2_ploidy1_Pools_noRef() { - PC_LSV_Test_NoRef(" -maxAlleles 2 -ploidy 1","LSV_INDEL_DISC_NOREF_p1","POOLINDEL","ccdae3fc4d2c922f956a186aaad51c29"); + PC_LSV_Test_NoRef(" -maxAlleles 2 -ploidy 1","LSV_INDEL_DISC_NOREF_p1","INDEL","6fdae7093831ecfc82a06dd707d62fe9"); } @Test public void testMT_SNP_DISCOVERY_sp4() { - PC_MT_Test(CEUTRIO_BAM, " -maxAlleles 1 -ploidy 8", "MT_SNP_DISCOVERY_sp4","fa5ee7c957c473a80f3a7f3c35dc80b5"); + PC_MT_Test(CEUTRIO_BAM, " -maxAlleles 1 -ploidy 8", "MT_SNP_DISCOVERY_sp4","6b27634214530d379db70391a9cfc2d7"); } @Test public void testMT_SNP_GGA_sp10() { - PC_MT_Test(CEUTRIO_BAM, String.format(" -maxAlleles 1 -ploidy 20 -gt_mode GENOTYPE_GIVEN_ALLELES -alleles %s",NA12891_CALLS), "MT_SNP_GGA_sp10", "6907c8617d49bb57b33f8704ce7f0323"); + PC_MT_Test(CEUTRIO_BAM, String.format(" -maxAlleles 1 -ploidy 20 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",NA12891_CALLS), "MT_SNP_GGA_sp10", "e74d4c73ece45d7fb676b99364df4f1a"); } } diff --git a/public/R/scripts/org/broadinstitute/sting/gatk/walkers/bqsr/BQSR.R b/public/R/scripts/org/broadinstitute/sting/utils/recalibration/BQSR.R similarity index 99% rename from public/R/scripts/org/broadinstitute/sting/gatk/walkers/bqsr/BQSR.R rename to public/R/scripts/org/broadinstitute/sting/utils/recalibration/BQSR.R index fd301cd97..6c4dace1d 100644 --- a/public/R/scripts/org/broadinstitute/sting/gatk/walkers/bqsr/BQSR.R +++ b/public/R/scripts/org/broadinstitute/sting/utils/recalibration/BQSR.R @@ -1,4 +1,5 @@ library("ggplot2") +library("tools") #For compactPDF in R 2.13+ args <- commandArgs(TRUE) data <- read.csv(args[1]) diff --git a/public/java/src/org/broadinstitute/sting/gatk/CommandLineGATK.java b/public/java/src/org/broadinstitute/sting/gatk/CommandLineGATK.java index 306ebdd0e..312d31727 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/CommandLineGATK.java +++ b/public/java/src/org/broadinstitute/sting/gatk/CommandLineGATK.java @@ -130,12 +130,12 @@ public class CommandLineGATK extends CommandLineExecutable { // can't close tribble index when writing if ( message.indexOf("Unable to close index for") != -1 ) - exitSystemWithUserError(new UserException(t.getCause().getMessage())); + exitSystemWithUserError(new UserException(t.getCause() == null ? message : t.getCause().getMessage())); // disk is full if ( message.indexOf("No space left on device") != -1 ) exitSystemWithUserError(new UserException(t.getMessage())); - if ( t.getCause().getMessage().indexOf("No space left on device") != -1 ) + if ( t.getCause() != null && t.getCause().getMessage().indexOf("No space left on device") != -1 ) exitSystemWithUserError(new UserException(t.getCause().getMessage())); } diff --git a/public/java/src/org/broadinstitute/sting/gatk/GenomeAnalysisEngine.java b/public/java/src/org/broadinstitute/sting/gatk/GenomeAnalysisEngine.java index eab9fde79..56fcf0652 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/GenomeAnalysisEngine.java +++ b/public/java/src/org/broadinstitute/sting/gatk/GenomeAnalysisEngine.java @@ -274,6 +274,38 @@ public class GenomeAnalysisEngine { //return result; } + // TODO -- Let's move this to a utility class in unstable - but which one? + // ************************************************************************************** + // * Handle Deprecated Walkers * + // ************************************************************************************** + + // Mapping from walker name to major version number where the walker first disappeared + private static Map deprecatedGATKWalkers = new HashMap(); + static { + deprecatedGATKWalkers.put("CountCovariates", "2.0"); + deprecatedGATKWalkers.put("TableRecalibration", "2.0"); + } + + /** + * Utility method to check whether a given walker has been deprecated in a previous GATK release + * + * @param walkerName the walker class name (not the full package) to check + */ + public static boolean isDeprecatedWalker(final String walkerName) { + return deprecatedGATKWalkers.containsKey(walkerName); + } + + /** + * Utility method to check whether a given walker has been deprecated in a previous GATK release + * + * @param walkerName the walker class name (not the full package) to check + */ + public static String getDeprecatedMajorVersionNumber(final String walkerName) { + return deprecatedGATKWalkers.get(walkerName); + } + + // ************************************************************************************** + /** * Retrieves an instance of the walker based on the walker name. * @@ -287,6 +319,9 @@ public class GenomeAnalysisEngine { if ( isGATKLite() && GATKLiteUtils.isAvailableOnlyInFullGATK(walkerName) ) { e = new UserException.NotSupportedInGATKLite("the " + walkerName + " walker is available only in the full version of the GATK"); } + else if ( isDeprecatedWalker(walkerName) ) { + e = new UserException.DeprecatedWalker(walkerName, getDeprecatedMajorVersionNumber(walkerName)); + } throw e; } } @@ -762,6 +797,14 @@ public class GenomeAnalysisEngine { if ( getWalkerBAQApplicationTime() == BAQ.ApplicationTime.FORBIDDEN && argCollection.BAQMode != BAQ.CalculationMode.OFF) throw new UserException.BadArgumentValue("baq", "Walker cannot accept BAQ'd base qualities, and yet BAQ mode " + argCollection.BAQMode + " was requested."); + if (argCollection.removeProgramRecords && argCollection.keepProgramRecords) + throw new UserException.BadArgumentValue("rpr / kpr", "Cannot enable both options"); + + boolean removeProgramRecords = argCollection.removeProgramRecords || walker.getClass().isAnnotationPresent(RemoveProgramRecords.class); + + if (argCollection.keepProgramRecords) + removeProgramRecords = false; + return new SAMDataSource( samReaderIDs, threadAllocation, @@ -778,7 +821,8 @@ public class GenomeAnalysisEngine { getWalkerBAQQualityMode(), refReader, getBaseRecalibration(), - argCollection.defaultBaseQualities); + argCollection.defaultBaseQualities, + removeProgramRecords); } /** diff --git a/public/java/src/org/broadinstitute/sting/gatk/arguments/GATKArgumentCollection.java b/public/java/src/org/broadinstitute/sting/gatk/arguments/GATKArgumentCollection.java index 3fd3857c5..972116952 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/arguments/GATKArgumentCollection.java +++ b/public/java/src/org/broadinstitute/sting/gatk/arguments/GATKArgumentCollection.java @@ -249,6 +249,12 @@ public class GATKArgumentCollection { @Argument(fullName = "validation_strictness", shortName = "S", doc = "How strict should we be with validation", required = false) public SAMFileReader.ValidationStringency strictnessLevel = SAMFileReader.ValidationStringency.SILENT; + @Argument(fullName = "remove_program_records", shortName = "rpr", doc = "Should we override the Walker's default and remove program records from the SAM header", required = false) + public boolean removeProgramRecords = false; + + @Argument(fullName = "keep_program_records", shortName = "kpr", doc = "Should we override the Walker's default and keep program records from the SAM header", required = false) + public boolean keepProgramRecords = false; + @Argument(fullName = "unsafe", shortName = "U", doc = "If set, enables unsafe operations: nothing will be checked at runtime. For expert users only who know what they are doing. We do not support usage of this argument.", required = false) public ValidationExclusion.TYPE unsafe; diff --git a/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSource.java b/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSource.java index 0fa4234b3..7f0a0c4c0 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSource.java +++ b/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSource.java @@ -89,6 +89,11 @@ public class SAMDataSource { */ private final SAMFileReader.ValidationStringency validationStringency; + /** + * Do we want to remove the program records from this data source? + */ + private final boolean removeProgramRecords; + /** * Store BAM indices for each reader present. */ @@ -200,7 +205,8 @@ public class SAMDataSource { BAQ.QualityMode.DONT_MODIFY, null, // no BAQ null, // no BQSR - (byte) -1); + (byte) -1, + false); } /** @@ -233,7 +239,8 @@ public class SAMDataSource { BAQ.QualityMode qmode, IndexedFastaSequenceFile refReader, BaseRecalibration bqsrApplier, - byte defaultBaseQualities) { + byte defaultBaseQualities, + boolean removeProgramRecords) { this.readMetrics = new ReadMetrics(); this.genomeLocParser = genomeLocParser; @@ -249,6 +256,7 @@ public class SAMDataSource { dispatcher = null; validationStringency = strictness; + this.removeProgramRecords = removeProgramRecords; if(readBufferSize != null) ReadShard.setReadBufferSize(readBufferSize); else { @@ -748,7 +756,7 @@ public class SAMDataSource { private synchronized void createNewResource() { if(allResources.size() > maxEntries) throw new ReviewedStingException("Cannot create a new resource pool. All resources are in use."); - SAMReaders readers = new SAMReaders(readerIDs, validationStringency); + SAMReaders readers = new SAMReaders(readerIDs, validationStringency, removeProgramRecords); allResources.add(readers); availableResources.add(readers); } @@ -777,9 +785,11 @@ public class SAMDataSource { /** * Derive a new set of readers from the Reads metadata. * @param readerIDs reads to load. + * TODO: validationStringency is not used here * @param validationStringency validation stringency. + * @param removeProgramRecords indicate whether to clear program records from the readers */ - public SAMReaders(Collection readerIDs, SAMFileReader.ValidationStringency validationStringency) { + public SAMReaders(Collection readerIDs, SAMFileReader.ValidationStringency validationStringency, boolean removeProgramRecords) { final int totalNumberOfFiles = readerIDs.size(); int readerNumber = 1; final SimpleTimer timer = new SimpleTimer().start(); @@ -790,6 +800,9 @@ public class SAMDataSource { long lastTick = timer.currentTime(); for(final SAMReaderID readerID: readerIDs) { final ReaderInitializer init = new ReaderInitializer(readerID).call(); + if (removeProgramRecords) { + init.reader.getFileHeader().setProgramRecords(new ArrayList()); + } if (threadAllocation.getNumIOThreads() > 0) { inputStreams.put(init.readerID, init.blockInputStream); // get from initializer } diff --git a/public/java/src/org/broadinstitute/sting/gatk/io/storage/SAMFileWriterStorage.java b/public/java/src/org/broadinstitute/sting/gatk/io/storage/SAMFileWriterStorage.java index cb8786be1..300e801e6 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/io/storage/SAMFileWriterStorage.java +++ b/public/java/src/org/broadinstitute/sting/gatk/io/storage/SAMFileWriterStorage.java @@ -62,6 +62,7 @@ public class SAMFileWriterStorage implements SAMFileWriter, Storage extends Walker { @Output(fullName="activeRegionOut", shortName="ARO", doc="Output the active region to this interval list file", required = false) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/LocusWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/LocusWalker.java index e94d01d5a..2a92d8831 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/LocusWalker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/LocusWalker.java @@ -19,6 +19,7 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; @Requires({DataSource.READS,DataSource.REFERENCE, DataSource.REFERENCE_BASES}) @PartitionBy(PartitionType.LOCUS) @ReadFilters({UnmappedReadFilter.class,NotPrimaryAlignmentFilter.class,DuplicateReadFilter.class,FailsVendorQualityCheckFilter.class}) +@RemoveProgramRecords public abstract class LocusWalker extends Walker { // Do we actually want to operate on the context? public boolean filter(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/RemoveProgramRecords.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/RemoveProgramRecords.java new file mode 100644 index 000000000..d9abc7925 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/RemoveProgramRecords.java @@ -0,0 +1,21 @@ +package org.broadinstitute.sting.gatk.walkers; + +/** + * Created with IntelliJ IDEA. + * User: thibault + * Date: 8/2/12 + * Time: 1:58 PM + * To change this template use File | Settings | File Templates. + */ + +import java.lang.annotation.*; + +/** + * Indicates that program records should be removed from SAM headers by default for this walker + */ +@Documented +@Inherited +@Retention(RetentionPolicy.RUNTIME) +@Target(ElementType.TYPE) +public @interface RemoveProgramRecords { +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BQSRGatherer.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BQSRGatherer.java index 122958ac2..a6d82d5b3 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BQSRGatherer.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BQSRGatherer.java @@ -28,6 +28,8 @@ package org.broadinstitute.sting.gatk.walkers.bqsr; import org.broadinstitute.sting.commandline.Gatherer; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; +import org.broadinstitute.sting.utils.recalibration.RecalUtils; +import org.broadinstitute.sting.utils.recalibration.RecalibrationReport; import java.io.File; import java.io.FileNotFoundException; @@ -71,11 +73,11 @@ public class BQSRGatherer extends Gatherer { if (RAC.recalibrationReport != null && !RAC.NO_PLOTS) { final File recal_out = new File(output.getName() + ".original"); final RecalibrationReport originalReport = new RecalibrationReport(RAC.recalibrationReport); - RecalDataManager.generateRecalibrationPlot(recal_out, originalReport.getRecalibrationTables(), generalReport.getRecalibrationTables(), generalReport.getCovariates(), RAC.KEEP_INTERMEDIATE_FILES); + RecalUtils.generateRecalibrationPlot(recal_out, originalReport.getRecalibrationTables(), generalReport.getRecalibrationTables(), generalReport.getCovariates(), RAC.KEEP_INTERMEDIATE_FILES); } else if (!RAC.NO_PLOTS) { final File recal_out = new File(output.getName() + ".recal"); - RecalDataManager.generateRecalibrationPlot(recal_out, generalReport.getRecalibrationTables(), generalReport.getCovariates(), RAC.KEEP_INTERMEDIATE_FILES); + RecalUtils.generateRecalibrationPlot(recal_out, generalReport.getRecalibrationTables(), generalReport.getCovariates(), RAC.KEEP_INTERMEDIATE_FILES); } generalReport.output(outputFile); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java index b2400a49d..512434e6d 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java @@ -34,6 +34,7 @@ import org.broadinstitute.sting.gatk.filters.MappingQualityUnavailableFilter; import org.broadinstitute.sting.gatk.filters.MappingQualityZeroFilter; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.*; +import org.broadinstitute.sting.utils.recalibration.covariates.Covariate; import org.broadinstitute.sting.utils.baq.BAQ; import org.broadinstitute.sting.utils.classloader.GATKLiteUtils; import org.broadinstitute.sting.utils.collections.Pair; @@ -41,6 +42,9 @@ import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import org.broadinstitute.sting.utils.pileup.PileupElement; +import org.broadinstitute.sting.utils.recalibration.QuantizationInfo; +import org.broadinstitute.sting.utils.recalibration.RecalUtils; +import org.broadinstitute.sting.utils.recalibration.RecalibrationReport; import org.broadinstitute.sting.utils.recalibration.RecalibrationTables; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.ReadUtils; @@ -58,7 +62,7 @@ import java.util.ArrayList; * This walker is designed to work as the first pass in a two-pass processing step. It does a by-locus traversal operating * only at sites that are not in dbSNP. We assume that all reference mismatches we see are therefore errors and indicative * of poor base quality. This walker generates tables based on various user-specified covariates (such as read group, - * reported quality score, cycle, and dinucleotide). Since there is a large amount of data one can then calculate an empirical + * reported quality score, cycle, and context). Since there is a large amount of data one can then calculate an empirical * probability of error given the particular covariates seen at this site, where p(error) = num mismatches / num observations. * The output file is a table (of the several covariate values, num observations, num mismatches, empirical quality score). *

@@ -90,7 +94,7 @@ import java.util.ArrayList; *

Examples

*
  * java -Xmx4g -jar GenomeAnalysisTK.jar \
- *   -T BaseQualityScoreRecalibrator \
+ *   -T BaseRecalibrator \
  *   -I my_reads.bam \
  *   -R resources/Homo_sapiens_assembly18.fasta \
  *   -knownSites bundle/hg18/dbsnp_132.hg18.vcf \
@@ -109,7 +113,7 @@ public class BaseRecalibrator extends LocusWalker implements TreeRed
     @ArgumentCollection
     private final RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection();                          // all the command line arguments for BQSR and it's covariates
 
-    private QuantizationInfo quantizationInfo;                                                                          // an object that keeps track of the information necessary for quality score quantization 
+    private QuantizationInfo quantizationInfo;                                                                          // an object that keeps track of the information necessary for quality score quantization
     
     private RecalibrationTables recalibrationTables;
 
@@ -143,12 +147,12 @@ public class BaseRecalibrator extends LocusWalker implements TreeRed
             throw new UserException.CommandLineException(NO_DBSNP_EXCEPTION);
 
         if (RAC.LIST_ONLY) {
-            RecalDataManager.listAvailableCovariates(logger);
+            RecalUtils.listAvailableCovariates(logger);
             System.exit(0);
         }
         RAC.recalibrationReport = getToolkit().getArguments().BQSR_RECAL_FILE;                                          // if we have a recalibration file, record it so it goes on the report table
 
-        Pair, ArrayList> covariates = RecalDataManager.initializeCovariates(RAC);       // initialize the required and optional covariates
+        Pair, ArrayList> covariates = RecalUtils.initializeCovariates(RAC);       // initialize the required and optional covariates
         ArrayList requiredCovariates = covariates.getFirst();
         ArrayList optionalCovariates = covariates.getSecond();
 
@@ -222,17 +226,17 @@ public class BaseRecalibrator extends LocusWalker implements TreeRed
 
                 if (readNotSeen(read)) {
                     read.setTemporaryAttribute(SEEN_ATTRIBUTE, true);
-                    RecalDataManager.parsePlatformForRead(read, RAC);
-                    if (RecalDataManager.isColorSpaceConsistent(RAC.SOLID_NOCALL_STRATEGY, read)) {
+                    RecalUtils.parsePlatformForRead(read, RAC);
+                    if (RecalUtils.isColorSpaceConsistent(RAC.SOLID_NOCALL_STRATEGY, read)) {
                         read.setTemporaryAttribute(SKIP_RECORD_ATTRIBUTE, true);
                         continue;
                     }
-                    read.setTemporaryAttribute(COVARS_ATTRIBUTE, RecalDataManager.computeCovariates(read, requestedCovariates));
+                    read.setTemporaryAttribute(COVARS_ATTRIBUTE, RecalUtils.computeCovariates(read, requestedCovariates));
                 }
 
                 if (!ReadUtils.isSOLiDRead(read) ||                                                                     // SOLID bams have inserted the reference base into the read if the color space in inconsistent with the read base so skip it
-                    RAC.SOLID_RECAL_MODE == RecalDataManager.SOLID_RECAL_MODE.DO_NOTHING ||
-                        RecalDataManager.isColorSpaceConsistent(read, offset))
+                    RAC.SOLID_RECAL_MODE == RecalUtils.SOLID_RECAL_MODE.DO_NOTHING ||
+                        RecalUtils.isColorSpaceConsistent(read, offset))
                     recalibrationEngine.updateDataForPileupElement(p, ref.getBase());                                                             // This base finally passed all the checks for a good base, so add it to the big data hashmap
             }
             countedSites++;
@@ -271,13 +275,16 @@ public class BaseRecalibrator extends LocusWalker implements TreeRed
     public void onTraversalDone(Long result) {
         logger.info("Calculating quantized quality scores...");
         quantizeQualityScores();
+
+        logger.info("Writing recalibration report...");
+        generateReport();
+        logger.info("...done!");
+
         if (!RAC.NO_PLOTS) {
             logger.info("Generating recalibration plots...");
             generatePlots();
         }
-        logger.info("Writing recalibration report...");
-        generateReport();
-        logger.info("...done!");
+
         logger.info("Processed: " + result + " sites");
     }
 
@@ -285,10 +292,10 @@ public class BaseRecalibrator extends LocusWalker implements TreeRed
         File recalFile = getToolkit().getArguments().BQSR_RECAL_FILE;
         if (recalFile != null) {
             RecalibrationReport report = new RecalibrationReport(recalFile);
-            RecalDataManager.generateRecalibrationPlot(RAC.RECAL_FILE, report.getRecalibrationTables(), recalibrationTables, requestedCovariates, RAC.KEEP_INTERMEDIATE_FILES);
+            RecalUtils.generateRecalibrationPlot(RAC.RECAL_FILE, report.getRecalibrationTables(), recalibrationTables, requestedCovariates, RAC.KEEP_INTERMEDIATE_FILES);
         }
         else
-            RecalDataManager.generateRecalibrationPlot(RAC.RECAL_FILE, recalibrationTables, requestedCovariates, RAC.KEEP_INTERMEDIATE_FILES);
+            RecalUtils.generateRecalibrationPlot(RAC.RECAL_FILE, recalibrationTables, requestedCovariates, RAC.KEEP_INTERMEDIATE_FILES);
     }
 
 
@@ -309,7 +316,7 @@ public class BaseRecalibrator extends LocusWalker implements TreeRed
             throw new UserException.CouldNotCreateOutputFile(RAC.RECAL_FILE, "could not be created");
         }
 
