diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java index d6c5e82f6..002bdc39f 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java @@ -280,7 +280,7 @@ public class BaseRecalibrator extends ReadWalker implements NanoSche * @param hasEvents a vector a vectors of 0 (no event) and 1 (has event) * @return the total number of events across all hasEvent arrays */ - private int nEvents(final int[]... hasEvents) { + protected static int nEvents(final int[]... hasEvents) { int n = 0; for ( final int[] hasEvent : hasEvents ) { n += MathUtils.sum(hasEvent); @@ -302,7 +302,7 @@ public class BaseRecalibrator extends ReadWalker implements NanoSche return ReadUtils.isSOLiDRead(read) && RAC.SOLID_RECAL_MODE != RecalUtils.SOLID_RECAL_MODE.DO_NOTHING && !RecalUtils.isColorSpaceConsistent(read, offset); } - protected boolean[] calculateKnownSites( final GATKSAMRecord read, final List features ) { + protected static boolean[] calculateKnownSites( final GATKSAMRecord read, final List features ) { final int readLength = read.getReadBases().length; final boolean[] knownSites = new boolean[readLength]; Arrays.fill(knownSites, false); @@ -464,7 +464,7 @@ public class BaseRecalibrator extends ReadWalker implements NanoSche * @return a BAQ-style non-null byte[] counting NO_BAQ_UNCERTAINTY values * // TODO -- could be optimized avoiding this function entirely by using this inline if the calculation code above */ - private byte[] flatBAQArray(final GATKSAMRecord read) { + protected static byte[] flatBAQArray(final GATKSAMRecord read) { final byte[] baq = new byte[read.getReadLength()]; Arrays.fill(baq, NO_BAQ_UNCERTAINTY); return baq; diff --git a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java index 34aa5abc7..e44f2e06e 100644 --- a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java +++ b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java @@ -477,7 +477,7 @@ public class RecalUtils { } } - private static List generateValuesFromKeys(final List keys, final Covariate[] covariates, final Map covariateNameMap) { + protected static List generateValuesFromKeys(final List keys, final Covariate[] covariates, final Map covariateNameMap) { final List values = new ArrayList(4); values.add(covariates[RecalibrationTables.TableType.READ_GROUP_TABLE.ordinal()].formatKey((Integer)keys.get(0))); final int covariateIndex = (Integer)keys.get(1); diff --git a/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatLengthCovariate.java b/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatLengthCovariate.java index 638d9fb93..b6266a543 100644 --- a/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatLengthCovariate.java +++ b/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatLengthCovariate.java @@ -46,63 +46,248 @@ package org.broadinstitute.sting.utils.recalibration.covariates; +import com.google.java.contract.Ensures; +import com.google.java.contract.Requires; import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; import org.broadinstitute.sting.utils.recalibration.ReadCovariates; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; +import org.broadinstitute.variant.utils.BaseUtils; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.variantcontext.VariantContextUtils; import java.util.Arrays; - -/** - * Created with IntelliJ IDEA. - * User: rpoplin - * Date: 11/3/12 - */ +import java.util.HashMap; +import java.util.Map; +import java.util.Set; public class RepeatLengthCovariate implements ExperimentalCovariate { final int MAX_REPEAT_LENGTH = 20; + final int MAX_STR_UNIT_LENGTH = 1; // =1 will restrict effectively to detecting homopolymer runs + public final boolean RECORD_REPUNIT_WITH_REPLENGTH = false; + private final HashMap repeatLookupTable = new HashMap(); + private final HashMap repeatReverseLookupTable = new HashMap(); + private int nextId = 0; // Initialize any member variables using the command-line arguments passed to the walkers @Override - public void initialize(final RecalibrationArgumentCollection RAC) {} + public void initialize(final RecalibrationArgumentCollection RAC) { + } @Override public void recordValues(final GATKSAMRecord read, final ReadCovariates values) { - byte[] readBytes = read.getReadBases(); - for (int i = 0; i < readBytes.length; i++) { - int maxRL = 0; - for (int str = 1; str <= 8; str++) { - if (i + str <= readBytes.length) { - maxRL = Math.max(maxRL, VariantContextUtils.findNumberofRepetitions( - Arrays.copyOfRange(readBytes, i, i + str), - Arrays.copyOfRange(readBytes, i, readBytes.length) - )); + // store the original bases and then write Ns over low quality ones + final byte[] originalBases = read.getReadBases().clone(); + + final boolean negativeStrand = read.getReadNegativeStrandFlag(); + byte[] bases = read.getReadBases(); + if (negativeStrand) + bases = BaseUtils.simpleReverseComplement(bases); + + // don't record reads with N's + if (!BaseUtils.isAllRegularBases(bases)) + return; + + for (int i = 0; i < bases.length; i++) { + final Pair res = findTandemRepeatUnits(bases, i); + // merge repeat unit and repeat length to get covariate value + final String repeatID = repeatFromUnitAndLength(res.first, res.second); + final int key = keyForRepeat(repeatID); + + final int readOffset = (negativeStrand ? bases.length - i - 1 : i); + values.addCovariate(key, key, key, readOffset); + } + + // put the original bases back in + read.setReadBases(originalBases); + + } + + private Pair findTandemRepeatUnits(byte[] readBases, int offset) { + int maxBW = 0; + byte[] bestBWRepeatUnit = new byte[]{readBases[offset]}; + for (int str = 1; str <= MAX_STR_UNIT_LENGTH; str++) { + // fix repeat unit length + //edge case: if candidate tandem repeat unit falls beyond edge of read, skip + if (offset+1-str < 0) + break; + + // get backward repeat unit and # repeats + byte[] backwardRepeatUnit = Arrays.copyOfRange(readBases, offset - str+1, offset+1); + maxBW = VariantContextUtils.findNumberofRepetitions(backwardRepeatUnit,Arrays.copyOfRange(readBases, 0, offset+1), false); + if (maxBW > 1) { + bestBWRepeatUnit = backwardRepeatUnit.clone(); + break; + } + } + byte[] bestRepeatUnit = bestBWRepeatUnit; + int maxRL = maxBW; + + if (offset < readBases.length-1) { + byte[] bestFWRepeatUnit = new byte[]{readBases[offset+1]}; + int maxFW = 0; + for (int str = 1; str <= MAX_STR_UNIT_LENGTH; str++) { + // fix repeat unit length + //edge case: if candidate tandem repeat unit falls beyond edge of read, skip + if (offset+str+1 > readBases.length) + break; + + // get forward repeat unit and # repeats + byte[] forwardRepeatUnit = Arrays.copyOfRange(readBases, offset +1, offset+str+1); + maxFW = VariantContextUtils.findNumberofRepetitions(forwardRepeatUnit,Arrays.copyOfRange(readBases, offset+1, readBases.length), true); + if (maxFW > 1) { + bestFWRepeatUnit = forwardRepeatUnit.clone(); + break; } } - if(maxRL > MAX_REPEAT_LENGTH) { maxRL = MAX_REPEAT_LENGTH; } - values.addCovariate(maxRL, maxRL, maxRL, i); - } - } + // if FW repeat unit = BW repeat unit it means we're in the middle of a tandem repeat - add FW and BW components + if (Arrays.equals(bestFWRepeatUnit, bestBWRepeatUnit)) { + maxRL = maxBW + maxFW; + bestRepeatUnit = bestFWRepeatUnit; // arbitrary + } + else { + // tandem repeat starting forward from current offset + maxRL = maxFW; + bestRepeatUnit = bestFWRepeatUnit; - // Used to get the covariate's value from input csv file during on-the-fly recalibration + } +/* if (maxFW > maxBW) { + // tandem repeat starting forward from current offset + maxRL = maxFW; + bestRepeatUnit = bestFWRepeatUnit; + } + else if (maxFW < maxBW) { + maxRL = maxBW; + bestRepeatUnit = bestBWRepeatUnit; + } */ + /* else { + // maxFW = maxBW but repeat units different: not in a tandem repeat. + maxRL = 1; + bestRepeatUnit = bestBWRepeatUnit; // arbitrary + } */ + + } + + + + if(maxRL > MAX_REPEAT_LENGTH) { maxRL = MAX_REPEAT_LENGTH; } + return new Pair(bestRepeatUnit, maxRL); + + } @Override public final Object getValue(final String str) { - return Byte.parseByte(str); + return str; } @Override - public String formatKey(final int key) { - return String.format("%d", key); + public synchronized String formatKey(final int key) { + // This method is synchronized so that we don't attempt to do a get() + // from the reverse lookup table while that table is being updated + return repeatReverseLookupTable.get(key); } @Override public int keyFromValue(final Object value) { - return (value instanceof String) ? Integer.parseInt((String) value) : (Integer) value; + return keyForRepeat((String) value); + } + + /** + * Get the mapping from read group names to integer key values for all read groups in this covariate + * @return a set of mappings from read group names -> integer key values + */ + public Set> getKeyMap() { + return repeatLookupTable.entrySet(); + } + + @Requires({"repeatLength>=0", "repeatFromUnitAndLength != null"}) + @Ensures("result != null") + private String repeatFromUnitAndLength(final byte[] repeatFromUnitAndLength, final int repeatLength) { + if (RECORD_REPUNIT_WITH_REPLENGTH) + return new String(repeatFromUnitAndLength) + String.format("%d",repeatLength); + else + return String.format("%d",repeatLength); + } + + private int keyForRepeat(final String repeatID) { + // Rather than synchronize this entire method (which would be VERY expensive for walkers like the BQSR), + // synchronize only the table updates. + + // Before entering the synchronized block, check to see if this read group is not in our tables. + // If it's not, either we will have to insert it, OR another thread will insert it first. + // This preliminary check avoids doing any synchronization most of the time. + if ( ! repeatLookupTable.containsKey(repeatID) ) { + + synchronized ( this ) { + + // Now we need to make sure the key is STILL not there, since another thread may have come along + // and inserted it while we were