-        RecalDataManager.outputRecalibrationReport(RAC, quantizationInfo, recalibrationTables, requestedCovariates, output);
+        RecalUtils.outputRecalibrationReport(RAC, quantizationInfo, recalibrationTables, requestedCovariates, output);
     }
 }
 
diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/Datum.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/Datum.java
deleted file mode 100644
index d7e8e16b5..000000000
--- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/Datum.java
+++ /dev/null
@@ -1,109 +0,0 @@
-package org.broadinstitute.sting.gatk.walkers.bqsr;
-
-import org.broadinstitute.sting.utils.QualityUtils;
-
-/*
- * Copyright (c) 2010 The Broad Institute
- *
- * Permission is hereby granted, free of charge, to any person
- * obtaining a copy of this software and associated documentation
- * files (the "Software"), to deal in the Software without
- * restriction, including without limitation the rights to use,
- * copy, modify, merge, publish, distribute, sublicense, and/or sell
- * copies of the Software, and to permit persons to whom the
- * Software is furnished to do so, subject to the following
- * conditions:
- *
- * The above copyright notice and this permission notice shall be
- * included in all copies or substantial portions of the Software.
- *
- * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
- * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
- * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
- * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
- * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
- * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
- * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
- * OTHER DEALINGS IN THE SOFTWARE.
- */
-
-/**
- * Created by IntelliJ IDEA.
- * User: rpoplin
- * Date: Jan 6, 2010
- *
- * An individual piece of recalibration data. Optimized for CountCovariates. Extras added to make TableRecalibration fast have been removed.
- * Each bin counts up the number of observations and the number of reference mismatches seen for that combination of covariates.
- */
-
-public class Datum {
-
-    long numObservations;                                                                                     // number of bases seen in total
-    long numMismatches;                                                                                       // number of bases seen that didn't match the reference
-
-    private static final int SMOOTHING_CONSTANT = 1;                                                                    // used when calculating empirical qualities to avoid division by zero
-
-    //---------------------------------------------------------------------------------------------------------------
-    //
-    // constructors
-    //
-    //---------------------------------------------------------------------------------------------------------------
-
-    public Datum() {
-        numObservations = 0L;
-        numMismatches = 0L;
-    }
-
-    public Datum(long numObservations, long numMismatches) {
-        this.numObservations = numObservations;
-        this.numMismatches = numMismatches;
-    }
-
-    //---------------------------------------------------------------------------------------------------------------
-    //
-    // increment methods
-    //
-    //---------------------------------------------------------------------------------------------------------------
-
-    synchronized void increment(final long incObservations, final long incMismatches) {
-        numObservations += incObservations;
-        numMismatches += incMismatches;
-    }
-
-    synchronized void increment(final boolean isError) {
-        numObservations++;
-        numMismatches += isError ? 1:0;
-    }
-
-    //---------------------------------------------------------------------------------------------------------------
-    //
-    // methods to derive empirical quality score
-    //
-    //---------------------------------------------------------------------------------------------------------------
-
-    double empiricalQualDouble() {
-        final double doubleMismatches = (double) (numMismatches + SMOOTHING_CONSTANT);
-        final double doubleObservations = (double) (numObservations + SMOOTHING_CONSTANT + SMOOTHING_CONSTANT); // smoothing is one error and one non-error observation, for example
-        final double empiricalQual = -10 * Math.log10(doubleMismatches / doubleObservations);
-        return Math.min(empiricalQual, (double) QualityUtils.MAX_RECALIBRATED_Q_SCORE);
-    }
-
-    byte empiricalQualByte() {
-        final double doubleMismatches = (double) (numMismatches);
-        final double doubleObservations = (double) (numObservations);
-        return QualityUtils.probToQual(1.0 - doubleMismatches / doubleObservations);                                    // This is capped at Q40
-    }
-
-    @Override
-    public String toString() {
-        return String.format("%d,%d,%d", numObservations, numMismatches, (int) empiricalQualByte());
-    }
-
-    @Override
-    public boolean equals(Object o) {
-        if (!(o instanceof Datum))
-            return false;
-        Datum other = (Datum) o;
-        return numMismatches == other.numMismatches && numObservations == other.numObservations;
-    }
-}
diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalDatum.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalDatum.java
deleted file mode 100755
index 9b00b1876..000000000
--- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalDatum.java
+++ /dev/null
@@ -1,148 +0,0 @@
-package org.broadinstitute.sting.gatk.walkers.bqsr;
-
-/*
- * Copyright (c) 2009 The Broad Institute
- *
- * Permission is hereby granted, free of charge, to any person
- * obtaining a copy of this software and associated documentation
- * files (the "Software"), to deal in the Software without
- * restriction, including without limitation the rights to use,
- * copy, modify, merge, publish, distribute, sublicense, and/or sell
- * copies of the Software, and to permit persons to whom the
- * Software is furnished to do so, subject to the following
- * conditions:
- *
- * The above copyright notice and this permission notice shall be
- * included in all copies or substantial portions of the Software.
- *
- * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
- * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
- * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
- * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
- * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
- * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
- * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
- * OTHER DEALINGS IN THE SOFTWARE.
- */
-
-import com.google.java.contract.Ensures;
-import com.google.java.contract.Requires;
-import org.broadinstitute.sting.utils.MathUtils;
-import org.broadinstitute.sting.utils.QualityUtils;
-
-import java.util.Random;
-
-/**
- * Created by IntelliJ IDEA.
- * User: rpoplin
- * Date: Nov 3, 2009
- *
- * An individual piece of recalibration data. Each bin counts up the number of observations and the number of reference mismatches seen for that combination of covariates.
- */
-
-public class RecalDatum extends Datum {
-
-    private static final double UNINITIALIZED = -1.0;
-
-    private double estimatedQReported;                                                                                  // estimated reported quality score based on combined data's individual q-reporteds and number of observations
-    private double empiricalQuality;                                                                                    // the empirical quality for datums that have been collapsed together (by read group and reported quality, for example)
-
-
-    //---------------------------------------------------------------------------------------------------------------
-    //
-    // constructors
-    //
-    //---------------------------------------------------------------------------------------------------------------
-
-    public RecalDatum(final long _numObservations, final long _numMismatches, final byte reportedQuality) {
-        numObservations = _numObservations;
-        numMismatches = _numMismatches;
-        estimatedQReported = reportedQuality;
-        empiricalQuality = UNINITIALIZED;
-    }
-
-    public RecalDatum(final RecalDatum copy) {
-        this.numObservations = copy.numObservations;
-        this.numMismatches = copy.numMismatches;
-        this.estimatedQReported = copy.estimatedQReported;
-        this.empiricalQuality = copy.empiricalQuality;
-    }
-
-    public void combine(final RecalDatum other) {
-        final double sumErrors = this.calcExpectedErrors() + other.calcExpectedErrors();
-        increment(other.numObservations, other.numMismatches);
-        estimatedQReported = -10 * Math.log10(sumErrors / this.numObservations);
-        empiricalQuality = UNINITIALIZED;
-    }
-
-    @Override
-    public void increment(final boolean isError) {
-        super.increment(isError);
-        empiricalQuality = UNINITIALIZED;
-    }
-
-    @Requires("empiricalQuality == UNINITIALIZED")
-    @Ensures("empiricalQuality != UNINITIALIZED")
-    protected final void calcEmpiricalQuality() {
-        empiricalQuality = empiricalQualDouble();                                                                       // cache the value so we don't call log over and over again
-    }
-
-    public void setEstimatedQReported(final double estimatedQReported) {
-        this.estimatedQReported = estimatedQReported;
-    }
-
-    public final double getEstimatedQReported() {
-        return estimatedQReported;
-    }
-
-    public void setEmpiricalQuality(final double empiricalQuality) {
-        this.empiricalQuality = empiricalQuality;
-    }
-
-    public final double getEmpiricalQuality() {
-        if (empiricalQuality == UNINITIALIZED)
-            calcEmpiricalQuality();
-        return empiricalQuality;
-    }
-
-    @Override
-    public String toString() {
-        return String.format("%d,%d,%d", numObservations, numMismatches, (byte) Math.floor(getEmpiricalQuality()));
-    }
-
-    public String stringForCSV() {
-        return String.format("%s,%d,%.2f", toString(), (byte) Math.floor(getEstimatedQReported()), getEmpiricalQuality() - getEstimatedQReported());
-    }
-
-    private double calcExpectedErrors() {
-        return (double) this.numObservations * qualToErrorProb(estimatedQReported);
-    }
-
-    private double qualToErrorProb(final double qual) {
-        return Math.pow(10.0, qual / -10.0);
-    }
-
-    public static RecalDatum createRandomRecalDatum(int maxObservations, int maxErrors) {
-        final Random random = new Random();
-        final int nObservations = random.nextInt(maxObservations);
-        final int nErrors = random.nextInt(maxErrors);
-        final int qual = random.nextInt(QualityUtils.MAX_QUAL_SCORE);
-        return new RecalDatum(nObservations, nErrors, (byte)qual);
-    }
-
-    /**
-     * We don't compare the estimated quality reported because it may be different when read from
-     * report tables.
-     *
-     * @param o the other recal datum
-     * @return true if the two recal datums have the same number of observations, errors and empirical quality.
-     */
-    @Override
-    public boolean equals(Object o) {
-        if (!(o instanceof RecalDatum))
-            return false;
-        RecalDatum other = (RecalDatum) o;
-        return super.equals(o) &&
-               MathUtils.compareDoubles(this.empiricalQuality, other.empiricalQuality, 0.001) == 0;
-    }
-}
diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationArgumentCollection.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationArgumentCollection.java
index 2a94426a7..f04e4a1b3 100755
--- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationArgumentCollection.java
+++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationArgumentCollection.java
@@ -29,6 +29,7 @@ import org.broad.tribble.Feature;
 import org.broadinstitute.sting.commandline.*;
 import org.broadinstitute.sting.gatk.report.GATKReportTable;
 import org.broadinstitute.sting.utils.Utils;
+import org.broadinstitute.sting.utils.recalibration.RecalUtils;
 
 import java.io.File;
 import java.util.Collections;
@@ -100,7 +101,7 @@ public class RecalibrationArgumentCollection {
      * reads which have had the reference inserted because of color space inconsistencies.
      */
     @Argument(fullName = "solid_recal_mode", shortName = "sMode", required = false, doc = "How should we recalibrate solid bases in which the reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS")
-    public RecalDataManager.SOLID_RECAL_MODE SOLID_RECAL_MODE = RecalDataManager.SOLID_RECAL_MODE.SET_Q_ZERO;
+    public RecalUtils.SOLID_RECAL_MODE SOLID_RECAL_MODE = RecalUtils.SOLID_RECAL_MODE.SET_Q_ZERO;
 
     /**
      * CountCovariates and TableRecalibration accept a --solid_nocall_strategy  flag which governs how the recalibrator handles
@@ -108,7 +109,7 @@ public class RecalibrationArgumentCollection {
      * their color space tag can not be recalibrated.
      */
     @Argument(fullName = "solid_nocall_strategy", shortName = "solid_nocall_strategy", doc = "Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ", required = false)
-    public RecalDataManager.SOLID_NOCALL_STRATEGY SOLID_NOCALL_STRATEGY = RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION;
+    public RecalUtils.SOLID_NOCALL_STRATEGY SOLID_NOCALL_STRATEGY = RecalUtils.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION;
 
     /**
      * The context covariate will use a context of this size to calculate it's covariate value for base mismatches
@@ -177,41 +178,41 @@ public class RecalibrationArgumentCollection {
     public GATKReportTable generateReportTable() {
         GATKReportTable argumentsTable = new GATKReportTable("Arguments", "Recalibration argument collection values used in this run", 2);
         argumentsTable.addColumn("Argument");
-        argumentsTable.addColumn(RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME);
+        argumentsTable.addColumn(RecalUtils.ARGUMENT_VALUE_COLUMN_NAME);
         argumentsTable.addRowID("covariate", true);
-        argumentsTable.set("covariate", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, (COVARIATES == null) ? "null" : Utils.join(",", COVARIATES));
+        argumentsTable.set("covariate", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, (COVARIATES == null) ? "null" : Utils.join(",", COVARIATES));
         argumentsTable.addRowID("no_standard_covs", true);
-        argumentsTable.set("no_standard_covs", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, DO_NOT_USE_STANDARD_COVARIATES);
+        argumentsTable.set("no_standard_covs", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, DO_NOT_USE_STANDARD_COVARIATES);
         argumentsTable.addRowID("run_without_dbsnp", true);
-        argumentsTable.set("run_without_dbsnp", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, RUN_WITHOUT_DBSNP);
+        argumentsTable.set("run_without_dbsnp", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, RUN_WITHOUT_DBSNP);
         argumentsTable.addRowID("solid_recal_mode", true);
-        argumentsTable.set("solid_recal_mode", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, SOLID_RECAL_MODE);
+        argumentsTable.set("solid_recal_mode", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, SOLID_RECAL_MODE);
         argumentsTable.addRowID("solid_nocall_strategy", true);
-        argumentsTable.set("solid_nocall_strategy", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, SOLID_NOCALL_STRATEGY);
+        argumentsTable.set("solid_nocall_strategy", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, SOLID_NOCALL_STRATEGY);
         argumentsTable.addRowID("mismatches_context_size", true);
-        argumentsTable.set("mismatches_context_size", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, MISMATCHES_CONTEXT_SIZE);
+        argumentsTable.set("mismatches_context_size", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, MISMATCHES_CONTEXT_SIZE);
         argumentsTable.addRowID("indels_context_size", true);
-        argumentsTable.set("indels_context_size", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, INDELS_CONTEXT_SIZE);
+        argumentsTable.set("indels_context_size", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, INDELS_CONTEXT_SIZE);
         argumentsTable.addRowID("mismatches_default_quality", true);
-        argumentsTable.set("mismatches_default_quality", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, MISMATCHES_DEFAULT_QUALITY);
+        argumentsTable.set("mismatches_default_quality", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, MISMATCHES_DEFAULT_QUALITY);
         argumentsTable.addRowID("insertions_default_quality", true);
-        argumentsTable.set("insertions_default_quality", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, INSERTIONS_DEFAULT_QUALITY);
+        argumentsTable.set("insertions_default_quality", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, INSERTIONS_DEFAULT_QUALITY);
         argumentsTable.addRowID("low_quality_tail", true);
-        argumentsTable.set("low_quality_tail", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, LOW_QUAL_TAIL);
+        argumentsTable.set("low_quality_tail", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, LOW_QUAL_TAIL);
         argumentsTable.addRowID("default_platform", true);
-        argumentsTable.set("default_platform", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, DEFAULT_PLATFORM);
+        argumentsTable.set("default_platform", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, DEFAULT_PLATFORM);
         argumentsTable.addRowID("force_platform", true);
-        argumentsTable.set("force_platform", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, FORCE_PLATFORM);
+        argumentsTable.set("force_platform", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, FORCE_PLATFORM);
         argumentsTable.addRowID("quantizing_levels", true);
-        argumentsTable.set("quantizing_levels", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, QUANTIZING_LEVELS);
+        argumentsTable.set("quantizing_levels", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, QUANTIZING_LEVELS);
         argumentsTable.addRowID("keep_intermediate_files", true);
-        argumentsTable.set("keep_intermediate_files", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, KEEP_INTERMEDIATE_FILES);
+        argumentsTable.set("keep_intermediate_files", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, KEEP_INTERMEDIATE_FILES);
         argumentsTable.addRowID("no_plots", true);
-        argumentsTable.set("no_plots", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, NO_PLOTS);
+        argumentsTable.set("no_plots", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, NO_PLOTS);
         argumentsTable.addRowID("recalibration_report", true);
-        argumentsTable.set("recalibration_report", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, recalibrationReport == null ? "null" : recalibrationReport.getAbsolutePath());
+        argumentsTable.set("recalibration_report", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, recalibrationReport == null ? "null" : recalibrationReport.getAbsolutePath());
         argumentsTable.addRowID("binary_tag_name", true);
-        argumentsTable.set("binary_tag_name", RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME, BINARY_TAG_NAME == null ? "null" : BINARY_TAG_NAME);
+        argumentsTable.set("binary_tag_name", RecalUtils.ARGUMENT_VALUE_COLUMN_NAME, BINARY_TAG_NAME == null ? "null" : BINARY_TAG_NAME);
         return argumentsTable;
     }
 
diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationEngine.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationEngine.java
index aa62a18bc..38e306939 100644
--- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationEngine.java
+++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationEngine.java
@@ -1,5 +1,6 @@
 package org.broadinstitute.sting.gatk.walkers.bqsr;
 
+import org.broadinstitute.sting.utils.recalibration.covariates.Covariate;
 import org.broadinstitute.sting.utils.pileup.PileupElement;
 import org.broadinstitute.sting.utils.recalibration.RecalibrationTables;
 
diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/StandardRecalibrationEngine.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/StandardRecalibrationEngine.java
index a24506d07..08c7da754 100644
--- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/StandardRecalibrationEngine.java
+++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/StandardRecalibrationEngine.java
@@ -25,10 +25,14 @@ package org.broadinstitute.sting.gatk.walkers.bqsr;
  * OTHER DEALINGS IN THE SOFTWARE.
  */
 
+import org.broadinstitute.sting.utils.recalibration.covariates.Covariate;
 import org.broadinstitute.sting.utils.BaseUtils;
 import org.broadinstitute.sting.utils.classloader.PublicPackageSource;
 import org.broadinstitute.sting.utils.collections.NestedIntegerArray;
 import org.broadinstitute.sting.utils.pileup.PileupElement;
+import org.broadinstitute.sting.utils.recalibration.EventType;
+import org.broadinstitute.sting.utils.recalibration.ReadCovariates;
+import org.broadinstitute.sting.utils.recalibration.RecalDatum;
 import org.broadinstitute.sting.utils.recalibration.RecalibrationTables;
 import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
 
diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReference.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReference.java
index 92549b821..8fbd37e30 100755
--- a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReference.java
+++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReference.java
@@ -47,7 +47,10 @@ import java.util.List;
  * 

* Given variant tracks, it replaces the reference bases at variation sites with the bases supplied by the ROD(s). * Additionally, allows for one or more "snpmask" VCFs to set overlapping bases to 'N'. - * Note that if there are multiple variants at a site, it takes the first one seen. + * Several important notes: + * 1) if there are multiple variants that start at a site, it chooses one of them randomly. + * 2) when there are overlapping indels (but with different start positions) only the first will be chosen. + * 3) this tool works only for SNPs and for simple indels (but not for things like complex substitutions). * Reference bases for each interval will be output as a separate fasta sequence (named numerically in order). * *

Input

@@ -102,7 +105,7 @@ public class FastaAlternateReference extends FastaReference { String refBase = String.valueOf((char)ref.getBase()); // Check to see if we have a called snp - for ( VariantContext vc : tracker.getValues(variants) ) { + for ( VariantContext vc : tracker.getValues(variants, ref.getLocus()) ) { if ( vc.isFiltered() ) continue; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/AlleleFrequencyCalculationModel.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/AlleleFrequencyCalculationModel.java index 432bbd6d7..08a333486 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/AlleleFrequencyCalculationModel.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/AlleleFrequencyCalculationModel.java @@ -46,8 +46,7 @@ public abstract class AlleleFrequencyCalculationModel implements Cloneable { public enum Model { /** The default model with the best performance in all cases */ - EXACT, - POOL + EXACT } protected int N; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GenotypeLikelihoodsCalculationModel.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GenotypeLikelihoodsCalculationModel.java index 4253ff3ad..6fdc926d5 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GenotypeLikelihoodsCalculationModel.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GenotypeLikelihoodsCalculationModel.java @@ -59,10 +59,9 @@ public abstract class GenotypeLikelihoodsCalculationModel implements Cloneable { public enum Model { SNP, INDEL, - BOTH, - POOLSNP, - POOLINDEL, - POOLBOTH + GeneralPloidySNP, + GeneralPloidyINDEL, + BOTH } public enum GENOTYPING_MODE { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java index cd1815d82..c1c1339f5 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java @@ -82,7 +82,7 @@ import java.util.*; * -o snps.raw.vcf \ * -stand_call_conf [50.0] \ * -stand_emit_conf 10.0 \ - * -dcov [50] \ + * -dcov [50 for 4x, 200 for >30x WGS or Whole exome] \ * [-L targets.interval_list] *
* @@ -241,7 +241,7 @@ public class UnifiedGenotyper extends LocusWalker, Unif } else { // in full mode: check for consistency in ploidy/pool calling arguments // check for correct calculation models - if (UAC.samplePloidy != VariantContextUtils.DEFAULT_PLOIDY) { +/* if (UAC.samplePloidy != VariantContextUtils.DEFAULT_PLOIDY) { // polyploidy requires POOL GL and AF calculation models to be specified right now if (UAC.GLmodel != GenotypeLikelihoodsCalculationModel.Model.POOLSNP && UAC.GLmodel != GenotypeLikelihoodsCalculationModel.Model.POOLINDEL && UAC.GLmodel != GenotypeLikelihoodsCalculationModel.Model.POOLBOTH) { @@ -252,6 +252,7 @@ public class UnifiedGenotyper extends LocusWalker, Unif throw new UserException("Incorrect AF Calculation model. Only POOL model supported if sample ploidy != 2"); } + */ // get all of the unique sample names if (UAC.TREAT_ALL_READS_AS_SINGLE_POOL) { samples.clear(); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java index f73ab2471..f4bd196ae 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java @@ -50,6 +50,7 @@ import java.util.*; public class UnifiedGenotyperEngine { public static final String LOW_QUAL_FILTER_NAME = "LowQual"; + private static final String GPSTRING = "GeneralPloidy"; public static final String NUMBER_OF_DISCOVERED_ALLELES_KEY = "NDA"; @@ -273,7 +274,7 @@ public class UnifiedGenotyperEngine { glcm.set(getGenotypeLikelihoodsCalculationObject(logger, UAC)); } - return glcm.get().get(model.name()).getLikelihoods(tracker, refContext, stratifiedContexts, type, alternateAllelesToUse, useBAQedPileup && BAQEnabledOnCMDLine, genomeLocParser); + return glcm.get().get(model.name().toUpperCase()).getLikelihoods(tracker, refContext, stratifiedContexts, type, alternateAllelesToUse, useBAQedPileup && BAQEnabledOnCMDLine, genomeLocParser); } private VariantCallContext generateEmptyContext(RefMetaDataTracker tracker, ReferenceContext ref, Map stratifiedContexts, AlignmentContext rawContext) { @@ -640,6 +641,9 @@ public class UnifiedGenotyperEngine { if ( UAC.GLmodel.name().toUpperCase().contains("BOTH") ) modelPrefix = UAC.GLmodel.name().toUpperCase().replaceAll("BOTH",""); + if (!UAC.GLmodel.name().contains(GPSTRING) && UAC.samplePloidy != VariantContextUtils.DEFAULT_PLOIDY) + modelPrefix = GPSTRING + modelPrefix; + // if we're genotyping given alleles and we have a requested SNP at this position, do SNP if ( UAC.GenotypingMode == GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES ) { final VariantContext vcInput = UnifiedGenotyperEngine.getVCFromAllelesRod(tracker, refContext, rawContext.getLocation(), false, logger, UAC.alleles); @@ -648,17 +652,13 @@ public class UnifiedGenotyperEngine { if ( vcInput.isSNP() ) { // ignore SNPs if the user chose INDEL mode only - if ( UAC.GLmodel.name().toUpperCase().contains("BOTH") ) + if ( UAC.GLmodel.name().toUpperCase().contains("BOTH") || UAC.GLmodel.name().toUpperCase().contains("SNP") ) models.add(GenotypeLikelihoodsCalculationModel.Model.valueOf(modelPrefix+"SNP")); - else if ( UAC.GLmodel.name().toUpperCase().contains("SNP") ) - models.add(UAC.GLmodel); - } + } else if ( vcInput.isIndel() || vcInput.isMixed() ) { // ignore INDELs if the user chose SNP mode only - if ( UAC.GLmodel.name().toUpperCase().contains("BOTH") ) + if ( UAC.GLmodel.name().toUpperCase().contains("BOTH") || UAC.GLmodel.name().toUpperCase().contains("INDEL") ) models.add(GenotypeLikelihoodsCalculationModel.Model.valueOf(modelPrefix+"INDEL")); - else if (UAC.GLmodel.name().toUpperCase().contains("INDEL")) - models.add(UAC.GLmodel); } // No support for other types yet } @@ -668,7 +668,7 @@ public class UnifiedGenotyperEngine { models.add(GenotypeLikelihoodsCalculationModel.Model.valueOf(modelPrefix+"INDEL")); } else { - models.add(UAC.GLmodel); + models.add(GenotypeLikelihoodsCalculationModel.Model.valueOf(modelPrefix+UAC.GLmodel.name().toUpperCase())); } } @@ -730,12 +730,19 @@ public class UnifiedGenotyperEngine { } private static AlleleFrequencyCalculationModel getAlleleFrequencyCalculationObject(int N, Logger logger, PrintStream verboseWriter, UnifiedArgumentCollection UAC) { + List> afClasses = new PluginManager(AlleleFrequencyCalculationModel.class).getPlugins(); + // user-specified name + String afModelName = UAC.AFmodel.name(); + + if (!afModelName.contains(GPSTRING) && UAC.samplePloidy != VariantContextUtils.DEFAULT_PLOIDY) + afModelName = GPSTRING + afModelName; + for (int i = 0; i < afClasses.size(); i++) { Class afClass = afClasses.get(i); String key = afClass.getSimpleName().replace("AFCalculationModel","").toUpperCase(); - if (UAC.AFmodel.name().equalsIgnoreCase(key)) { + if (afModelName.equalsIgnoreCase(key)) { try { Object args[] = new Object[]{UAC,N,logger,verboseWriter}; Constructor c = afClass.getDeclaredConstructor(UnifiedArgumentCollection.class, int.class, Logger.class, PrintStream.class); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/LeftAlignIndels.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/LeftAlignIndels.java index 6047a15b4..b08def44f 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/LeftAlignIndels.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/LeftAlignIndels.java @@ -73,19 +73,7 @@ public class LeftAlignIndels extends ReadWalker { @Output(required=false, doc="Output bam") protected StingSAMFileWriter writer = null; - /** - * If set too low, the tool may run out of system file descriptors needed to perform sorting; if too high, the tool - * may run out of memory. We recommend that you additionally tell Java to use a temp directory with plenty of available - * space (by setting java.io.tempdir on the command-line). - */ - @Argument(fullName="maxReadsInRam", shortName="maxInRam", doc="max reads allowed to be kept in memory at a time by the output writer", required=false) - protected int MAX_RECORDS_IN_RAM = 500000; - - public void initialize() { - // set up the output writer - if ( writer != null ) - writer.setMaxRecordsInRam(MAX_RECORDS_IN_RAM); - } + public void initialize() {} private void emit(final SAMRecord read) { if ( writer != null ) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasing.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasing.java index f16deb701..f49e8f8c0 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasing.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasing.java @@ -288,7 +288,7 @@ public class ReadBackedPhasing extends RodWalker samplesToPhase) { // for ( String sample : samplesToPhase ) // logger.debug(String.format(" Sample %s has genotype %s, het = %s", sample, vc.getGenotype(sample), vc.getGenotype(sample).isHet() )); - VariantContext subvc = vc.subContextFromSamples(samplesToPhase, true); + VariantContext subvc = vc.subContextFromSamples(samplesToPhase); // logger.debug("original VC = " + vc); // logger.debug("sub VC = " + subvc); return VariantContextUtils.pruneVariantContext(subvc, KEYS_TO_KEEP_IN_REDUCED_VCF); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/validationsiteselector/GLBasedSampleSelector.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/validationsiteselector/GLBasedSampleSelector.java index e54dc6388..3e48520a7 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/validationsiteselector/GLBasedSampleSelector.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/validationsiteselector/GLBasedSampleSelector.java @@ -43,7 +43,7 @@ public class GLBasedSampleSelector extends SampleSelector { return true; // want to include a site in the given samples if it is *likely* to be variant (via the EXACT model) // first subset to the samples - VariantContext subContext = vc.subContextFromSamples(samples, true); + VariantContext subContext = vc.subContextFromSamples(samples); // now check to see (using EXACT model) whether this should be variant // do we want to apply a prior? maybe user-spec? diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/validationsiteselector/GTBasedSampleSelector.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/validationsiteselector/GTBasedSampleSelector.java index 0f55524a6..de832b108 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/validationsiteselector/GTBasedSampleSelector.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/validationsiteselector/GTBasedSampleSelector.java @@ -45,7 +45,7 @@ public class GTBasedSampleSelector extends SampleSelector{ if ( samples == null || samples.isEmpty() ) return true; - VariantContext subContext = vc.subContextFromSamples(samples, false); + VariantContext subContext = vc.subContextFromSamples(samples); if ( subContext.isPolymorphicInSamples() ) { return true; } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java index 0b395bc62..58cd14737 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java @@ -500,7 +500,10 @@ public class VariantEval extends RodWalker implements TreeRedu @Requires({"eval != null", "comp != null"}) private EvalCompMatchType doEvalAndCompMatch(final VariantContext eval, final VariantContext comp, boolean requireStrictAlleleMatch) { - // find all of the matching comps + if ( comp.getType() == VariantContext.Type.NO_VARIATION || eval.getType() == VariantContext.Type.NO_VARIATION ) + // if either of these are NO_VARIATION they are LENIENT matches + return EvalCompMatchType.LENIENT; + if ( comp.getType() != eval.getType() ) return EvalCompMatchType.NO_MATCH; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java index 6c4fcd26d..fe2437976 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java @@ -57,9 +57,12 @@ public class TiTvVariantEvaluator extends VariantEvaluator implements StandardEv } } - public void update2(VariantContext vc1, VariantContext vc2, RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) { - if (vc1 != null) updateTiTv(vc1, false); - if (vc2 != null) updateTiTv(vc2, true); + @Override + public void update2(VariantContext eval, VariantContext comp, RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) { + if (eval != null) + updateTiTv(eval, false); + if (comp != null) + updateTiTv(comp, true); } @Override diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Novelty.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Novelty.java index 693bdf198..2ad08d806 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Novelty.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Novelty.java @@ -28,7 +28,7 @@ public class Novelty extends VariantStratifier implements StandardStratification final Collection knownComps = tracker.getValues(knowns, ref.getLocus()); for ( final VariantContext c : knownComps ) { // loop over sites, looking for something that matches the type eval - if ( eval.getType() == c.getType() ) { + if ( eval.getType() == c.getType() || eval.getType() == VariantContext.Type.NO_VARIATION ) { return KNOWN_STATES; } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java index 3dcc1f85f..e84b0b10e 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java @@ -197,7 +197,9 @@ public class VariantEvalUtils { * @return a new VariantContext with just the requested samples */ public VariantContext getSubsetOfVariantContext(VariantContext vc, Set sampleNames) { - return ensureAnnotations(vc, vc.subContextFromSamples(sampleNames, false)); + // if we want to preserve AC0 sites as polymorphic we need to not rederive alleles + final boolean deriveAlleles = variantEvalWalker.ignoreAC0Sites(); + return ensureAnnotations(vc, vc.subContextFromSamples(sampleNames, deriveAlleles)); } public VariantContext ensureAnnotations(final VariantContext vc, final VariantContext vcsub) { @@ -262,12 +264,8 @@ public class VariantEvalUtils { // First, filter the VariantContext to represent only the samples for evaluation VariantContext vcsub = vc; - if (subsetBySample && vc.hasGenotypes()) { - if ( variantEvalWalker.isSubsettingToSpecificSamples() ) - vcsub = getSubsetOfVariantContext(vc, variantEvalWalker.getSampleNamesForEvaluation()); - else - vcsub = ensureAnnotations(vc, vc); - } + if (subsetBySample && vc.hasGenotypes()) + vcsub = getSubsetOfVariantContext(vc, variantEvalWalker.getSampleNamesForEvaluation()); if ((byFilter || !vcsub.isFiltered())) { addMapping(mapping, VariantEval.getAllSampleName(), vcsub); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/ApplyRecalibration.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/ApplyRecalibration.java index 744a094c6..011f3471c 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/ApplyRecalibration.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/ApplyRecalibration.java @@ -58,14 +58,11 @@ import java.util.*; * to the desired level but also has the information necessary to pull out more variants for a higher sensitivity but a * slightly lower quality level. * - *

- * See the GATK wiki for a tutorial and example recalibration accuracy plots. - * *

Input

*

* The input raw variants to be recalibrated. *

- * The recalibration table file in CSV format that was generated by the VariantRecalibrator walker. + * The recalibration table file in VCF format that was generated by the VariantRecalibrator walker. *

* The tranches file that was generated by the VariantRecalibrator walker. * @@ -82,6 +79,7 @@ import java.util.*; * --ts_filter_level 99.0 \ * -tranchesFile path/to/output.tranches \ * -recalFile path/to/output.recal \ + * -mode SNP \ * -o path/to/output.recalibrated.filtered.vcf * * @@ -198,7 +196,7 @@ public class ApplyRecalibration extends RodWalker implements T for( final VariantContext vc : VCs ) { - if( VariantRecalibrator.checkRecalibrationMode( vc, MODE ) && (vc.isNotFiltered() || ignoreInputFilterSet.containsAll(vc.getFilters())) ) { + if( VariantDataManager.checkVariationClass( vc, MODE ) && (vc.isNotFiltered() || ignoreInputFilterSet.containsAll(vc.getFilters())) ) { final VariantContext recalDatum = getMatchingRecalVC(vc, recals); if( recalDatum == null ) { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantDataManager.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantDataManager.java index d6df4ff1b..45fdad4f8 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantDataManager.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantDataManager.java @@ -31,6 +31,7 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.variantcontext.writer.VariantContextWriter; import org.broadinstitute.sting.utils.collections.ExpandingArrayList; import org.broadinstitute.sting.utils.exceptions.UserException; @@ -273,11 +274,37 @@ public class VariantDataManager { } private boolean isValidVariant( final VariantContext evalVC, final VariantContext trainVC, final boolean TRUST_ALL_POLYMORPHIC) { - return trainVC != null && trainVC.isNotFiltered() && trainVC.isVariant() && - ((evalVC.isSNP() && trainVC.isSNP()) || ((evalVC.isIndel()||evalVC.isMixed()) && (trainVC.isIndel()||trainVC.isMixed()))) && + return trainVC != null && trainVC.isNotFiltered() && trainVC.isVariant() && checkVariationClass( evalVC, trainVC ) && (TRUST_ALL_POLYMORPHIC || !trainVC.hasGenotypes() || trainVC.isPolymorphicInSamples()); } + protected static boolean checkVariationClass( final VariantContext evalVC, final VariantContext trainVC ) { + switch( trainVC.getType() ) { + case SNP: + case MNP: + return checkVariationClass( evalVC, VariantRecalibratorArgumentCollection.Mode.SNP ); + case INDEL: + case MIXED: + case SYMBOLIC: + return checkVariationClass( evalVC, VariantRecalibratorArgumentCollection.Mode.INDEL ); + default: + return false; + } + } + + protected static boolean checkVariationClass( final VariantContext evalVC, final VariantRecalibratorArgumentCollection.Mode mode ) { + switch( mode ) { + case SNP: + return evalVC.isSNP() || evalVC.isMNP(); + case INDEL: + return evalVC.isIndel() || evalVC.isMixed() || evalVC.isSymbolic(); + case BOTH: + return true; + default: + throw new ReviewedStingException( "Encountered unknown recal mode: " + mode ); + } + } + public void writeOutRecalibrationTable( final VariantContextWriter recalWriter ) { // we need to sort in coordinate order in order to produce a valid VCF Collections.sort( data, new Comparator() { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrator.java index 2a424e15b..ab2ff6176 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrator.java @@ -38,7 +38,6 @@ import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.sting.utils.R.RScriptExecutor; import org.broadinstitute.sting.utils.Utils; -import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeader; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLine; import org.broadinstitute.sting.utils.collections.ExpandingArrayList; @@ -48,7 +47,6 @@ import org.broadinstitute.sting.utils.io.Resource; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils; import org.broadinstitute.sting.utils.variantcontext.writer.VariantContextWriter; -import org.broadinstitute.sting.utils.variantcontext.writer.VariantContextWriterFactory; import java.io.File; import java.io.FileNotFoundException; @@ -65,7 +63,7 @@ import java.util.*; * The purpose of the variant recalibrator is to assign a well-calibrated probability to each variant call in a call set. * One can then create highly accurate call sets by filtering based on this single estimate for the accuracy of each call. * The approach taken by variant quality score recalibration is to develop a continuous, covarying estimate of the relationship - * between SNP call annotations (QD, SB, HaplotypeScore, HRun, for example) and the the probability that a SNP is a true genetic + * between SNP call annotations (QD, MQ, HaplotypeScore, and ReadPosRankSum, for example) and the the probability that a SNP is a true genetic * variant versus a sequencing or data processing artifact. This model is determined adaptively based on "true sites" provided * as input, typically HapMap 3 sites and those sites found to be polymorphic on the Omni 2.5M SNP chip array. This adaptive * error model can then be applied to both known and novel variation discovered in the call set of interest to evaluate the @@ -73,15 +71,9 @@ import java.util.*; * the log odds ratio of being a true variant versus being false under the trained Gaussian mixture model. * *

- * NOTE: Please see our best practices wiki page for our recommendations on which annotations to use for specific project designs. - * - *

* NOTE: In order to create the model reporting plots Rscript needs to be in your environment PATH (this is the scripting version of R, not the interactive version). * See http://www.r-project.org for more info on how to download and install R. * - *

- * See the GATK wiki for a tutorial and example recalibration accuracy plots. - * *

Input

*

* The input raw variants to be recalibrated. @@ -90,7 +82,7 @@ import java.util.*; * *

Output

*

- * A recalibration table file in CSV format that is used by the ApplyRecalibration walker. + * A recalibration table file in VCF format that is used by the ApplyRecalibration walker. *

* A tranches file which shows various metrics of the recalibration callset as a function of making several slices through the data. * @@ -102,8 +94,9 @@ import java.util.*; * -input NA12878.HiSeq.WGS.bwa.cleaned.raw.subset.b37.vcf \ * -resource:hapmap,known=false,training=true,truth=true,prior=15.0 hapmap_3.3.b37.sites.vcf \ * -resource:omni,known=false,training=true,truth=false,prior=12.0 1000G_omni2.5.b37.sites.vcf \ - * -resource:dbsnp,known=true,training=false,truth=false,prior=8.0 dbsnp_132.b37.vcf \ - * -an QD -an HaplotypeScore -an MQRankSum -an ReadPosRankSum -an MQ \ + * -resource:dbsnp,known=true,training=false,truth=false,prior=6.0 dbsnp_135.b37.vcf \ + * -an QD -an HaplotypeScore -an MQRankSum -an ReadPosRankSum -an FS -an MQ -an InbreedingCoeff \ + * -mode SNP \ * -recalFile path/to/output.recal \ * -tranchesFile path/to/output.tranches \ * -rscriptFile path/to/output.plots.R @@ -187,9 +180,6 @@ public class VariantRecalibrator extends RodWalker 127; -128 -> 128; -1 -> 255; etc. } diff --git a/public/java/src/org/broadinstitute/sting/utils/classloader/PluginManager.java b/public/java/src/org/broadinstitute/sting/utils/classloader/PluginManager.java index f24bbb636..9a2cb68db 100644 --- a/public/java/src/org/broadinstitute/sting/utils/classloader/PluginManager.java +++ b/public/java/src/org/broadinstitute/sting/utils/classloader/PluginManager.java @@ -168,6 +168,28 @@ public class PluginManager { String pluginName = getName(pluginClass); pluginsByName.put(pluginName, pluginClass); } + + // sort the plugins so the order of elements is deterministic + sortPlugins(plugins); + sortPlugins(interfaces); + } + + /** + * Sorts, in place, the list of plugins according to getName() on each element + * + * @param unsortedPlugins + */ + private final void sortPlugins(final List> unsortedPlugins) { + Collections.sort(unsortedPlugins, new ComparePluginsByName()); + } + + private final class ComparePluginsByName implements Comparator> { + @Override + public int compare(final Class aClass, final Class aClass1) { + String pluginName1 = getName(aClass); + String pluginName2 = getName(aClass1); + return pluginName1.compareTo(pluginName2); + } } /** diff --git a/public/java/src/org/broadinstitute/sting/utils/clipping/ClippingOp.java b/public/java/src/org/broadinstitute/sting/utils/clipping/ClippingOp.java index a4383c3ae..554188bc1 100644 --- a/public/java/src/org/broadinstitute/sting/utils/clipping/ClippingOp.java +++ b/public/java/src/org/broadinstitute/sting/utils/clipping/ClippingOp.java @@ -4,7 +4,7 @@ import com.google.java.contract.Requires; import net.sf.samtools.Cigar; import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; -import org.broadinstitute.sting.gatk.walkers.bqsr.EventType; +import org.broadinstitute.sting.utils.recalibration.EventType; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/public/java/src/org/broadinstitute/sting/utils/clipping/ReadClipper.java b/public/java/src/org/broadinstitute/sting/utils/clipping/ReadClipper.java index ba9267222..6392ce4ce 100644 --- a/public/java/src/org/broadinstitute/sting/utils/clipping/ReadClipper.java +++ b/public/java/src/org/broadinstitute/sting/utils/clipping/ReadClipper.java @@ -3,7 +3,7 @@ package org.broadinstitute.sting.utils.clipping; import com.google.java.contract.Requires; import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; -import org.broadinstitute.sting.gatk.walkers.bqsr.EventType; +import org.broadinstitute.sting.utils.recalibration.EventType; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.ReadUtils; diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Codec.java b/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Codec.java index 0f9cc34e7..0776b3aa8 100644 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Codec.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Codec.java @@ -53,6 +53,11 @@ public final class BCF2Codec implements FeatureCodec { final protected static Logger logger = Logger.getLogger(BCF2Codec.class); private final static boolean FORBID_SYMBOLICS = false; + private final static int ALLOWED_MAJOR_VERSION = 2; + private final static int MIN_MINOR_VERSION = 1; + + private BCFVersion bcfVersion = null; + private VCFHeader header = null; /** @@ -131,8 +136,16 @@ public final class BCF2Codec implements FeatureCodec { public FeatureCodecHeader readHeader( final PositionalBufferedStream inputStream ) { try { // note that this reads the magic as well, and so does double duty - if ( ! BCF2Utils.startsWithBCF2Magic(inputStream) ) - error("Input stream does not begin with BCF2 magic"); + bcfVersion = BCFVersion.readBCFVersion(inputStream); + if ( bcfVersion == null ) + error("Input stream does not contain a BCF encoded file; BCF magic header info not found"); + + if ( bcfVersion.getMajorVersion() != ALLOWED_MAJOR_VERSION ) + error("BCF2Codec can only process BCF2 files, this file has major version " + bcfVersion.getMajorVersion()); + if ( bcfVersion.getMinorVersion() < MIN_MINOR_VERSION ) + error("BCF2Codec can only process BCF2 files with minor version >= " + MIN_MINOR_VERSION + " but this file has minor version " + bcfVersion.getMinorVersion()); + + logger.info("BCF version " + bcfVersion); final int headerSizeInBytes = BCF2Utils.readInt(BCF2Type.INT32.getSizeInBytes(), inputStream); @@ -187,7 +200,8 @@ public final class BCF2Codec implements FeatureCodec { FileInputStream fis = null; try { fis = new FileInputStream(path); - return BCF2Utils.startsWithBCF2Magic(fis); + final BCFVersion version = BCFVersion.readBCFVersion(fis); + return version != null && version.getMajorVersion() == ALLOWED_MAJOR_VERSION; } catch ( FileNotFoundException e ) { return false; } catch ( IOException e ) { @@ -196,7 +210,7 @@ public final class BCF2Codec implements FeatureCodec { try { if ( fis != null ) fis.close(); } catch ( IOException e ) { - ; // do nothing + // do nothing } } } diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Decoder.java b/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Decoder.java index a13be21c5..2619a4dae 100644 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Decoder.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Decoder.java @@ -202,7 +202,7 @@ public final class BCF2Decoder { return null; else { final String s = new String(bytes, 0, goodLength); - return BCF2Utils.isCollapsedString(s) ? BCF2Utils.exploreStringList(s) : s; + return BCF2Utils.isCollapsedString(s) ? BCF2Utils.explodeStringList(s) : s; } } catch ( IOException e ) { throw new ReviewedStingException("readByte failure", e); diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Utils.java b/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Utils.java index 43e933948..c79abe2ae 100644 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Utils.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCF2Utils.java @@ -41,8 +41,6 @@ import java.util.*; * @since 5/12 */ public final class BCF2Utils { - public static final byte[] MAGIC_HEADER_LINE = "BCF\2".getBytes(); - public static final int MAX_ALLELES_IN_GENOTYPES = 127; public static final int OVERFLOW_ELEMENT_MARKER = 15; @@ -75,68 +73,60 @@ public final class BCF2Utils { */ @Requires("header != null") @Ensures({"result != null", "new HashSet(result).size() == result.size()"}) - public final static ArrayList makeDictionary(final VCFHeader header) { + public static ArrayList makeDictionary(final VCFHeader header) { final Set seen = new HashSet(); final ArrayList dict = new ArrayList(); - boolean sawPASS = false; + // special case the special PASS field which doesn't show up in the FILTER field definitions + seen.add(VCFConstants.PASSES_FILTERS_v4); + dict.add(VCFConstants.PASSES_FILTERS_v4); + // set up the strings dictionary for ( VCFHeaderLine line : header.getMetaDataInInputOrder() ) { if ( line instanceof VCFIDHeaderLine && ! (line instanceof VCFContigHeaderLine) ) { final VCFIDHeaderLine idLine = (VCFIDHeaderLine)line; if ( ! seen.contains(idLine.getID())) { - sawPASS = sawPASS || idLine.getID().equals(VCFConstants.PASSES_FILTERS_v4); dict.add(idLine.getID()); seen.add(idLine.getID()); } } } - - if ( ! sawPASS ) - dict.add(VCFConstants.PASSES_FILTERS_v4); // special case the special PASS field - return dict; } @Requires({"nElements >= 0", "type != null"}) - public final static byte encodeTypeDescriptor(final int nElements, final BCF2Type type ) { + public static byte encodeTypeDescriptor(final int nElements, final BCF2Type type ) { int encodeSize = Math.min(nElements, OVERFLOW_ELEMENT_MARKER); byte typeByte = (byte)((0x0F & encodeSize) << 4 | (type.getID() & 0x0F)); return typeByte; } @Ensures("result >= 0") - public final static int decodeSize(final byte typeDescriptor) { + public static int decodeSize(final byte typeDescriptor) { return (0xF0 & typeDescriptor) >> 4; } @Ensures("result >= 0") - public final static int decodeTypeID(final byte typeDescriptor) { + public static int decodeTypeID(final byte typeDescriptor) { return typeDescriptor & 0x0F; } @Ensures("result != null") - public final static BCF2Type decodeType(final byte typeDescriptor) { + public static BCF2Type decodeType(final byte typeDescriptor) { return ID_TO_ENUM[decodeTypeID(typeDescriptor)]; } - public final static boolean sizeIsOverflow(final byte typeDescriptor) { + public static boolean sizeIsOverflow(final byte typeDescriptor) { return decodeSize(typeDescriptor) == OVERFLOW_ELEMENT_MARKER; } @Requires("nElements >= 0") - public final static boolean willOverflow(final long nElements) { + public static boolean willOverflow(final long nElements) { return nElements > MAX_INLINE_ELEMENTS; } - public final static boolean startsWithBCF2Magic(final InputStream stream) throws IOException { - final byte[] magicBytes = new byte[BCF2Utils.MAGIC_HEADER_LINE.length]; - stream.read(magicBytes); - return Arrays.equals(magicBytes, BCF2Utils.MAGIC_HEADER_LINE); - } - - public final static byte readByte(final InputStream stream) { + public static byte readByte(final InputStream stream) { // TODO -- shouldn't be capturing error here try { return (byte)(stream.read() & 0xFF); @@ -155,7 +145,7 @@ public final class BCF2Utils { */ @Requires({"strings != null", "strings.size() > 1"}) @Ensures("result != null") - public static final String collapseStringList(final List strings) { + public static String collapseStringList(final List strings) { final StringBuilder b = new StringBuilder(); for ( final String s : strings ) { if ( s != null ) { @@ -177,14 +167,14 @@ public final class BCF2Utils { */ @Requires({"collapsed != null", "isCollapsedString(collapsed)"}) @Ensures("result != null") - public static final List exploreStringList(final String collapsed) { + public static List explodeStringList(final String collapsed) { assert isCollapsedString(collapsed); final String[] exploded = collapsed.substring(1).split(","); return Arrays.asList(exploded); } @Requires("s != null") - public static final boolean isCollapsedString(final String s) { + public static boolean isCollapsedString(final String s) { return s.charAt(0) == ','; } @@ -226,7 +216,7 @@ public final class BCF2Utils { } @Ensures("result.isIntegerType()") - public final static BCF2Type determineIntegerType(final int value) { + public static BCF2Type determineIntegerType(final int value) { for ( final BCF2Type potentialType : INTEGER_TYPES_BY_SIZE) { if ( potentialType.withinRange(value) ) return potentialType; @@ -236,7 +226,7 @@ public final class BCF2Utils { } @Ensures("result.isIntegerType()") - public final static BCF2Type determineIntegerType(final int[] values) { + public static BCF2Type determineIntegerType(final int[] values) { // literally a copy of the code below, but there's no general way to unify lists and arrays in java BCF2Type maxType = BCF2Type.INT8; for ( final int value : values ) { @@ -262,7 +252,7 @@ public final class BCF2Utils { */ @Requires({"t1.isIntegerType()","t2.isIntegerType()"}) @Ensures("result.isIntegerType()") - public final static BCF2Type maxIntegerType(final BCF2Type t1, final BCF2Type t2) { + public static BCF2Type maxIntegerType(final BCF2Type t1, final BCF2Type t2) { switch ( t1 ) { case INT8: return t2; case INT16: return t2 == BCF2Type.INT32 ? t2 : t1; @@ -272,7 +262,7 @@ public final class BCF2Utils { } @Ensures("result.isIntegerType()") - public final static BCF2Type determineIntegerType(final List values) { + public static BCF2Type determineIntegerType(final List values) { BCF2Type maxType = BCF2Type.INT8; for ( final int value : values ) { final BCF2Type type1 = determineIntegerType(value); @@ -297,7 +287,7 @@ public final class BCF2Utils { * @param o * @return */ - public final static List toList(final Object o) { + public static List toList(final Object o) { if ( o == null ) return Collections.emptyList(); else if ( o instanceof List ) return (List)o; else return Collections.singletonList(o); @@ -305,7 +295,7 @@ public final class BCF2Utils { @Requires({"stream != null", "bytesForEachInt > 0"}) - public final static int readInt(int bytesForEachInt, final InputStream stream) { + public static int readInt(int bytesForEachInt, final InputStream stream) { switch ( bytesForEachInt ) { case 1: { return (byte)(readByte(stream)); @@ -323,7 +313,7 @@ public final class BCF2Utils { } } - public final static void encodeRawBytes(final int value, final BCF2Type type, final OutputStream encodeStream) throws IOException { + public static void encodeRawBytes(final int value, final BCF2Type type, final OutputStream encodeStream) throws IOException { switch ( type.getSizeInBytes() ) { case 1: encodeStream.write(0xFF & value); diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCFVersion.java b/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCFVersion.java new file mode 100644 index 000000000..742da7c0c --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/bcf2/BCFVersion.java @@ -0,0 +1,80 @@ +package org.broadinstitute.sting.utils.codecs.bcf2; + +import java.io.IOException; +import java.io.InputStream; +import java.io.OutputStream; +import java.util.Arrays; + +/** + * Simple holder for BCF version information + * + * User: depristo + * Date: 8/2/12 + * Time: 2:16 PM + */ +public class BCFVersion { + /** + * BCF2 begins with the MAGIC info BCF_M_m where M is the major version (currently 2) + * and m is the minor version, currently 1 + */ + public static final byte[] MAGIC_HEADER_START = "BCF".getBytes(); + + final int majorVersion; + final int minorVersion; + + public BCFVersion(int majorVersion, int minorVersion) { + this.majorVersion = majorVersion; + this.minorVersion = minorVersion; + } + + /** + * @return the major version number of this BCF file + */ + public int getMajorVersion() { + return majorVersion; + } + + /** + * @return the minor version number of this BCF file + */ + public int getMinorVersion() { + return minorVersion; + } + + /** + * Return a new BCFVersion object describing the major and minor version of the BCF file in stream + * + * Note that stream must be at the very start of the file. + * + * @param stream + * @return a BCFVersion object, or null if stream doesn't contain a BCF file + * @throws IOException + */ + public static BCFVersion readBCFVersion(final InputStream stream) throws IOException { + final byte[] magicBytes = new byte[MAGIC_HEADER_START.length]; + stream.read(magicBytes); + if ( Arrays.equals(magicBytes, MAGIC_HEADER_START) ) { + // we're a BCF file + final int majorByte = stream.read(); + final int minorByte = stream.read(); + return new BCFVersion( majorByte, minorByte ); + } else + return null; + } + + /** + * Write out the BCF magic information indicating this is a BCF file with corresponding major and minor versions + * @param out + * @throws IOException + */ + public void write(final OutputStream out) throws IOException { + out.write(MAGIC_HEADER_START); + out.write(getMajorVersion() & 0xFF); + out.write(getMinorVersion() & 0xFF); + } + + @Override + public String toString() { + return String.format("BCF%d.%d", getMajorVersion(), getMinorVersion()); + } +} diff --git a/public/java/src/org/broadinstitute/sting/utils/exceptions/UserException.java b/public/java/src/org/broadinstitute/sting/utils/exceptions/UserException.java index 9ce4e82a1..52da31362 100755 --- a/public/java/src/org/broadinstitute/sting/utils/exceptions/UserException.java +++ b/public/java/src/org/broadinstitute/sting/utils/exceptions/UserException.java @@ -316,9 +316,9 @@ public class UserException extends ReviewedStingException { - public static class MissingWalker extends UserException { - public MissingWalker(String walkerName, String message) { - super(String.format("Walker %s is not available: %s", walkerName, message)); + public static class DeprecatedWalker extends UserException { + public DeprecatedWalker(String walkerName, String version) { + super(String.format("Walker %s is no longer available in the GATK; it has been deprecated since version %s", walkerName, version)); } } diff --git a/public/java/src/org/broadinstitute/sting/utils/fragments/FragmentUtils.java b/public/java/src/org/broadinstitute/sting/utils/fragments/FragmentUtils.java index c6eec24f1..851272673 100644 --- a/public/java/src/org/broadinstitute/sting/utils/fragments/FragmentUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/fragments/FragmentUtils.java @@ -4,7 +4,7 @@ import net.sf.samtools.Cigar; import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; import net.sf.samtools.SAMRecord; -import org.broadinstitute.sting.gatk.walkers.bqsr.EventType; +import org.broadinstitute.sting.utils.recalibration.EventType; import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.pileup.PileupElement; diff --git a/public/java/src/org/broadinstitute/sting/utils/recalibration/BaseRecalibration.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/BaseRecalibration.java index b5f7ad046..c09eb0063 100644 --- a/public/java/src/org/broadinstitute/sting/utils/recalibration/BaseRecalibration.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/BaseRecalibration.java @@ -27,7 +27,7 @@ package org.broadinstitute.sting.utils.recalibration; import net.sf.samtools.SAMTag; import net.sf.samtools.SAMUtils; -import org.broadinstitute.sting.gatk.walkers.bqsr.*; +import org.broadinstitute.sting.utils.recalibration.covariates.Covariate; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.sting.utils.collections.NestedIntegerArray; @@ -103,7 +103,7 @@ public class BaseRecalibration { } } - RecalDataManager.computeCovariates(read, requestedCovariates, readCovariates); // compute all covariates for the read + RecalUtils.computeCovariates(read, requestedCovariates, readCovariates); // compute all covariates for the read for (final EventType errorModel : EventType.values()) { // recalibrate all three quality strings if (disableIndelQuals && errorModel != EventType.BASE_SUBSTITUTION) { read.setBaseQualities(null, errorModel); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/EventType.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/EventType.java similarity index 96% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/EventType.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/EventType.java index 2650f0f8d..1c84518eb 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/EventType.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/EventType.java @@ -1,4 +1,4 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/QuantizationInfo.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/QuantizationInfo.java similarity index 78% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/QuantizationInfo.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/QuantizationInfo.java index fb3aef949..2b67d12a9 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/QuantizationInfo.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/QuantizationInfo.java @@ -1,11 +1,9 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; import org.broadinstitute.sting.gatk.report.GATKReportTable; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.sting.utils.collections.NestedIntegerArray; -import org.broadinstitute.sting.utils.recalibration.QualQuantizer; -import org.broadinstitute.sting.utils.recalibration.RecalibrationTables; import java.util.Arrays; import java.util.List; @@ -41,7 +39,7 @@ public class QuantizationInfo { for (final RecalDatum value : qualTable.getAllValues()) { final RecalDatum datum = value; final int empiricalQual = MathUtils.fastRound(datum.getEmpiricalQuality()); // convert the empirical quality to an integer ( it is already capped by MAX_QUAL ) - qualHistogram[empiricalQual] += datum.numObservations; // add the number of observations for every key + qualHistogram[empiricalQual] += datum.getNumObservations(); // add the number of observations for every key } empiricalQualCounts = Arrays.asList(qualHistogram); // histogram with the number of observations of the empirical qualities quantizeQualityScores(quantizationLevels); @@ -70,15 +68,15 @@ public class QuantizationInfo { } public GATKReportTable generateReportTable() { - GATKReportTable quantizedTable = new GATKReportTable(RecalDataManager.QUANTIZED_REPORT_TABLE_TITLE, "Quality quantization map", 3); - quantizedTable.addColumn(RecalDataManager.QUALITY_SCORE_COLUMN_NAME); - quantizedTable.addColumn(RecalDataManager.QUANTIZED_COUNT_COLUMN_NAME); - quantizedTable.addColumn(RecalDataManager.QUANTIZED_VALUE_COLUMN_NAME); + GATKReportTable quantizedTable = new GATKReportTable(RecalUtils.QUANTIZED_REPORT_TABLE_TITLE, "Quality quantization map", 3); + quantizedTable.addColumn(RecalUtils.QUALITY_SCORE_COLUMN_NAME); + quantizedTable.addColumn(RecalUtils.QUANTIZED_COUNT_COLUMN_NAME); + quantizedTable.addColumn(RecalUtils.QUANTIZED_VALUE_COLUMN_NAME); for (int qual = 0; qual <= QualityUtils.MAX_QUAL_SCORE; qual++) { - quantizedTable.set(qual, RecalDataManager.QUALITY_SCORE_COLUMN_NAME, qual); - quantizedTable.set(qual, RecalDataManager.QUANTIZED_COUNT_COLUMN_NAME, empiricalQualCounts.get(qual)); - quantizedTable.set(qual, RecalDataManager.QUANTIZED_VALUE_COLUMN_NAME, quantizedQuals.get(qual)); + quantizedTable.set(qual, RecalUtils.QUALITY_SCORE_COLUMN_NAME, qual); + quantizedTable.set(qual, RecalUtils.QUANTIZED_COUNT_COLUMN_NAME, empiricalQualCounts.get(qual)); + quantizedTable.set(qual, RecalUtils.QUANTIZED_VALUE_COLUMN_NAME, quantizedQuals.get(qual)); } return quantizedTable; } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/ReadCovariates.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/ReadCovariates.java similarity index 97% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/ReadCovariates.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/ReadCovariates.java index 5e907237d..c86bd4deb 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/ReadCovariates.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/ReadCovariates.java @@ -1,4 +1,4 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; /** * The object temporarily held by a read that describes all of it's covariates. diff --git a/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatum.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatum.java new file mode 100755 index 000000000..249422c17 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatum.java @@ -0,0 +1,305 @@ +package org.broadinstitute.sting.utils.recalibration; + +/* + * Copyright (c) 2009 The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +import com.google.java.contract.Ensures; +import com.google.java.contract.Invariant; +import com.google.java.contract.Requires; +import org.broadinstitute.sting.utils.MathUtils; +import org.broadinstitute.sting.utils.QualityUtils; + +import java.util.Random; + +/** + * An individual piece of recalibration data. Each bin counts up the number of observations and the number + * of reference mismatches seen for that combination of covariates. + * + * Created by IntelliJ IDEA. + * User: rpoplin + * Date: Nov 3, 2009 + */ +@Invariant({ + "estimatedQReported >= 0.0", + "! Double.isNaN(estimatedQReported)", + "! Double.isInfinite(estimatedQReported)", + "empiricalQuality >= 0.0 || empiricalQuality == UNINITIALIZED", + "! Double.isNaN(empiricalQuality)", + "! Double.isInfinite(empiricalQuality)", + "numObservations >= 0", + "numMismatches >= 0", + "numMismatches <= numObservations" +}) +public class RecalDatum { + private static final double UNINITIALIZED = -1.0; + + /** + * estimated reported quality score based on combined data's individual q-reporteds and number of observations + */ + private double estimatedQReported; + + /** + * the empirical quality for datums that have been collapsed together (by read group and reported quality, for example) + */ + private double empiricalQuality; + + /** + * number of bases seen in total + */ + private long numObservations; + + /** + * number of bases seen that didn't match the reference + */ + private long numMismatches; + + /** + * used when calculating empirical qualities to avoid division by zero + */ + private static final int SMOOTHING_CONSTANT = 1; + + //--------------------------------------------------------------------------------------------------------------- + // + // constructors + // + //--------------------------------------------------------------------------------------------------------------- + + /** + * Create a new RecalDatum with given observation and mismatch counts, and an reported quality + * + * @param _numObservations + * @param _numMismatches + * @param reportedQuality + */ + public RecalDatum(final long _numObservations, final long _numMismatches, final byte reportedQuality) { + if ( numObservations < 0 ) throw new IllegalArgumentException("numObservations < 0"); + if ( numMismatches < 0 ) throw new IllegalArgumentException("numMismatches < 0"); + if ( reportedQuality < 0 ) throw new IllegalArgumentException("reportedQuality < 0"); + + numObservations = _numObservations; + numMismatches = _numMismatches; + estimatedQReported = reportedQuality; + empiricalQuality = UNINITIALIZED; + } + + /** + * Copy copy into this recal datum, overwriting all of this objects data + * @param copy + */ + public RecalDatum(final RecalDatum copy) { + this.numObservations = copy.getNumObservations(); + this.numMismatches = copy.getNumMismatches(); + this.estimatedQReported = copy.estimatedQReported; + this.empiricalQuality = copy.empiricalQuality; + } + + /** + * Add in all of the data from other into this object, updating the reported quality from the expected + * error rate implied by the two reported qualities + * + * @param other + */ + public synchronized void combine(final RecalDatum other) { + final double sumErrors = this.calcExpectedErrors() + other.calcExpectedErrors(); + increment(other.getNumObservations(), other.getNumMismatches()); + estimatedQReported = -10 * Math.log10(sumErrors / getNumObservations()); + empiricalQuality = UNINITIALIZED; + } + + public synchronized void setEstimatedQReported(final double estimatedQReported) { + if ( estimatedQReported < 0 ) throw new IllegalArgumentException("estimatedQReported < 0"); + if ( Double.isInfinite(estimatedQReported) ) throw new IllegalArgumentException("estimatedQReported is infinite"); + if ( Double.isNaN(estimatedQReported) ) throw new IllegalArgumentException("estimatedQReported is NaN"); + + this.estimatedQReported = estimatedQReported; + } + + public static RecalDatum createRandomRecalDatum(int maxObservations, int maxErrors) { + final Random random = new Random(); + final int nObservations = random.nextInt(maxObservations); + final int nErrors = random.nextInt(maxErrors); + final int qual = random.nextInt(QualityUtils.MAX_QUAL_SCORE); + return new RecalDatum(nObservations, nErrors, (byte)qual); + } + + public final double getEstimatedQReported() { + return estimatedQReported; + } + public final byte getEstimatedQReportedAsByte() { + return (byte)(int)(Math.round(getEstimatedQReported())); + } + + //--------------------------------------------------------------------------------------------------------------- + // + // Empirical quality score -- derived from the num mismatches and observations + // + //--------------------------------------------------------------------------------------------------------------- + + /** + * Returns the error rate (in real space) of this interval, or 0 if there are no obserations + * @return the empirical error rate ~= N errors / N obs + */ + @Ensures("result >= 0.0") + public double getEmpiricalErrorRate() { + if ( numObservations == 0 ) + return 0.0; + else { + // cache the value so we don't call log over and over again + final double doubleMismatches = (double) (numMismatches + SMOOTHING_CONSTANT); + // smoothing is one error and one non-error observation, for example + final double doubleObservations = (double) (numObservations + SMOOTHING_CONSTANT + SMOOTHING_CONSTANT); + return doubleMismatches / doubleObservations; + } + } + + public synchronized void setEmpiricalQuality(final double empiricalQuality) { + if ( empiricalQuality < 0 ) throw new IllegalArgumentException("empiricalQuality < 0"); + if ( Double.isInfinite(empiricalQuality) ) throw new IllegalArgumentException("empiricalQuality is infinite"); + if ( Double.isNaN(empiricalQuality) ) throw new IllegalArgumentException("empiricalQuality is NaN"); + + this.empiricalQuality = empiricalQuality; + } + + public final double getEmpiricalQuality() { + if (empiricalQuality == UNINITIALIZED) + calcEmpiricalQuality(); + return empiricalQuality; + } + + public final byte getEmpiricalQualityAsByte() { + return (byte)(Math.round(getEmpiricalQuality())); + } + + //--------------------------------------------------------------------------------------------------------------- + // + // increment methods + // + //--------------------------------------------------------------------------------------------------------------- + + @Override + public String toString() { + return String.format("%d,%d,%d", getNumObservations(), getNumMismatches(), (byte) Math.floor(getEmpiricalQuality())); + } + + public String stringForCSV() { + return String.format("%s,%d,%.2f", toString(), (byte) Math.floor(getEstimatedQReported()), getEmpiricalQuality() - getEstimatedQReported()); + } + +// /** +// * We don't compare the estimated quality reported because it may be different when read from +// * report tables. +// * +// * @param o the other recal datum +// * @return true if the two recal datums have the same number of observations, errors and empirical quality. +// */ +// @Override +// public boolean equals(Object o) { +// if (!(o instanceof RecalDatum)) +// return false; +// RecalDatum other = (RecalDatum) o; +// return super.equals(o) && +// MathUtils.compareDoubles(this.empiricalQuality, other.empiricalQuality, 0.001) == 0; +// } + + //--------------------------------------------------------------------------------------------------------------- + // + // increment methods + // + //--------------------------------------------------------------------------------------------------------------- + + public long getNumObservations() { + return numObservations; + } + + public synchronized void setNumObservations(final long numObservations) { + if ( numObservations < 0 ) throw new IllegalArgumentException("numObservations < 0"); + this.numObservations = numObservations; + empiricalQuality = UNINITIALIZED; + } + + public long getNumMismatches() { + return numMismatches; + } + + @Requires({"numMismatches >= 0"}) + public synchronized void setNumMismatches(final long numMismatches) { + if ( numMismatches < 0 ) throw new IllegalArgumentException("numMismatches < 0"); + this.numMismatches = numMismatches; + empiricalQuality = UNINITIALIZED; + } + + @Requires({"by >= 0"}) + public synchronized void incrementNumObservations(final long by) { + numObservations += by; + empiricalQuality = UNINITIALIZED; + } + + @Requires({"by >= 0"}) + public synchronized void incrementNumMismatches(final long by) { + numMismatches += by; + empiricalQuality = UNINITIALIZED; + } + + @Requires({"incObservations >= 0", "incMismatches >= 0"}) + @Ensures({"numObservations == old(numObservations) + incObservations", "numMismatches == old(numMismatches) + incMismatches"}) + public synchronized void increment(final long incObservations, final long incMismatches) { + incrementNumObservations(incObservations); + incrementNumMismatches(incMismatches); + } + + @Ensures({"numObservations == old(numObservations) + 1", "numMismatches >= old(numMismatches)"}) + public synchronized void increment(final boolean isError) { + incrementNumObservations(1); + if ( isError ) + incrementNumMismatches(1); + } + + // ------------------------------------------------------------------------------------- + // + // Private implementation helper functions + // + // ------------------------------------------------------------------------------------- + + /** + * Calculate and cache the empirical quality score from mismatches and observations (expensive operation) + */ + @Requires("empiricalQuality == UNINITIALIZED") + @Ensures("empiricalQuality != UNINITIALIZED") + private synchronized final void calcEmpiricalQuality() { + final double empiricalQual = -10 * Math.log10(getEmpiricalErrorRate()); + empiricalQuality = Math.min(empiricalQual, (double) QualityUtils.MAX_RECALIBRATED_Q_SCORE); + } + + /** + * calculate the expected number of errors given the estimated Q reported and the number of observations + * in this datum. + * + * @return a positive (potentially fractional) estimate of the number of errors + */ + @Ensures("result >= 0.0") + private double calcExpectedErrors() { + return (double) getNumObservations() * QualityUtils.qualToErrorProb(estimatedQReported); + } +} diff --git a/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatumNode.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatumNode.java new file mode 100644 index 000000000..3af91be16 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatumNode.java @@ -0,0 +1,309 @@ +package org.broadinstitute.sting.utils.recalibration; + +import com.google.java.contract.Ensures; +import com.google.java.contract.Requires; +import org.apache.commons.math.stat.inference.ChiSquareTestImpl; +import org.apache.log4j.Logger; +import org.broadinstitute.sting.utils.MathUtils; +import org.broadinstitute.sting.utils.collections.Pair; + +import java.util.HashSet; +import java.util.Set; + +/** + * A tree of recal datum, where each contains a set of sub datum representing sub-states of the higher level one + * + * @author Mark DePristo + * @since 07/27/12 + */ +public class RecalDatumNode { + private final static boolean USE_CHI2 = true; + protected static Logger logger = Logger.getLogger(RecalDatumNode.class); + private final static double UNINITIALIZED = Double.NEGATIVE_INFINITY; + private final T recalDatum; + private double fixedPenalty = UNINITIALIZED; + private final Set> subnodes; + + public RecalDatumNode(final T recalDatum) { + this(recalDatum, new HashSet>()); + } + + @Override + public String toString() { + return recalDatum.toString(); + } + + public RecalDatumNode(final T recalDatum, final Set> subnodes) { + this(recalDatum, UNINITIALIZED, subnodes); + } + + protected RecalDatumNode(final T recalDatum, final double fixedPenalty) { + this(recalDatum, fixedPenalty, new HashSet>()); + } + + protected RecalDatumNode(final T recalDatum, final double fixedPenalty, final Set> subnodes) { + this.recalDatum = recalDatum; + this.fixedPenalty = fixedPenalty; + this.subnodes = new HashSet>(subnodes); + } + + public T getRecalDatum() { + return recalDatum; + } + + public Set> getSubnodes() { + return subnodes; + } + + public double getPenalty() { + if ( fixedPenalty != UNINITIALIZED ) + return fixedPenalty; + else + return calcPenalty(); + } + + public double calcAndSetFixedPenalty(final boolean doEntireTree) { + fixedPenalty = calcPenalty(); + if ( doEntireTree ) + for ( final RecalDatumNode sub : subnodes ) + sub.calcAndSetFixedPenalty(doEntireTree); + return fixedPenalty; + } + + public void addSubnode(final RecalDatumNode sub) { + subnodes.add(sub); + } + + public boolean isLeaf() { + return subnodes.isEmpty(); + } + + public int getNumBranches() { + return subnodes.size(); + } + + /** + * Total penalty is the sum of leaf node penalties + * + * This algorithm assumes that penalties have been fixed before pruning, as leaf nodes by + * definition have 0 penalty unless they represent a pruned tree with underlying -- but now + * pruned -- subtrees + * + * @return + */ + public double totalPenalty() { + if ( isLeaf() ) + return getPenalty(); + else { + double sum = 0.0; + for ( final RecalDatumNode sub : subnodes ) + sum += sub.totalPenalty(); + return sum; + } + } + + public int maxDepth() { + int subMax = 0; + for ( final RecalDatumNode sub : subnodes ) + subMax = Math.max(subMax, sub.maxDepth()); + return subMax + 1; + } + + public int minDepth() { + if ( isLeaf() ) + return 1; + else { + int subMin = Integer.MAX_VALUE; + for ( final RecalDatumNode sub : subnodes ) + subMin = Math.min(subMin, sub.minDepth()); + return subMin + 1; + } + } + + public int size() { + int size = 1; + for ( final RecalDatumNode sub : subnodes ) + size += sub.size(); + return size; + } + + public int numLeaves() { + if ( isLeaf() ) + return 1; + else { + int size = 0; + for ( final RecalDatumNode sub : subnodes ) + size += sub.numLeaves(); + return size; + } + } + + private double calcPenalty() { + if ( USE_CHI2 ) + return calcPenaltyChi2(); + else + return calcPenaltyLog10(getRecalDatum().getEmpiricalErrorRate()); + } + + private double calcPenaltyChi2() { + if ( isLeaf() ) + return 0.0; + else { + final long[][] counts = new long[subnodes.size()][2]; + + int i = 0; + for ( RecalDatumNode subnode : subnodes ) { + counts[i][0] = subnode.getRecalDatum().getNumMismatches(); + counts[i][1] = subnode.getRecalDatum().getNumObservations(); + i++; + } + + final double chi2 = new ChiSquareTestImpl().chiSquare(counts); + +// StringBuilder x = new StringBuilder(); +// StringBuilder y = new StringBuilder(); +// for ( int k = 0; k < counts.length; k++) { +// if ( k != 0 ) { +// x.append(", "); +// y.append(", "); +// } +// x.append(counts[k][0]); +// y.append(counts[k][1]); +// } +// logger.info("x = c(" + x.toString() + ")"); +// logger.info("y = c(" + y.toString() + ")"); +// logger.info("chi2 = " + chi2); + + return chi2; + //return Math.log10(chi2); + } + } + + /** + * Calculate the penalty of this interval, given the overall error rate for the interval + * + * If the globalErrorRate is e, this value is: + * + * sum_i |log10(e_i) - log10(e)| * nObservations_i + * + * each the index i applies to all leaves of the tree accessible from this interval + * (found recursively from subnodes as necessary) + * + * @param globalErrorRate overall error rate in real space against which we calculate the penalty + * @return the cost of approximating the bins in this interval with the globalErrorRate + */ + @Requires("globalErrorRate >= 0.0") + @Ensures("result >= 0.0") + private double calcPenaltyLog10(final double globalErrorRate) { + if ( globalErrorRate == 0.0 ) // there were no observations, so there's no penalty + return 0.0; + + if ( isLeaf() ) { + // this is leave node + return (Math.abs(Math.log10(recalDatum.getEmpiricalErrorRate()) - Math.log10(globalErrorRate))) * recalDatum.getNumObservations(); + // TODO -- how we can generalize this calculation? +// if ( this.qEnd <= minInterestingQual ) +// // It's free to merge up quality scores below the smallest interesting one +// return 0; +// else { +// return (Math.abs(Math.log10(getEmpiricalErrorRate()) - Math.log10(globalErrorRate))) * getNumObservations(); +// } + } else { + double sum = 0; + for ( final RecalDatumNode hrd : subnodes) + sum += hrd.calcPenaltyLog10(globalErrorRate); + return sum; + } + } + + public RecalDatumNode pruneToDepth(final int maxDepth) { + if ( maxDepth < 1 ) + throw new IllegalArgumentException("maxDepth < 1"); + else { + final Set> subPruned = new HashSet>(getNumBranches()); + if ( maxDepth > 1 ) + for ( final RecalDatumNode sub : subnodes ) + subPruned.add(sub.pruneToDepth(maxDepth - 1)); + return new RecalDatumNode(getRecalDatum(), fixedPenalty, subPruned); + } + } + + public RecalDatumNode pruneByPenalty(final int maxElements) { + RecalDatumNode root = this; + + while ( root.size() > maxElements ) { + // remove the lowest penalty element, and continue + root = root.removeLowestPenaltyNode(); + } + + // our size is below the target, so we are good, return + return root; + } + + /** + * Find the lowest penalty node in the tree, and return a tree without it + * + * Note this excludes the current (root) node + * + * @return + */ + private RecalDatumNode removeLowestPenaltyNode() { + final Pair, Double> nodeToRemove = getMinPenaltyNode(); + logger.info("Removing " + nodeToRemove.getFirst() + " with penalty " + nodeToRemove.getSecond()); + + final Pair, Boolean> result = removeNode(nodeToRemove.getFirst()); + + if ( ! result.getSecond() ) + throw new IllegalStateException("Never removed any node!"); + + final RecalDatumNode oneRemoved = result.getFirst(); + if ( oneRemoved == null ) + throw new IllegalStateException("Removed our root node, wow, didn't expect that"); + return oneRemoved; + } + + private Pair, Double> getMinPenaltyNode() { + final double myValue = isLeaf() ? Double.MAX_VALUE : getPenalty(); + Pair, Double> maxNode = new Pair, Double>(this, myValue); + + for ( final RecalDatumNode sub : subnodes ) { + final Pair, Double> subFind = sub.getMinPenaltyNode(); + if ( subFind.getSecond() < maxNode.getSecond() ) { + maxNode = subFind; + } + } + + return maxNode; + } + + private Pair, Boolean> removeNode(final RecalDatumNode nodeToRemove) { + if ( this == nodeToRemove ) { + if ( isLeaf() ) + throw new IllegalStateException("Trying to remove a leaf node from the tree! " + this + " " + nodeToRemove); + // node is the thing we are going to remove, but without any subnodes + final RecalDatumNode node = new RecalDatumNode(getRecalDatum(), fixedPenalty); + return new Pair, Boolean>(node, true); + } else { + // did we remove something in a sub branch? + boolean removedSomething = false; + + // our sub nodes with the penalty node removed + final Set> sub = new HashSet>(getNumBranches()); + + for ( final RecalDatumNode sub1 : subnodes ) { + if ( removedSomething ) { + // already removed something, just add sub1 back to sub + sub.add(sub1); + } else { + // haven't removed anything yet, so try + final Pair, Boolean> maybeRemoved = sub1.removeNode(nodeToRemove); + removedSomething = maybeRemoved.getSecond(); + sub.add(maybeRemoved.getFirst()); + } + } + + final RecalDatumNode node = new RecalDatumNode(getRecalDatum(), fixedPenalty, sub); + return new Pair, Boolean>(node, removedSomething); + } + } +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalDataManager.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java similarity index 96% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalDataManager.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java index f40a62d53..fe6ef7018 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalDataManager.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java @@ -23,11 +23,13 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; import org.apache.log4j.Logger; import org.broadinstitute.sting.gatk.report.GATKReport; import org.broadinstitute.sting.gatk.report.GATKReportTable; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; +import org.broadinstitute.sting.utils.recalibration.covariates.*; import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.R.RScriptExecutor; import org.broadinstitute.sting.utils.Utils; @@ -39,7 +41,6 @@ import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.io.Resource; -import org.broadinstitute.sting.utils.recalibration.RecalibrationTables; import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.ReadUtils; @@ -59,7 +60,7 @@ import java.util.*; * This class holds the parsing methods that are shared between CountCovariates and TableRecalibration. */ -public class RecalDataManager { +public class RecalUtils { public final static String ARGUMENT_REPORT_TABLE_TITLE = "Arguments"; public final static String QUANTIZED_REPORT_TABLE_TITLE = "Quantized"; public final static String READGROUP_REPORT_TABLE_TITLE = "RecalTable0"; @@ -85,13 +86,108 @@ public class RecalDataManager { private static final String SCRIPT_FILE = "BQSR.R"; - private static final Pair covariateValue = new Pair(RecalDataManager.COVARIATE_VALUE_COLUMN_NAME, "%s"); - private static final Pair covariateName = new Pair(RecalDataManager.COVARIATE_NAME_COLUMN_NAME, "%s"); - private static final Pair eventType = new Pair(RecalDataManager.EVENT_TYPE_COLUMN_NAME, "%s"); - private static final Pair empiricalQuality = new Pair(RecalDataManager.EMPIRICAL_QUALITY_COLUMN_NAME, "%.4f"); - private static final Pair estimatedQReported = new Pair(RecalDataManager.ESTIMATED_Q_REPORTED_COLUMN_NAME, "%.4f"); - private static final Pair nObservations = new Pair(RecalDataManager.NUMBER_OBSERVATIONS_COLUMN_NAME, "%d"); - private static final Pair nErrors = new Pair(RecalDataManager.NUMBER_ERRORS_COLUMN_NAME, "%d"); + private static final Pair covariateValue = new Pair(RecalUtils.COVARIATE_VALUE_COLUMN_NAME, "%s"); + private static final Pair covariateName = new Pair(RecalUtils.COVARIATE_NAME_COLUMN_NAME, "%s"); + private static final Pair eventType = new Pair(RecalUtils.EVENT_TYPE_COLUMN_NAME, "%s"); + private static final Pair empiricalQuality = new Pair(RecalUtils.EMPIRICAL_QUALITY_COLUMN_NAME, "%.4f"); + private static final Pair estimatedQReported = new Pair(RecalUtils.ESTIMATED_Q_REPORTED_COLUMN_NAME, "%.4f"); + private static final Pair nObservations = new Pair(RecalUtils.NUMBER_OBSERVATIONS_COLUMN_NAME, "%d"); + private static final Pair nErrors = new Pair(RecalUtils.NUMBER_ERRORS_COLUMN_NAME, "%d"); + + /** + * Generates two lists : required covariates and optional covariates based on the user's requests. + * + * Performs the following tasks in order: + * 1. Adds all requierd covariates in order + * 2. Check if the user asked to use the standard covariates and adds them all if that's the case + * 3. Adds all covariates requested by the user that were not already added by the two previous steps + * + * @param argumentCollection the argument collection object for the recalibration walker + * @return a pair of ordered lists : required covariates (first) and optional covariates (second) + */ + public static Pair, ArrayList> initializeCovariates(RecalibrationArgumentCollection argumentCollection) { + final List> covariateClasses = new PluginManager(Covariate.class).getPlugins(); + final List> requiredClasses = new PluginManager(RequiredCovariate.class).getPlugins(); + final List> standardClasses = new PluginManager(StandardCovariate.class).getPlugins(); + + final ArrayList requiredCovariates = addRequiredCovariatesToList(requiredClasses); // add the required covariates + ArrayList optionalCovariates = new ArrayList(); + if (!argumentCollection.DO_NOT_USE_STANDARD_COVARIATES) + optionalCovariates = addStandardCovariatesToList(standardClasses); // add the standard covariates if -standard was specified by the user + + if (argumentCollection.COVARIATES != null) { // parse the -cov arguments that were provided, skipping over the ones already specified + for (String requestedCovariateString : argumentCollection.COVARIATES) { + boolean foundClass = false; + for (Class covClass : covariateClasses) { + if (requestedCovariateString.equalsIgnoreCase(covClass.getSimpleName())) { // -cov argument matches the class name for an implementing class + foundClass = true; + if (!requiredClasses.contains(covClass) && + (argumentCollection.DO_NOT_USE_STANDARD_COVARIATES || !standardClasses.contains(covClass))) { + try { + final Covariate covariate = covClass.newInstance(); // now that we've found a matching class, try to instantiate it + optionalCovariates.add(covariate); + } catch (Exception e) { + throw new DynamicClassResolutionException(covClass, e); + } + } + } + } + + if (!foundClass) { + throw new UserException.CommandLineException("The requested covariate type (" + requestedCovariateString + ") isn't a valid covariate option. Use --list to see possible covariates."); + } + } + } + return new Pair, ArrayList>(requiredCovariates, optionalCovariates); + } + + /** + * Adds the required covariates to a covariate list + * + * Note: this method really only checks if the classes object has the expected number of required covariates, then add them by hand. + * + * @param classes list of classes to add to the covariate list + * @return the covariate list + */ + private static ArrayList addRequiredCovariatesToList(List> classes) { + ArrayList dest = new ArrayList(classes.size()); + if (classes.size() != 2) + throw new ReviewedStingException("The number of required covariates has changed, this is a hard change in the code and needs to be inspected"); + + dest.add(new ReadGroupCovariate()); // enforce the order with RG first and QS next. + dest.add(new QualityScoreCovariate()); + return dest; + } + + /** + * Adds the standard covariates to a covariate list + * + * @param classes list of classes to add to the covariate list + * @return the covariate list + */ + private static ArrayList addStandardCovariatesToList(List> classes) { + ArrayList dest = new ArrayList(classes.size()); + for (Class covClass : classes) { + try { + final Covariate covariate = (Covariate) covClass.newInstance(); + dest.add(covariate); + } catch (Exception e) { + throw new DynamicClassResolutionException(covClass, e); + } + } + return dest; + } + + public static void listAvailableCovariates(Logger logger) { + // Get a list of all available covariates + final List> covariateClasses = new PluginManager(Covariate.class).getPlugins(); + + // Print and exit if that's what was requested + logger.info("Available covariates:"); + for (Class covClass : covariateClasses) + logger.info(covClass.getSimpleName()); + logger.info(""); + } public enum SOLID_RECAL_MODE { @@ -152,64 +248,6 @@ public class RecalDataManager { } } - /** - * Generates two lists : required covariates and optional covariates based on the user's requests. - * - * Performs the following tasks in order: - * 1. Adds all requierd covariates in order - * 2. Check if the user asked to use the standard covariates and adds them all if that's the case - * 3. Adds all covariates requested by the user that were not already added by the two previous steps - * - * @param argumentCollection the argument collection object for the recalibration walker - * @return a pair of ordered lists : required covariates (first) and optional covariates (second) - */ - public static Pair, ArrayList> initializeCovariates(RecalibrationArgumentCollection argumentCollection) { - final List> covariateClasses = new PluginManager(Covariate.class).getPlugins(); - final List> requiredClasses = new PluginManager(RequiredCovariate.class).getPlugins(); - final List> standardClasses = new PluginManager(StandardCovariate.class).getPlugins(); - - final ArrayList requiredCovariates = addRequiredCovariatesToList(requiredClasses); // add the required covariates - ArrayList optionalCovariates = new ArrayList(); - if (!argumentCollection.DO_NOT_USE_STANDARD_COVARIATES) - optionalCovariates = addStandardCovariatesToList(standardClasses); // add the standard covariates if -standard was specified by the user - - if (argumentCollection.COVARIATES != null) { // parse the -cov arguments that were provided, skipping over the ones already specified - for (String requestedCovariateString : argumentCollection.COVARIATES) { - boolean foundClass = false; - for (Class covClass : covariateClasses) { - if (requestedCovariateString.equalsIgnoreCase(covClass.getSimpleName())) { // -cov argument matches the class name for an implementing class - foundClass = true; - if (!requiredClasses.contains(covClass) && - (argumentCollection.DO_NOT_USE_STANDARD_COVARIATES || !standardClasses.contains(covClass))) { - try { - final Covariate covariate = covClass.newInstance(); // now that we've found a matching class, try to instantiate it - optionalCovariates.add(covariate); - } catch (Exception e) { - throw new DynamicClassResolutionException(covClass, e); - } - } - } - } - - if (!foundClass) { - throw new UserException.CommandLineException("The requested covariate type (" + requestedCovariateString + ") isn't a valid covariate option. Use --list to see possible covariates."); - } - } - } - return new Pair, ArrayList>(requiredCovariates, optionalCovariates); - } - - public static void listAvailableCovariates(Logger logger) { - // Get a list of all available covariates - final List> covariateClasses = new PluginManager(Covariate.class).getPlugins(); - - // Print and exit if that's what was requested - logger.info("Available covariates:"); - for (Class covClass : covariateClasses) - logger.info(covClass.getSimpleName()); - logger.info(""); - } - private static List generateReportTables(final RecalibrationTables recalibrationTables, final Covariate[] requestedCovariates) { List result = new LinkedList(); int reportTableIndex = 0; @@ -272,8 +310,8 @@ public class RecalDataManager { reportTable.set(rowIndex, columnNames.get(columnIndex++).getFirst(), datum.getEmpiricalQuality()); if (tableIndex == RecalibrationTables.TableType.READ_GROUP_TABLE.index) reportTable.set(rowIndex, columnNames.get(columnIndex++).getFirst(), datum.getEstimatedQReported()); // we only add the estimated Q reported in the RG table - reportTable.set(rowIndex, columnNames.get(columnIndex++).getFirst(), datum.numObservations); - reportTable.set(rowIndex, columnNames.get(columnIndex).getFirst(), datum.numMismatches); + reportTable.set(rowIndex, columnNames.get(columnIndex++).getFirst(), datum.getNumObservations()); + reportTable.set(rowIndex, columnNames.get(columnIndex).getFirst(), datum.getNumMismatches()); rowIndex++; } @@ -320,7 +358,7 @@ public class RecalDataManager { files.getFirst().close(); final RScriptExecutor executor = new RScriptExecutor(); - executor.addScript(new Resource(SCRIPT_FILE, RecalDataManager.class)); + executor.addScript(new Resource(SCRIPT_FILE, RecalUtils.class)); executor.addArgs(csvFileName.getAbsolutePath()); executor.addArgs(plotFileName.getAbsolutePath()); executor.exec(); @@ -480,14 +518,14 @@ public class RecalDataManager { */ public static boolean isColorSpaceConsistent(final SOLID_NOCALL_STRATEGY strategy, final GATKSAMRecord read) { if (ReadUtils.isSOLiDRead(read)) { // If this is a SOLID read then we have to check if the color space is inconsistent. This is our only sign that SOLID has inserted the reference base - if (read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG) == null) { // Haven't calculated the inconsistency array yet for this read - final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG); + if (read.getAttribute(RecalUtils.COLOR_SPACE_INCONSISTENCY_TAG) == null) { // Haven't calculated the inconsistency array yet for this read + final Object attr = read.getAttribute(RecalUtils.COLOR_SPACE_ATTRIBUTE_TAG); if (attr != null) { byte[] colorSpace; if (attr instanceof String) colorSpace = ((String) attr).getBytes(); else - throw new UserException.MalformedBAM(read, String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName())); + throw new UserException.MalformedBAM(read, String.format("Value encoded by %s in %s isn't a string!", RecalUtils.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName())); byte[] readBases = read.getReadBases(); // Loop over the read and calculate first the inferred bases from the color and then check if it is consistent with the read if (read.getReadNegativeStrandFlag()) @@ -501,7 +539,7 @@ public class RecalDataManager { inconsistency[i] = (byte) (thisBase == readBases[i] ? 0 : 1); prevBase = readBases[i]; } - read.setAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG, inconsistency); + read.setAttribute(RecalUtils.COLOR_SPACE_INCONSISTENCY_TAG, inconsistency); } else if (strategy == SOLID_NOCALL_STRATEGY.THROW_EXCEPTION) // if the strategy calls for an exception, throw it throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() + " Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias."); @@ -545,7 +583,7 @@ public class RecalDataManager { * @return Returns true if the base was inconsistent with the color space */ public static boolean isColorSpaceConsistent(final GATKSAMRecord read, final int offset) { - final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG); + final Object attr = read.getAttribute(RecalUtils.COLOR_SPACE_INCONSISTENCY_TAG); if (attr != null) { final byte[] inconsistency = (byte[]) attr; // NOTE: The inconsistency array is in the direction of the read, not aligned to the reference! @@ -691,40 +729,4 @@ public class RecalDataManager { } - /** - * Adds the required covariates to a covariate list - * - * Note: this method really only checks if the classes object has the expected number of required covariates, then add them by hand. - * - * @param classes list of classes to add to the covariate list - * @return the covariate list - */ - private static ArrayList addRequiredCovariatesToList(List> classes) { - ArrayList dest = new ArrayList(classes.size()); - if (classes.size() != 2) - throw new ReviewedStingException("The number of required covariates has changed, this is a hard change in the code and needs to be inspected"); - - dest.add(new ReadGroupCovariate()); // enforce the order with RG first and QS next. - dest.add(new QualityScoreCovariate()); - return dest; - } - - /** - * Adds the standard covariates to a covariate list - * - * @param classes list of classes to add to the covariate list - * @return the covariate list - */ - private static ArrayList addStandardCovariatesToList(List> classes) { - ArrayList dest = new ArrayList(classes.size()); - for (Class covClass : classes) { - try { - final Covariate covariate = (Covariate) covClass.newInstance(); - dest.add(covariate); - } catch (Exception e) { - throw new DynamicClassResolutionException(covClass, e); - } - } - return dest; - } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationReport.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationReport.java similarity index 82% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationReport.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationReport.java index e69cf4d69..e6ab9e38b 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationReport.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationReport.java @@ -1,11 +1,12 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; import org.broadinstitute.sting.gatk.report.GATKReport; import org.broadinstitute.sting.gatk.report.GATKReportTable; +import org.broadinstitute.sting.gatk.walkers.bqsr.*; +import org.broadinstitute.sting.utils.recalibration.covariates.Covariate; import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.sting.utils.collections.NestedIntegerArray; import org.broadinstitute.sting.utils.collections.Pair; -import org.broadinstitute.sting.utils.recalibration.RecalibrationTables; import java.io.File; import java.io.PrintStream; @@ -33,13 +34,13 @@ public class RecalibrationReport { public RecalibrationReport(final File RECAL_FILE) { final GATKReport report = new GATKReport(RECAL_FILE); - argumentTable = report.getTable(RecalDataManager.ARGUMENT_REPORT_TABLE_TITLE); + argumentTable = report.getTable(RecalUtils.ARGUMENT_REPORT_TABLE_TITLE); RAC = initializeArgumentCollectionTable(argumentTable); - GATKReportTable quantizedTable = report.getTable(RecalDataManager.QUANTIZED_REPORT_TABLE_TITLE); + GATKReportTable quantizedTable = report.getTable(RecalUtils.QUANTIZED_REPORT_TABLE_TITLE); quantizationInfo = initializeQuantizationTable(quantizedTable); - Pair, ArrayList> covariates = RecalDataManager.initializeCovariates(RAC); // initialize the required and optional covariates + Pair, ArrayList> covariates = RecalUtils.initializeCovariates(RAC); // initialize the required and optional covariates ArrayList requiredCovariates = covariates.getFirst(); ArrayList optionalCovariates = covariates.getSecond(); requestedCovariates = new Covariate[requiredCovariates.size() + optionalCovariates.size()]; @@ -57,13 +58,13 @@ public class RecalibrationReport { for (Covariate cov : requestedCovariates) cov.initialize(RAC); // initialize any covariate member variables using the shared argument collection - recalibrationTables = new RecalibrationTables(requestedCovariates, countReadGroups(report.getTable(RecalDataManager.READGROUP_REPORT_TABLE_TITLE))); + recalibrationTables = new RecalibrationTables(requestedCovariates, countReadGroups(report.getTable(RecalUtils.READGROUP_REPORT_TABLE_TITLE))); - parseReadGroupTable(report.getTable(RecalDataManager.READGROUP_REPORT_TABLE_TITLE), recalibrationTables.getTable(RecalibrationTables.TableType.READ_GROUP_TABLE)); + parseReadGroupTable(report.getTable(RecalUtils.READGROUP_REPORT_TABLE_TITLE), recalibrationTables.getTable(RecalibrationTables.TableType.READ_GROUP_TABLE)); - parseQualityScoreTable(report.getTable(RecalDataManager.QUALITY_SCORE_REPORT_TABLE_TITLE), recalibrationTables.getTable(RecalibrationTables.TableType.QUALITY_SCORE_TABLE)); + parseQualityScoreTable(report.getTable(RecalUtils.QUALITY_SCORE_REPORT_TABLE_TITLE), recalibrationTables.getTable(RecalibrationTables.TableType.QUALITY_SCORE_TABLE)); - parseAllCovariatesTable(report.getTable(RecalDataManager.ALL_COVARIATES_REPORT_TABLE_TITLE), recalibrationTables); + parseAllCovariatesTable(report.getTable(RecalUtils.ALL_COVARIATES_REPORT_TABLE_TITLE), recalibrationTables); } @@ -85,7 +86,7 @@ public class RecalibrationReport { private int countReadGroups(final GATKReportTable reportTable) { Set readGroups = new HashSet(); for ( int i = 0; i < reportTable.getNumRows(); i++ ) - readGroups.add(reportTable.get(i, RecalDataManager.READGROUP_COLUMN_NAME).toString()); + readGroups.add(reportTable.get(i, RecalUtils.READGROUP_COLUMN_NAME).toString()); return readGroups.size(); } @@ -139,17 +140,17 @@ public class RecalibrationReport { \ */ private void parseAllCovariatesTable(final GATKReportTable reportTable, final RecalibrationTables recalibrationTables) { for ( int i = 0; i < reportTable.getNumRows(); i++ ) { - final Object rg = reportTable.get(i, RecalDataManager.READGROUP_COLUMN_NAME); + final Object rg = reportTable.get(i, RecalUtils.READGROUP_COLUMN_NAME); tempCOVarray[0] = requestedCovariates[0].keyFromValue(rg); - final Object qual = reportTable.get(i, RecalDataManager.QUALITY_SCORE_COLUMN_NAME); + final Object qual = reportTable.get(i, RecalUtils.QUALITY_SCORE_COLUMN_NAME); tempCOVarray[1] = requestedCovariates[1].keyFromValue(qual); - final String covName = (String)reportTable.get(i, RecalDataManager.COVARIATE_NAME_COLUMN_NAME); + final String covName = (String)reportTable.get(i, RecalUtils.COVARIATE_NAME_COLUMN_NAME); final int covIndex = optionalCovariateIndexes.get(covName); - final Object covValue = reportTable.get(i, RecalDataManager.COVARIATE_VALUE_COLUMN_NAME); + final Object covValue = reportTable.get(i, RecalUtils.COVARIATE_VALUE_COLUMN_NAME); tempCOVarray[2] = requestedCovariates[RecalibrationTables.TableType.OPTIONAL_COVARIATE_TABLES_START.index + covIndex].keyFromValue(covValue); - final EventType event = EventType.eventFrom((String)reportTable.get(i, RecalDataManager.EVENT_TYPE_COLUMN_NAME)); + final EventType event = EventType.eventFrom((String)reportTable.get(i, RecalUtils.EVENT_TYPE_COLUMN_NAME)); tempCOVarray[3] = event.index; recalibrationTables.getTable(RecalibrationTables.TableType.OPTIONAL_COVARIATE_TABLES_START.index + covIndex).put(getRecalDatum(reportTable, i, false), tempCOVarray); @@ -164,11 +165,11 @@ public class RecalibrationReport { */ private void parseQualityScoreTable(final GATKReportTable reportTable, final NestedIntegerArray qualTable) { for ( int i = 0; i < reportTable.getNumRows(); i++ ) { - final Object rg = reportTable.get(i, RecalDataManager.READGROUP_COLUMN_NAME); + final Object rg = reportTable.get(i, RecalUtils.READGROUP_COLUMN_NAME); tempQUALarray[0] = requestedCovariates[0].keyFromValue(rg); - final Object qual = reportTable.get(i, RecalDataManager.QUALITY_SCORE_COLUMN_NAME); + final Object qual = reportTable.get(i, RecalUtils.QUALITY_SCORE_COLUMN_NAME); tempQUALarray[1] = requestedCovariates[1].keyFromValue(qual); - final EventType event = EventType.eventFrom((String)reportTable.get(i, RecalDataManager.EVENT_TYPE_COLUMN_NAME)); + final EventType event = EventType.eventFrom((String)reportTable.get(i, RecalUtils.EVENT_TYPE_COLUMN_NAME)); tempQUALarray[2] = event.index; qualTable.put(getRecalDatum(reportTable, i, false), tempQUALarray); @@ -183,9 +184,9 @@ public class RecalibrationReport { */ private void parseReadGroupTable(final GATKReportTable reportTable, final NestedIntegerArray rgTable) { for ( int i = 0; i < reportTable.getNumRows(); i++ ) { - final Object rg = reportTable.get(i, RecalDataManager.READGROUP_COLUMN_NAME); + final Object rg = reportTable.get(i, RecalUtils.READGROUP_COLUMN_NAME); tempRGarray[0] = requestedCovariates[0].keyFromValue(rg); - final EventType event = EventType.eventFrom((String)reportTable.get(i, RecalDataManager.EVENT_TYPE_COLUMN_NAME)); + final EventType event = EventType.eventFrom((String)reportTable.get(i, RecalUtils.EVENT_TYPE_COLUMN_NAME)); tempRGarray[1] = event.index; rgTable.put(getRecalDatum(reportTable, i, true), tempRGarray); @@ -193,13 +194,13 @@ public class RecalibrationReport { } private RecalDatum getRecalDatum(final GATKReportTable reportTable, final int row, final boolean hasEstimatedQReportedColumn) { - final long nObservations = (Long) reportTable.get(row, RecalDataManager.NUMBER_OBSERVATIONS_COLUMN_NAME); - final long nErrors = (Long) reportTable.get(row, RecalDataManager.NUMBER_ERRORS_COLUMN_NAME); - final double empiricalQuality = (Double) reportTable.get(row, RecalDataManager.EMPIRICAL_QUALITY_COLUMN_NAME); + final long nObservations = (Long) reportTable.get(row, RecalUtils.NUMBER_OBSERVATIONS_COLUMN_NAME); + final long nErrors = (Long) reportTable.get(row, RecalUtils.NUMBER_ERRORS_COLUMN_NAME); + final double empiricalQuality = (Double) reportTable.get(row, RecalUtils.EMPIRICAL_QUALITY_COLUMN_NAME); final double estimatedQReported = hasEstimatedQReportedColumn ? // the estimatedQreported column only exists in the ReadGroup table - (Double) reportTable.get(row, RecalDataManager.ESTIMATED_Q_REPORTED_COLUMN_NAME) : // we get it if we are in the read group table - Byte.parseByte((String) reportTable.get(row, RecalDataManager.QUALITY_SCORE_COLUMN_NAME)); // or we use the reported quality if we are in any other table + (Double) reportTable.get(row, RecalUtils.ESTIMATED_Q_REPORTED_COLUMN_NAME) : // we get it if we are in the read group table + Byte.parseByte((String) reportTable.get(row, RecalUtils.QUALITY_SCORE_COLUMN_NAME)); // or we use the reported quality if we are in any other table final RecalDatum datum = new RecalDatum(nObservations, nErrors, (byte)1); datum.setEstimatedQReported(estimatedQReported); @@ -218,8 +219,8 @@ public class RecalibrationReport { final Long[] counts = new Long[QualityUtils.MAX_QUAL_SCORE + 1]; for ( int i = 0; i < table.getNumRows(); i++ ) { final byte originalQual = (byte)i; - final Object quantizedObject = table.get(i, RecalDataManager.QUANTIZED_VALUE_COLUMN_NAME); - final Object countObject = table.get(i, RecalDataManager.QUANTIZED_COUNT_COLUMN_NAME); + final Object quantizedObject = table.get(i, RecalUtils.QUANTIZED_VALUE_COLUMN_NAME); + final Object countObject = table.get(i, RecalUtils.QUANTIZED_COUNT_COLUMN_NAME); final byte quantizedQual = Byte.parseByte(quantizedObject.toString()); final long quantizedCount = Long.parseLong(countObject.toString()); quals[originalQual] = quantizedQual; @@ -239,7 +240,7 @@ public class RecalibrationReport { for ( int i = 0; i < table.getNumRows(); i++ ) { final String argument = table.get(i, "Argument").toString(); - Object value = table.get(i, RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME); + Object value = table.get(i, RecalUtils.ARGUMENT_VALUE_COLUMN_NAME); if (value.equals("null")) value = null; // generic translation of null values that were printed out as strings | todo -- add this capability to the GATKReport @@ -250,10 +251,10 @@ public class RecalibrationReport { RAC.DO_NOT_USE_STANDARD_COVARIATES = Boolean.parseBoolean((String) value); else if (argument.equals("solid_recal_mode")) - RAC.SOLID_RECAL_MODE = RecalDataManager.SOLID_RECAL_MODE.recalModeFromString((String) value); + RAC.SOLID_RECAL_MODE = RecalUtils.SOLID_RECAL_MODE.recalModeFromString((String) value); else if (argument.equals("solid_nocall_strategy")) - RAC.SOLID_NOCALL_STRATEGY = RecalDataManager.SOLID_NOCALL_STRATEGY.nocallStrategyFromString((String) value); + RAC.SOLID_NOCALL_STRATEGY = RecalUtils.SOLID_NOCALL_STRATEGY.nocallStrategyFromString((String) value); else if (argument.equals("mismatches_context_size")) RAC.MISMATCHES_CONTEXT_SIZE = Integer.parseInt((String) value); @@ -307,7 +308,7 @@ public class RecalibrationReport { } public void output(PrintStream output) { - RecalDataManager.outputRecalibrationReport(argumentTable, quantizationInfo, recalibrationTables, requestedCovariates, output); + RecalUtils.outputRecalibrationReport(argumentTable, quantizationInfo, recalibrationTables, requestedCovariates, output); } public RecalibrationArgumentCollection getRAC() { diff --git a/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationTables.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationTables.java index 0416b5eb9..f37e69c9a 100644 --- a/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationTables.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationTables.java @@ -25,9 +25,7 @@ package org.broadinstitute.sting.utils.recalibration; -import org.broadinstitute.sting.gatk.walkers.bqsr.Covariate; -import org.broadinstitute.sting.gatk.walkers.bqsr.EventType; -import org.broadinstitute.sting.gatk.walkers.bqsr.RecalDatum; +import org.broadinstitute.sting.utils.recalibration.covariates.Covariate; import org.broadinstitute.sting.utils.collections.NestedIntegerArray; /** diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BinaryTagCovariate.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/BinaryTagCovariate.java similarity index 89% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BinaryTagCovariate.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/BinaryTagCovariate.java index a89586c2c..cebdebf9d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BinaryTagCovariate.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/BinaryTagCovariate.java @@ -1,5 +1,7 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration.covariates; +import org.broadinstitute.sting.utils.recalibration.ReadCovariates; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/ContextCovariate.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/ContextCovariate.java similarity index 98% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/ContextCovariate.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/ContextCovariate.java index 5fe8809fb..4c20284d9 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/ContextCovariate.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/ContextCovariate.java @@ -23,8 +23,10 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration.covariates; +import org.broadinstitute.sting.utils.recalibration.ReadCovariates; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.clipping.ClippingRepresentation; import org.broadinstitute.sting.utils.clipping.ReadClipper; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/Covariate.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/Covariate.java similarity index 94% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/Covariate.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/Covariate.java index 1ad5346fa..c613135bb 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/Covariate.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/Covariate.java @@ -1,5 +1,7 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration.covariates; +import org.broadinstitute.sting.utils.recalibration.ReadCovariates; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; /* @@ -89,8 +91,3 @@ public interface Covariate { public int maximumKeyValue(); } -interface RequiredCovariate extends Covariate {} - -interface StandardCovariate extends Covariate {} - -interface ExperimentalCovariate extends Covariate {} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/CycleCovariate.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/CycleCovariate.java similarity index 97% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/CycleCovariate.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/CycleCovariate.java index f0ff8f2bd..4f15419c7 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/CycleCovariate.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/CycleCovariate.java @@ -1,5 +1,7 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration.covariates; +import org.broadinstitute.sting.utils.recalibration.ReadCovariates; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.NGSPlatform; import org.broadinstitute.sting.utils.exceptions.UserException; diff --git a/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/ExperimentalCovariate.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/ExperimentalCovariate.java new file mode 100644 index 000000000..72df2a410 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/ExperimentalCovariate.java @@ -0,0 +1,30 @@ +package org.broadinstitute.sting.utils.recalibration.covariates; + +/** + * [Short one sentence description of this walker] + *

+ *

+ * [Functionality of this walker] + *

+ *

+ *

Input

+ *

+ * [Input description] + *

+ *

+ *

Output

+ *

+ * [Output description] + *

+ *

+ *

Examples

+ *
+ *    java
+ *      -jar GenomeAnalysisTK.jar
+ *      -T $WalkerName
+ *  
+ * + * @author Your Name + * @since Date created + */ +public interface ExperimentalCovariate extends Covariate {} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/QualityScoreCovariate.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/QualityScoreCovariate.java similarity index 92% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/QualityScoreCovariate.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/QualityScoreCovariate.java index dd7060ff8..3ef8ee931 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/QualityScoreCovariate.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/QualityScoreCovariate.java @@ -1,5 +1,7 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration.covariates; +import org.broadinstitute.sting.utils.recalibration.ReadCovariates; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/ReadGroupCovariate.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/ReadGroupCovariate.java similarity index 94% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/ReadGroupCovariate.java rename to public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/ReadGroupCovariate.java index f04d27b7a..85568dac9 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/ReadGroupCovariate.java +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/ReadGroupCovariate.java @@ -1,5 +1,7 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration.covariates; +import org.broadinstitute.sting.utils.recalibration.ReadCovariates; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RequiredCovariate.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RequiredCovariate.java new file mode 100644 index 000000000..50755dbcf --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RequiredCovariate.java @@ -0,0 +1,30 @@ +package org.broadinstitute.sting.utils.recalibration.covariates; + +/** + * [Short one sentence description of this walker] + *

+ *

+ * [Functionality of this walker] + *

+ *

+ *

Input

+ *

+ * [Input description] + *

+ *

+ *

Output

+ *

+ * [Output description] + *

+ *

+ *

Examples

+ *
+ *    java
+ *      -jar GenomeAnalysisTK.jar
+ *      -T $WalkerName
+ *  
+ * + * @author Your Name + * @since Date created + */ +public interface RequiredCovariate extends Covariate {} diff --git a/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/StandardCovariate.java b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/StandardCovariate.java new file mode 100644 index 000000000..444954f25 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/recalibration/covariates/StandardCovariate.java @@ -0,0 +1,30 @@ +package org.broadinstitute.sting.utils.recalibration.covariates; + +/** + * [Short one sentence description of this walker] + *

+ *

+ * [Functionality of this walker] + *

+ *

+ *

Input

+ *

+ * [Input description] + *

+ *

+ *

Output

+ *

+ * [Output description] + *

+ *

+ *

Examples

+ *
+ *    java
+ *      -jar GenomeAnalysisTK.jar
+ *      -T $WalkerName
+ *  
+ * + * @author Your Name + * @since Date created + */ +public interface StandardCovariate extends Covariate {} diff --git a/public/java/src/org/broadinstitute/sting/utils/sam/AlignmentUtils.java b/public/java/src/org/broadinstitute/sting/utils/sam/AlignmentUtils.java index 895de3578..2c388a1e0 100644 --- a/public/java/src/org/broadinstitute/sting/utils/sam/AlignmentUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/sam/AlignmentUtils.java @@ -30,12 +30,12 @@ import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; import net.sf.samtools.SAMRecord; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; -import org.broadinstitute.sting.gatk.walkers.bqsr.EventType; import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; +import org.broadinstitute.sting.utils.recalibration.EventType; import java.util.ArrayList; import java.util.Arrays; @@ -476,7 +476,6 @@ public class AlignmentUtils { } break; case D: - case N: if (!isDeletion) { alignmentPos += elementLength; } else { @@ -498,6 +497,7 @@ public class AlignmentUtils { break; case H: case P: + case N: break; default: throw new ReviewedStingException("Unsupported cigar operator: " + ce.getOperator()); @@ -516,16 +516,13 @@ public class AlignmentUtils { final int elementLength = ce.getLength(); switch (ce.getOperator()) { - case I: - case S: - break; case D: case N: - alignmentLength += elementLength; - break; case M: alignmentLength += elementLength; break; + case I: + case S: case H: case P: break; diff --git a/public/java/src/org/broadinstitute/sting/utils/sam/GATKSAMRecord.java b/public/java/src/org/broadinstitute/sting/utils/sam/GATKSAMRecord.java index 659615cf4..c9b3a2df8 100755 --- a/public/java/src/org/broadinstitute/sting/utils/sam/GATKSAMRecord.java +++ b/public/java/src/org/broadinstitute/sting/utils/sam/GATKSAMRecord.java @@ -25,7 +25,7 @@ package org.broadinstitute.sting.utils.sam; import net.sf.samtools.*; -import org.broadinstitute.sting.gatk.walkers.bqsr.EventType; +import org.broadinstitute.sting.utils.recalibration.EventType; import org.broadinstitute.sting.utils.NGSPlatform; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; diff --git a/public/java/src/org/broadinstitute/sting/utils/variantcontext/VariantContext.java b/public/java/src/org/broadinstitute/sting/utils/variantcontext/VariantContext.java index 979400350..2211cfe5e 100755 --- a/public/java/src/org/broadinstitute/sting/utils/variantcontext/VariantContext.java +++ b/public/java/src/org/broadinstitute/sting/utils/variantcontext/VariantContext.java @@ -334,12 +334,14 @@ public class VariantContext implements Feature { // to enable tribble integratio * in this VC is returned as the set of alleles in the subContext, even if * some of those alleles aren't in the samples * + * WARNING: BE CAREFUL WITH rederiveAllelesFromGenotypes UNLESS YOU KNOW WHAT YOU ARE DOING? + * * @param sampleNames the sample names - * @param rederiveAllelesFromGenotypes if true, returns the alleles to just those in use by the samples + * @param rederiveAllelesFromGenotypes if true, returns the alleles to just those in use by the samples, true should be default * @return new VariantContext subsetting to just the given samples */ public VariantContext subContextFromSamples(Set sampleNames, final boolean rederiveAllelesFromGenotypes ) { - if ( sampleNames.containsAll(getSampleNames()) ) { + if ( sampleNames.containsAll(getSampleNames()) && ! rederiveAllelesFromGenotypes ) { return this; // fast path when you don't have any work to do } else { VariantContextBuilder builder = new VariantContextBuilder(this); @@ -355,8 +357,18 @@ public class VariantContext implements Feature { // to enable tribble integratio } } + /** + * @see #subContextFromSamples(java.util.Set, boolean) with rederiveAllelesFromGenotypes = true + * + * @param sampleNames + * @return + */ + public VariantContext subContextFromSamples(final Set sampleNames) { + return subContextFromSamples(sampleNames, true); + } + public VariantContext subContextFromSample(String sampleName) { - return subContextFromSamples(Collections.singleton(sampleName), true); + return subContextFromSamples(Collections.singleton(sampleName)); } /** diff --git a/public/java/src/org/broadinstitute/sting/utils/variantcontext/writer/BCF2Writer.java b/public/java/src/org/broadinstitute/sting/utils/variantcontext/writer/BCF2Writer.java index b5da206ad..32377d09e 100644 --- a/public/java/src/org/broadinstitute/sting/utils/variantcontext/writer/BCF2Writer.java +++ b/public/java/src/org/broadinstitute/sting/utils/variantcontext/writer/BCF2Writer.java @@ -31,6 +31,7 @@ import org.apache.log4j.Logger; import org.broadinstitute.sting.utils.codecs.bcf2.BCF2Codec; import org.broadinstitute.sting.utils.codecs.bcf2.BCF2Type; import org.broadinstitute.sting.utils.codecs.bcf2.BCF2Utils; +import org.broadinstitute.sting.utils.codecs.bcf2.BCFVersion; import org.broadinstitute.sting.utils.codecs.vcf.*; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; @@ -83,6 +84,9 @@ import java.util.*; * @since 06/12 */ class BCF2Writer extends IndexingVariantContextWriter { + public static final int MAJOR_VERSION = 2; + public static final int MINOR_VERSION = 1; + /** * If true, we will write out the undecoded raw bytes for a genotypes block, if it * is found in the input VC. This can be very dangerous as the genotype encoding @@ -153,7 +157,7 @@ class BCF2Writer extends IndexingVariantContextWriter { writer.close(); final byte[] headerBytes = capture.toByteArray(); - outputStream.write(BCF2Utils.MAGIC_HEADER_LINE); + new BCFVersion(MAJOR_VERSION, MINOR_VERSION).write(outputStream); BCF2Utils.encodeRawBytes(headerBytes.length, BCF2Type.INT32, outputStream); outputStream.write(headerBytes); } catch (IOException e) { diff --git a/public/java/test/org/broadinstitute/sting/BaseTest.java b/public/java/test/org/broadinstitute/sting/BaseTest.java index af4891856..76e25a3c0 100755 --- a/public/java/test/org/broadinstitute/sting/BaseTest.java +++ b/public/java/test/org/broadinstitute/sting/BaseTest.java @@ -282,12 +282,12 @@ public abstract class BaseTest { private static final double DEFAULT_FLOAT_TOLERANCE = 1e-1; public static final void assertEqualsDoubleSmart(final Object actual, final Double expected) { - Assert.assertTrue(actual instanceof Double); + Assert.assertTrue(actual instanceof Double, "Not a double"); assertEqualsDoubleSmart((double)(Double)actual, (double)expected); } public static final void assertEqualsDoubleSmart(final Object actual, final Double expected, final double tolerance) { - Assert.assertTrue(actual instanceof Double); + Assert.assertTrue(actual instanceof Double, "Not a double"); assertEqualsDoubleSmart((double)(Double)actual, (double)expected, tolerance); } @@ -303,13 +303,13 @@ public abstract class BaseTest { public static final void assertEqualsDoubleSmart(final double actual, final double expected, final double tolerance) { if ( Double.isNaN(expected) ) // NaN == NaN => false unfortunately - Assert.assertTrue(Double.isNaN(actual)); + Assert.assertTrue(Double.isNaN(actual), "expected is nan, actual is not"); else if ( Double.isInfinite(expected) ) // NaN == NaN => false unfortunately - Assert.assertTrue(Double.isInfinite(actual)); + Assert.assertTrue(Double.isInfinite(actual), "expected is infinite, actual is not"); else { final double delta = Math.abs(actual - expected); final double ratio = Math.abs(actual / expected - 1.0); - Assert.assertTrue(delta < tolerance || ratio < tolerance); + Assert.assertTrue(delta < tolerance || ratio < tolerance, "expected = " + expected + " actual = " + actual + " not within tolerance " + tolerance); } } } diff --git a/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSourceUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSourceUnitTest.java index 1c5dab254..f2c546317 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSourceUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSourceUnitTest.java @@ -24,9 +24,12 @@ package org.broadinstitute.sting.gatk.datasources.reads; +import static org.testng.Assert.assertEquals; +import static org.testng.Assert.assertTrue; import static org.testng.Assert.fail; import net.sf.picard.reference.IndexedFastaSequenceFile; import net.sf.samtools.SAMFileReader; +import net.sf.samtools.SAMProgramRecord; import net.sf.samtools.SAMRecord; import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.commandline.Tags; @@ -36,6 +39,7 @@ import org.broadinstitute.sting.gatk.iterators.StingSAMIterator; import org.broadinstitute.sting.gatk.resourcemanagement.ThreadAllocation; import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.GenomeLoc; +import org.broadinstitute.sting.utils.baq.BAQ; import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; import org.broadinstitute.sting.utils.exceptions.UserException; import org.testng.annotations.AfterMethod; @@ -143,4 +147,73 @@ public class SAMDataSourceUnitTest extends BaseTest { fail("testLinearBreakIterateAll: We Should get a UserException.CouldNotReadInputFile exception"); } } + + /** Test that we clear program records when requested */ + @Test + public void testRemoveProgramRecords() { + logger.warn("Executing testRemoveProgramRecords"); + + // setup the data + readers.add(new SAMReaderID(new File(b37GoodBAM),new Tags())); + + // use defaults + SAMDataSource data = new SAMDataSource(readers, + new ThreadAllocation(), + null, + genomeLocParser, + false, + SAMFileReader.ValidationStringency.SILENT, + null, + null, + new ValidationExclusion(), + new ArrayList(), + false); + + List defaultProgramRecords = data.getHeader().getProgramRecords(); + assertTrue(defaultProgramRecords.size() != 0, "testRemoveProgramRecords: No program records found when using default constructor"); + + boolean removeProgramRecords = false; + data = new SAMDataSource(readers, + new ThreadAllocation(), + null, + genomeLocParser, + false, + SAMFileReader.ValidationStringency.SILENT, + null, + null, + new ValidationExclusion(), + new ArrayList(), + false, + BAQ.CalculationMode.OFF, + BAQ.QualityMode.DONT_MODIFY, + null, // no BAQ + null, // no BQSR + (byte) -1, + removeProgramRecords); + + List dontRemoveProgramRecords = data.getHeader().getProgramRecords(); + assertEquals(dontRemoveProgramRecords, defaultProgramRecords, "testRemoveProgramRecords: default program records differ from removeProgramRecords = false"); + + removeProgramRecords = true; + data = new SAMDataSource(readers, + new ThreadAllocation(), + null, + genomeLocParser, + false, + SAMFileReader.ValidationStringency.SILENT, + null, + null, + new ValidationExclusion(), + new ArrayList(), + false, + BAQ.CalculationMode.OFF, + BAQ.QualityMode.DONT_MODIFY, + null, // no BAQ + null, // no BQSR + (byte) -1, + removeProgramRecords); + + List doRemoveProgramRecords = data.getHeader().getProgramRecords(); + assertTrue(doRemoveProgramRecords.isEmpty(), "testRemoveProgramRecords: program records not cleared when removeProgramRecords = true"); + } } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/BQSRGathererUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/BQSRGathererUnitTest.java index 8e9f2533f..f1ffbe80f 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/BQSRGathererUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/BQSRGathererUnitTest.java @@ -2,6 +2,7 @@ package org.broadinstitute.sting.gatk.walkers.bqsr; import org.broadinstitute.sting.gatk.report.GATKReport; import org.broadinstitute.sting.gatk.report.GATKReportTable; +import org.broadinstitute.sting.utils.recalibration.RecalUtils; import org.testng.Assert; import org.testng.annotations.Test; @@ -33,15 +34,15 @@ public class BQSRGathererUnitTest { for (GATKReportTable originalTable : originalReport.getTables()) { GATKReportTable calculatedTable = calculatedReport.getTable(originalTable.getTableName()); List columnsToTest = new LinkedList(); - columnsToTest.add(RecalDataManager.NUMBER_OBSERVATIONS_COLUMN_NAME); - columnsToTest.add(RecalDataManager.NUMBER_ERRORS_COLUMN_NAME); - if (originalTable.getTableName().equals(RecalDataManager.ARGUMENT_REPORT_TABLE_TITLE)) { // these tables must be IDENTICAL - columnsToTest.add(RecalDataManager.ARGUMENT_VALUE_COLUMN_NAME); + columnsToTest.add(RecalUtils.NUMBER_OBSERVATIONS_COLUMN_NAME); + columnsToTest.add(RecalUtils.NUMBER_ERRORS_COLUMN_NAME); + if (originalTable.getTableName().equals(RecalUtils.ARGUMENT_REPORT_TABLE_TITLE)) { // these tables must be IDENTICAL + columnsToTest.add(RecalUtils.ARGUMENT_VALUE_COLUMN_NAME); testTablesWithColumnsAndFactor(originalTable, calculatedTable, columnsToTest, 1); } - else if (originalTable.getTableName().equals(RecalDataManager.QUANTIZED_REPORT_TABLE_TITLE)) { - columnsToTest.add(RecalDataManager.QUANTIZED_COUNT_COLUMN_NAME); + else if (originalTable.getTableName().equals(RecalUtils.QUANTIZED_REPORT_TABLE_TITLE)) { + columnsToTest.add(RecalUtils.QUANTIZED_COUNT_COLUMN_NAME); testTablesWithColumnsAndFactor(originalTable, calculatedTable, columnsToTest, 2); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/ArtificialReadPileupTestProvider.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/ArtificialReadPileupTestProvider.java index 17149220a..f7f7999be 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/ArtificialReadPileupTestProvider.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/ArtificialReadPileupTestProvider.java @@ -38,13 +38,17 @@ import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.sting.utils.pileup.ReadBackedPileupImpl; import org.broadinstitute.sting.utils.sam.ArtificialSAMUtils; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; +import org.broadinstitute.sting.utils.variantcontext.Allele; +import org.broadinstitute.sting.utils.variantcontext.VariantContext; +import org.broadinstitute.sting.utils.variantcontext.VariantContextBuilder; import java.util.*; public class ArtificialReadPileupTestProvider { + final String refBases = "ACAGAGCTGACCCTCCCTCCCCTCTCCCAGTGCAACAGCACGGGCGGCGACTGCTTTTACCGAGGCTACACGTCAGGCGTGGCGGCTGTCCAGGACTGGTACCACTTCCACTATGTGGATCTCTGCTGAGGACCAGGAAAGCCAGCACCCGCAGAGACTCTTCCCCAGTGCTCCATACGATCACCATTCTCTGCAGAAGGTCAGACGTCACTGGTGGCCCCCCAGCCTCCTCAGCAGGGAAGGATACTGTCCCGCAGATGAGATGAGCGAGAGCCGCCAGACCCACGTGACGCTGCACGACATCGACCCTCAGGCCTTGGACCAGCTGGTGCAGTTTGCCTACACGGCTGAGATTGTGGTGGGCGAGGGC"; final int contigStart = 1; - final int contigStop = 10; + final int contigStop = refBases.length(); final SAMFileHeader header = ArtificialSAMUtils.createArtificialSamHeader(1, 1, contigStop - contigStart + 1); // final GATKSAMReadGroupRecord artificialGATKRG = new GATKSAMReadGroupRecord("synthetic"); final String artificialContig = "chr1"; @@ -54,16 +58,18 @@ public class ArtificialReadPileupTestProvider { final int artificialMappingQuality = 60; Map sample2RG = new HashMap(); List sampleRGs; - - final String refBases = "AGGATACTGT"; List sampleNames = new ArrayList(); private String sampleName(int i) { return sampleNames.get(i); } private SAMReadGroupRecord sampleRG(String name) { return sample2RG.get(name); } - public final int offset = 5; + public final int locStart = 105; // start position where we desire artificial variant + private final int readLength = 10; // desired read length in pileup + public final int readOffset = 4; + private final int readStart = locStart - readOffset; public final GenomeLocParser genomeLocParser = new GenomeLocParser(header.getSequenceDictionary()); - public final GenomeLoc loc = genomeLocParser.createGenomeLoc(artificialContig,offset,offset); - public final GenomeLoc window = genomeLocParser.createGenomeLoc(artificialContig,artificialRefStart,10); - public final ReferenceContext referenceContext = new ReferenceContext(genomeLocParser,loc,window,this.refBases.getBytes()); + public final GenomeLoc loc = genomeLocParser.createGenomeLoc(artificialContig,locStart,locStart); + public final GenomeLoc window = genomeLocParser.createGenomeLoc(artificialContig,locStart-100,locStart+100); + public final String windowBases = refBases.substring(locStart-100-1,locStart+100); + public final ReferenceContext referenceContext = new ReferenceContext(genomeLocParser,loc,window,windowBases.getBytes()); byte BASE_QUAL = 50; @@ -96,25 +102,28 @@ public class ArtificialReadPileupTestProvider { public Map getAlignmentContextFromAlleles(int eventLength, String altBases, int[] numReadsPerAllele) { return getAlignmentContextFromAlleles(eventLength, altBases, numReadsPerAllele, false, BASE_QUAL); } - public Map getAlignmentContextFromAlleles(int eventLength, String altBases, int[] numReadsPerAllele, - boolean addBaseErrors, int phredScaledBaseErrorRate) { - // RefMetaDataTracker tracker = new RefMetaDataTracker(null,referenceContext); + public Map getAlignmentContextFromAlleles(final int eventLength, + final String altBases, + final int[] numReadsPerAllele, + final boolean addBaseErrors, + final int phredScaledBaseErrorRate) { + final String refChar = new String(new byte[]{referenceContext.getBase()}); String refAllele, altAllele; if (eventLength == 0) { // SNP case - refAllele = new String(new byte[]{referenceContext.getBase()}); - altAllele = new String(altBases.substring(0,1)); + refAllele = refChar; + altAllele = altBases.substring(0,1); } else if (eventLength>0){ // insertion - refAllele = ""; - altAllele = altBases.substring(0,eventLength); + refAllele = refChar; + altAllele = refChar+altBases/*.substring(0,eventLength)*/; } else { // deletion - refAllele = refBases.substring(offset,offset+Math.abs(eventLength)); - altAllele = ""; + refAllele = new String(referenceContext.getForwardBases()).substring(0,Math.abs(eventLength)+1); + altAllele = refChar; } Map contexts = new HashMap(); @@ -138,22 +147,21 @@ public class ArtificialReadPileupTestProvider { private ReadBackedPileup generateRBPForVariant( GenomeLoc loc, String refAllele, String altAllele, String altBases, int[] numReadsPerAllele, String sample, boolean addErrors, int phredScaledErrorRate) { List pileupElements = new ArrayList(); - int offset = (contigStop-contigStart+1)/2; - int refAlleleLength = refAllele.length(); + final int refAlleleLength = refAllele.length(); - pileupElements.addAll(createPileupElements(refAllele, loc, numReadsPerAllele[0], sample, contigStart, offset, altBases, addErrors, phredScaledErrorRate, refAlleleLength, true)); - pileupElements.addAll(createPileupElements(altAllele, loc, numReadsPerAllele[1], sample, contigStart, offset, altBases, addErrors, phredScaledErrorRate, refAlleleLength, false)); + pileupElements.addAll(createPileupElements(refAllele, loc, numReadsPerAllele[0], sample, readStart, altBases, addErrors, phredScaledErrorRate, refAlleleLength, true)); + pileupElements.addAll(createPileupElements(altAllele, loc, numReadsPerAllele[1], sample, readStart, altBases, addErrors, phredScaledErrorRate, refAlleleLength, false)); return new ReadBackedPileupImpl(loc,pileupElements); } - private List createPileupElements(String allele, GenomeLoc loc, int numReadsPerAllele, String sample, int readStart, int offset, String altBases, boolean addErrors, int phredScaledErrorRate, int refAlleleLength, boolean isReference) { + private List createPileupElements(String allele, GenomeLoc loc, int numReadsPerAllele, String sample, int readStart, String altBases, boolean addErrors, int phredScaledErrorRate, int refAlleleLength, boolean isReference) { int alleleLength = allele.length(); List pileupElements = new ArrayList(); int readCounter = 0; for ( int d = 0; d < numReadsPerAllele; d++ ) { - byte[] readBases = trueHaplotype(allele, offset, refAlleleLength); + byte[] readBases = trueHaplotype(allele, refAlleleLength, readLength); if (addErrors) addBaseErrors(readBases, phredScaledErrorRate); @@ -165,20 +173,20 @@ public class ArtificialReadPileupTestProvider { read.setReadBases(readBases); read.setReadName(artificialReadName+readCounter++); - boolean isBeforeDeletion = false, isBeforeInsertion = false; + boolean isBeforeDeletion = alleleLengthrefAlleleLength; + + int eventLength = alleleLength - refAlleleLength; if (isReference) read.setCigarString(readBases.length + "M"); else { - isBeforeDeletion = alleleLengthrefAlleleLength; if (isBeforeDeletion || isBeforeInsertion) - read.setCigarString(offset+"M"+ alleleLength + (isBeforeDeletion?"D":"I") + - (readBases.length-offset)+"M"); + read.setCigarString((readOffset+1)+"M"+ Math.abs(eventLength) + (isBeforeDeletion?"D":"I") + + (readBases.length-readOffset)+"M"); else // SNP case read.setCigarString(readBases.length+"M"); } - int eventLength = (isBeforeDeletion?refAlleleLength:(isBeforeInsertion?alleleLength:0)); read.setReadPairedFlag(false); read.setAlignmentStart(readStart); read.setMappingQuality(artificialMappingQuality); @@ -187,16 +195,25 @@ public class ArtificialReadPileupTestProvider { read.setAttribute("RG", sampleRG(sample).getReadGroupId()); - pileupElements.add(new PileupElement(read,offset,false,isBeforeDeletion, false, isBeforeInsertion,false,false,altBases.substring(0,alleleLength),eventLength)); + pileupElements.add(new PileupElement(read,readOffset,false,isBeforeDeletion, false, isBeforeInsertion,false,false,altBases,Math.abs(eventLength))); } return pileupElements; } - private byte[] trueHaplotype(String allele, int offset, int refAlleleLength) { + /** + * Create haplotype with desired allele and reference context + * @param allele Desired allele string + * @param refAlleleLength Length of reference allele. + * @param desiredLength Desired haplotype length + * @return String with haplotype formed by (prefix)+allele bases + postfix + */ + private byte[] trueHaplotype(final String allele, final int refAlleleLength, final int desiredLength) { // create haplotype based on a particular allele - String prefix = refBases.substring(0, offset); - String postfix = refBases.substring(offset+refAlleleLength,refBases.length()); + final int startIdx= locStart - readOffset-1; + + final String prefix = refBases.substring(startIdx, locStart-1); + final String postfix = refBases.substring(locStart+refAlleleLength-1,startIdx + desiredLength); return (prefix+allele+postfix).getBytes(); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/IndelGenotypeLikelihoodsUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/IndelGenotypeLikelihoodsUnitTest.java index dfd4bc525..85528f58b 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/IndelGenotypeLikelihoodsUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/IndelGenotypeLikelihoodsUnitTest.java @@ -45,7 +45,6 @@ import org.testng.annotations.Test; */ public class IndelGenotypeLikelihoodsUnitTest extends BaseTest { - final String refBases = "AGGATACTGT"; final int nSamples = 1; final int[] numReadsPerAllele = new int[]{10,10}; final String SAMPLE_PREFIX = "sample"; @@ -65,7 +64,7 @@ public class IndelGenotypeLikelihoodsUnitTest extends BaseTest { @Test public void testBasicConsensusCounts() { // 4 inserted bases, min cnt = 10 - String altBases = "CCTCCTGAGA"; + String altBases = "CCTC"; int eventLength = 4; List alleles = getConsensusAlleles(eventLength,true,10,0.1, altBases); @@ -73,13 +72,11 @@ public class IndelGenotypeLikelihoodsUnitTest extends BaseTest { Assert.assertEquals(alleles.get(1).getBaseString().substring(1), altBases.substring(0,eventLength)); - - //altBases = "CCTCMTGAGA"; - + // test deletions eventLength = 3; alleles = getConsensusAlleles(eventLength,false,10,0.1, altBases); Assert.assertEquals(alleles.size(),2); - Assert.assertEquals(alleles.get(0).getBaseString().substring(1), refBases.substring(pileupProvider.offset,pileupProvider.offset+eventLength)); + Assert.assertEquals(alleles.get(0).getBaseString().substring(1,eventLength), new String(pileupProvider.getReferenceContext().getForwardBases()).substring(1,eventLength)); // same with min Reads = 11 alleles = getConsensusAlleles(eventLength,false,11,0.1, altBases); @@ -92,14 +89,14 @@ public class IndelGenotypeLikelihoodsUnitTest extends BaseTest { Assert.assertEquals(alleles.size(),0); // test N's in insertions - altBases = "CCTCNTGAGA"; + altBases = "CCTC"; eventLength = 4; alleles = getConsensusAlleles(eventLength,true,10,0.1, altBases); Assert.assertEquals(alleles.size(),2); - Assert.assertEquals(alleles.get(1).getBaseString().substring(1), altBases.substring(0,eventLength)); + Assert.assertEquals(alleles.get(1).getBaseString().substring(1,eventLength+1), altBases); - altBases = "CCTCNTGAGA"; + altBases = "CCTCN"; eventLength = 5; alleles = getConsensusAlleles(eventLength,true,10,0.1, altBases); diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java index f35eb4404..d976e3e22 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java @@ -373,13 +373,13 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { // -------------------------------------------------------------------------------------------------------------- // - // testing SnpEff + // testing MinIndelFraction // // -------------------------------------------------------------------------------------------------------------- final static String assessMinIndelFraction = baseCommandIndelsb37 + " -I " + validationDataLocation + "978604.bam -L 1:978,586-978,626 -o %s --sites_only -rf Sample -goodSM 7377 -goodSM 22-0022 -goodSM 134 -goodSM 344029-53 -goodSM 14030"; - + @Test public void testMinIndelFraction0() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( @@ -403,4 +403,18 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { Arrays.asList("3f07efb768e08650a7ce333edd4f9a52")); executeTest("test minIndelFraction 1.0", spec); } + + // -------------------------------------------------------------------------------------------------------------- + // + // testing Ns in CIGAR + // + // -------------------------------------------------------------------------------------------------------------- + + @Test + public void testNsInCigar() { + WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( + "-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -I " + validationDataLocation + "testWithNs.bam -o %s -L 8:141799600-141814700", 1, + Arrays.asList("22c9fd65ce3298bd7fbf400c9c209f29")); + executeTest("test calling on reads with Ns in CIGAR", spec); + } } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalIntegrationTest.java index d9a91c4c2..94e52c2b9 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalIntegrationTest.java @@ -34,7 +34,7 @@ import java.util.Arrays; import java.util.List; public class VariantEvalIntegrationTest extends WalkerTest { - private static String variantEvalTestDataRoot = validationDataLocation + "VariantEval/"; + private static String variantEvalTestDataRoot = privateTestDir + "VariantEval/"; private static String fundamentalTestVCF = variantEvalTestDataRoot + "FundamentalsTest.annotated.db.subset.snps_and_indels.vcf"; private static String fundamentalTestSNPsVCF = variantEvalTestDataRoot + "FundamentalsTest.annotated.db.subset.final.vcf"; private static String fundamentalTestSNPsWithMLEVCF = variantEvalTestDataRoot + "FundamentalsTest.annotated.db.subset.final.withMLE.vcf"; @@ -122,7 +122,7 @@ public class VariantEvalIntegrationTest extends WalkerTest { "-o %s" ), 1, - Arrays.asList("e62a3bd9914d48e2bb2fb4f5dfc5ebc0") + Arrays.asList("40abbc9be663aed8ee1158f832463ca8") ); executeTest("testFundamentalsCountVariantsSNPsandIndelsWithNovelty", spec); } @@ -144,7 +144,7 @@ public class VariantEvalIntegrationTest extends WalkerTest { "-o %s" ), 1, - Arrays.asList("087a2d9943c53e7f49663667c3305c7e") + Arrays.asList("106a0e8753e839c0a2c030eb4b165fa9") ); executeTest("testFundamentalsCountVariantsSNPsandIndelsWithNoveltyAndFilter", spec); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrationWalkersIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrationWalkersIntegrationTest.java index 2411f9e08..74d071a90 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrationWalkersIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrationWalkersIntegrationTest.java @@ -26,9 +26,9 @@ public class VariantRecalibrationWalkersIntegrationTest extends WalkerTest { } VRTest lowPass = new VRTest("phase1.projectConsensus.chr20.raw.snps.vcf", - "62f81e7d2082fbc71cae0101c27fefad", // tranches - "b9709e4180e56abc691b208bd3e8626c", // recal file - "75c178345f70ca2eb90205662fbdf968"); // cut VCF + "f360ce3eb2b0b887301be917a9843e2b", // tranches + "287fea5ea066bf3fdd71f5ce9b58eab3", // recal file + "356b9570817b9389da71fbe991d8b2f5"); // cut VCF @DataProvider(name = "VRTest") public Object[][] createData1() { diff --git a/public/java/test/org/broadinstitute/sting/utils/codecs/bcf2/BCF2EncoderDecoderUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/codecs/bcf2/BCF2EncoderDecoderUnitTest.java index a0feef186..7569ce90d 100644 --- a/public/java/test/org/broadinstitute/sting/utils/codecs/bcf2/BCF2EncoderDecoderUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/codecs/bcf2/BCF2EncoderDecoderUnitTest.java @@ -351,7 +351,7 @@ public class BCF2EncoderDecoderUnitTest extends BaseTest { public void testEncodingListOfString(List strings, String expected) throws IOException { final String collapsed = BCF2Utils.collapseStringList(strings); Assert.assertEquals(collapsed, expected); - Assert.assertEquals(BCF2Utils.exploreStringList(collapsed), strings); + Assert.assertEquals(BCF2Utils.explodeStringList(collapsed), strings); } // ----------------------------------------------------------------- diff --git a/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/VCFIntegrationTest.java b/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/VCFIntegrationTest.java index 3948ba971..71fc1d464 100644 --- a/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/VCFIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/VCFIntegrationTest.java @@ -57,7 +57,7 @@ public class VCFIntegrationTest extends WalkerTest { String baseCommand = "-R " + b37KGReference + " --no_cmdline_in_header -o %s "; String test1 = baseCommand + "-T SelectVariants -V " + testVCF; - WalkerTestSpec spec1 = new WalkerTestSpec(test1, 1, Arrays.asList("")); + WalkerTestSpec spec1 = new WalkerTestSpec(test1, 1, Arrays.asList("bdab26dd7648a806dbab01f64db2bdab")); executeTest("Test reading and writing 1000G Phase I SVs", spec1); } @@ -77,7 +77,7 @@ public class VCFIntegrationTest extends WalkerTest { String testVCF = privateTestDir + "ex2.vcf"; String baseCommand = "-R " + b36KGReference + " --no_cmdline_in_header -o %s "; String test1 = baseCommand + "-T SelectVariants -V " + testVCF; - WalkerTestSpec spec1 = new WalkerTestSpec(test1, 1, Arrays.asList("a04a0fc22fedb516c663e56e51fc1e27")); + WalkerTestSpec spec1 = new WalkerTestSpec(test1, 1, Arrays.asList("e8f721ce81e4fdadba13c5291027057f")); executeTest("Test writing samtools WEx BCF example", spec1); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/ContextCovariateUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/recalibration/ContextCovariateUnitTest.java similarity index 89% rename from public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/ContextCovariateUnitTest.java rename to public/java/test/org/broadinstitute/sting/utils/recalibration/ContextCovariateUnitTest.java index 553b7e237..2556448ad 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/ContextCovariateUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/recalibration/ContextCovariateUnitTest.java @@ -1,5 +1,8 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; +import org.broadinstitute.sting.utils.recalibration.covariates.ContextCovariate; +import org.broadinstitute.sting.utils.recalibration.covariates.Covariate; import org.broadinstitute.sting.utils.clipping.ClippingRepresentation; import org.broadinstitute.sting.utils.clipping.ReadClipper; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/CycleCovariateUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/recalibration/CycleCovariateUnitTest.java similarity index 90% rename from public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/CycleCovariateUnitTest.java rename to public/java/test/org/broadinstitute/sting/utils/recalibration/CycleCovariateUnitTest.java index 3fa1e916d..c3d93b2cb 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/CycleCovariateUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/recalibration/CycleCovariateUnitTest.java @@ -1,5 +1,7 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; +import org.broadinstitute.sting.utils.recalibration.covariates.CycleCovariate; import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.ReadUtils; diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/ReadCovariatesUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/recalibration/ReadCovariatesUnitTest.java similarity index 92% rename from public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/ReadCovariatesUnitTest.java rename to public/java/test/org/broadinstitute/sting/utils/recalibration/ReadCovariatesUnitTest.java index 37994cf12..dac26cb53 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/ReadCovariatesUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/recalibration/ReadCovariatesUnitTest.java @@ -1,5 +1,7 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; +import org.broadinstitute.sting.utils.recalibration.covariates.*; import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.ReadUtils; @@ -41,7 +43,7 @@ public class ReadCovariatesUnitTest { requestedCovariates[2] = coCov; requestedCovariates[3] = cyCov; - ReadCovariates rc = RecalDataManager.computeCovariates(read, requestedCovariates); + ReadCovariates rc = RecalUtils.computeCovariates(read, requestedCovariates); // check that the length is correct Assert.assertEquals(rc.getMismatchesKeySet().length, length); diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/ReadGroupCovariateUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/recalibration/ReadGroupCovariateUnitTest.java similarity index 88% rename from public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/ReadGroupCovariateUnitTest.java rename to public/java/test/org/broadinstitute/sting/utils/recalibration/ReadGroupCovariateUnitTest.java index a83508353..78a74d259 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/ReadGroupCovariateUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/recalibration/ReadGroupCovariateUnitTest.java @@ -1,5 +1,7 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; +import org.broadinstitute.sting.utils.recalibration.covariates.ReadGroupCovariate; import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.ReadUtils; diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationReportUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/recalibration/RecalibrationReportUnitTest.java similarity index 95% rename from public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationReportUnitTest.java rename to public/java/test/org/broadinstitute/sting/utils/recalibration/RecalibrationReportUnitTest.java index e4a77c016..387cc94d6 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/bqsr/RecalibrationReportUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/recalibration/RecalibrationReportUnitTest.java @@ -1,9 +1,10 @@ -package org.broadinstitute.sting.gatk.walkers.bqsr; +package org.broadinstitute.sting.utils.recalibration; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; +import org.broadinstitute.sting.utils.recalibration.covariates.*; import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.sting.utils.collections.NestedIntegerArray; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; -import org.broadinstitute.sting.utils.recalibration.RecalibrationTables; import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.ReadUtils; @@ -72,7 +73,7 @@ public class RecalibrationReportUnitTest { final int expectedKeys = expectedNumberOfKeys(4, length, RAC.INDELS_CONTEXT_SIZE, RAC.MISMATCHES_CONTEXT_SIZE); int nKeys = 0; // keep track of how many keys were produced - final ReadCovariates rc = RecalDataManager.computeCovariates(read, requestedCovariates); + final ReadCovariates rc = RecalUtils.computeCovariates(read, requestedCovariates); final RecalibrationTables recalibrationTables = new RecalibrationTables(requestedCovariates); final NestedIntegerArray rgTable = recalibrationTables.getTable(RecalibrationTables.TableType.READ_GROUP_TABLE); diff --git a/public/java/test/org/broadinstitute/sting/utils/variantcontext/VariantContextBenchmark.java b/public/java/test/org/broadinstitute/sting/utils/variantcontext/VariantContextBenchmark.java index 7c522eadf..0e5522e3a 100644 --- a/public/java/test/org/broadinstitute/sting/utils/variantcontext/VariantContextBenchmark.java +++ b/public/java/test/org/broadinstitute/sting/utils/variantcontext/VariantContextBenchmark.java @@ -152,7 +152,7 @@ public class VariantContextBenchmark extends SimpleBenchmark { public void run(final VariantContext vc) { if ( samples == null ) samples = new HashSet(new ArrayList(vc.getSampleNames()).subList(0, nSamplesToTake)); - VariantContext sub = vc.subContextFromSamples(samples, true); + VariantContext sub = vc.subContextFromSamples(samples); sub.getNSamples(); } }; diff --git a/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/DataProcessingPipeline.scala b/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/DataProcessingPipeline.scala index 56e2ddebb..56f6460fb 100755 --- a/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/DataProcessingPipeline.scala +++ b/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/DataProcessingPipeline.scala @@ -347,6 +347,7 @@ class DataProcessingPipeline extends QScript { this.knownSites ++= qscript.dbSNP this.covariate ++= Seq("ReadGroupCovariate", "QualityScoreCovariate", "CycleCovariate", "ContextCovariate") this.input_file :+= inBam + this.disable_indel_quals = true this.out = outRecalFile if (!defaultPlatform.isEmpty) this.default_platform = defaultPlatform if (!qscript.intervalString.isEmpty) this.intervalsString ++= Seq(qscript.intervalString) @@ -359,7 +360,6 @@ class DataProcessingPipeline extends QScript { case class recal (inBam: File, inRecalFile: File, outBam: File) extends PrintReads with CommandLineGATKArgs { this.input_file :+= inBam this.BQSR = inRecalFile - this.disable_indel_quals = true this.baq = CalculationMode.CALCULATE_AS_NECESSARY this.out = outBam if (!qscript.intervalString.isEmpty) this.intervalsString ++= Seq(qscript.intervalString) diff --git a/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/PacbioProcessingPipeline.scala b/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/PacbioProcessingPipeline.scala index b7246ca8f..a4a6636fe 100755 --- a/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/PacbioProcessingPipeline.scala +++ b/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/PacbioProcessingPipeline.scala @@ -166,6 +166,7 @@ class PacbioProcessingPipeline extends QScript { this.knownSites :+= dbSNP this.covariate ++= List("ReadGroupCovariate", "QualityScoreCovariate", "CycleCovariate", "ContextCovariate") this.input_file :+= inBam + this.disable_indel_quals = true this.out = outRecalFile this.analysisName = queueLogDir + outRecalFile + ".covariates" this.jobName = queueLogDir + outRecalFile + ".covariates" @@ -178,7 +179,6 @@ class PacbioProcessingPipeline extends QScript { this.input_file :+= inBam this.BQSR = inRecalFile this.out = outBam - this.disable_indel_quals = true this.isIntermediate = false this.analysisName = queueLogDir + outBam + ".recalibration" this.jobName = queueLogDir + outBam + ".recalibration" diff --git a/public/scala/test/org/broadinstitute/sting/queue/pipeline/DataProcessingPipelineTest.scala b/public/scala/test/org/broadinstitute/sting/queue/pipeline/DataProcessingPipelineTest.scala index 724f35cf6..3fb9e0efa 100644 --- a/public/scala/test/org/broadinstitute/sting/queue/pipeline/DataProcessingPipelineTest.scala +++ b/public/scala/test/org/broadinstitute/sting/queue/pipeline/DataProcessingPipelineTest.scala @@ -41,7 +41,7 @@ class DataProcessingPipelineTest { " -D " + BaseTest.publicTestDir + "exampleDBSNP.vcf", " -test ", " -p " + projectName).mkString - spec.fileMD5s += testOut -> "0f0b32e94640a8d548b4c1134ad4c075" + spec.fileMD5s += testOut -> "60d39ae909fdd049920b54e0965b6d3c" PipelineTest.executeTest(spec) } @@ -60,7 +60,7 @@ class DataProcessingPipelineTest { " -bwa /home/unix/carneiro/bin/bwa", " -bwape ", " -p " + projectName).mkString - spec.fileMD5s += testOut -> "6b4f13d22b45d7d617ee959fdc278ed2" + spec.fileMD5s += testOut -> "61ca3237afdfabf78ee27a5bb80dae59" PipelineTest.executeTest(spec) } diff --git a/public/scala/test/org/broadinstitute/sting/queue/pipeline/PacbioProcessingPipelineTest.scala b/public/scala/test/org/broadinstitute/sting/queue/pipeline/PacbioProcessingPipelineTest.scala index 6e4c5ed3e..74e947377 100644 --- a/public/scala/test/org/broadinstitute/sting/queue/pipeline/PacbioProcessingPipelineTest.scala +++ b/public/scala/test/org/broadinstitute/sting/queue/pipeline/PacbioProcessingPipelineTest.scala @@ -40,7 +40,7 @@ class PacbioProcessingPipelineTest { " -blasr ", " -test ", " -D " + BaseTest.publicTestDir + "exampleDBSNP.vcf").mkString - spec.fileMD5s += testOut -> "2f2026882a2850bb14a858524158d5a8" + spec.fileMD5s += testOut -> "61b06e8b78a93e6644657e6d38851084" PipelineTest.executeTest(spec) } }