waiting to enter this synchronized block! + if ( ! repeatLookupTable.containsKey(repeatID) ) { + repeatLookupTable.put(repeatID, nextId); + repeatReverseLookupTable.put(nextId, repeatID); + nextId++; + } + } + } + + return repeatLookupTable.get(repeatID); + } + + + /** + * Splits repeat unit and num repetitions from covariate value. + * For example, if value if "ATG4" it returns (ATG,4) + * @param value Covariate value + * @return Split pair + */ + @Requires("value != null") + @Ensures({"result.first != null","result.second>=0"}) + public static Pair getRUandNRfromCovariate(final String value) { + + int k = 0; + for ( k=0; k < value.length(); k++ ) { + if (!BaseUtils.isRegularBase(value.getBytes()[k])) + break; + } + Integer nr = Integer.valueOf(value.substring(k,value.length())); // will throw NumberFormatException if format illegal + if (k == value.length() || nr <= 0) + throw new IllegalStateException("Covariate is not of form (Repeat Unit) + Integer"); + + return new Pair(value.substring(0,k), nr); + } + + /** + * Gets bases from tandem repeat representation (Repeat Unit),(Number of Repeats). + * For example, (AGC),3 returns AGCAGCAGC + * @param repeatUnit Tandem repeat unit + * @param numRepeats Number of repeats + * @return Expanded String + */ + @Requires({"numRepeats > 0","repeatUnit != null"}) + @Ensures("result != null") + public static String getBasesFromRUandNR(final String repeatUnit, final int numRepeats) { + final StringBuilder sb = new StringBuilder(); + + for (int i=0; i < numRepeats; i++) + sb.append(repeatUnit); + + return sb.toString(); + } + + // version given covariate key + public static String getBasesFromRUandNR(final String covariateValue) { + Pair pair = getRUandNRfromCovariate(covariateValue); + return getBasesFromRUandNR(pair.getFirst(), pair.getSecond()); } @Override - public int maximumKeyValue() { - return MAX_REPEAT_LENGTH + 1; + public synchronized int maximumKeyValue() { + // Synchronized so that we don't query table size while the tables are being updated + //return repeatLookupTable.size() - 1; + // max possible values of covariate: for repeat unit, length is up to MAX_STR_UNIT_LENGTH, + // so we have 4^MAX_STR_UNIT_LENGTH * MAX_REPEAT_LENGTH possible values + if (RECORD_REPUNIT_WITH_REPLENGTH) + return (1<<(2*MAX_STR_UNIT_LENGTH)) * MAX_REPEAT_LENGTH +1; + else + return (1+MAX_REPEAT_LENGTH); } } diff --git a/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatUnitAndLengthCovariate.java b/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatUnitAndLengthCovariate.java new file mode 100644 index 000000000..36c5d57d3 --- /dev/null +++ b/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatUnitAndLengthCovariate.java @@ -0,0 +1,295 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.sting.utils.recalibration.covariates; + +import com.google.java.contract.Ensures; +import com.google.java.contract.Requires; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; +import org.broadinstitute.sting.utils.recalibration.ReadCovariates; +import org.broadinstitute.sting.utils.sam.GATKSAMRecord; +import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; +import org.broadinstitute.variant.utils.BaseUtils; +import org.broadinstitute.variant.utils.Pair; +import org.broadinstitute.variant.variantcontext.VariantContextUtils; + +import java.util.Arrays; +import java.util.HashMap; +import java.util.Map; +import java.util.Set; + + +public class RepeatUnitAndLengthCovariate implements ExperimentalCovariate { + final int MAX_REPEAT_LENGTH = 20; + final int MAX_STR_UNIT_LENGTH = 8; + public final boolean RECORD_REPUNIT_WITH_REPLENGTH = true; + private final HashMap repeatLookupTable = new HashMap(); + private final HashMap repeatReverseLookupTable = new HashMap(); + private int nextId = 0; + + // Initialize any member variables using the command-line arguments passed to the walkers + @Override + public void initialize(final RecalibrationArgumentCollection RAC) { + } + + @Override + public void recordValues(final GATKSAMRecord read, final ReadCovariates values) { + // store the original bases and then write Ns over low quality ones + final byte[] originalBases = read.getReadBases().clone(); + + final boolean negativeStrand = read.getReadNegativeStrandFlag(); + byte[] bases = read.getReadBases(); + if (negativeStrand) + bases = BaseUtils.simpleReverseComplement(bases); + + // don't record reads with N's + if (!BaseUtils.isAllRegularBases(bases)) + return; + + for (int i = 0; i < bases.length; i++) { + final Pair res = findTandemRepeatUnits(bases, i); + // merge repeat unit and repeat length to get covariate value + final String repeatID = repeatFromUnitAndLength(res.first, res.second); + final int key = keyForRepeat(repeatID); + + final int readOffset = (negativeStrand ? bases.length - i - 1 : i); + values.addCovariate(key, key, key, readOffset); + } + + // put the original bases back in + read.setReadBases(originalBases); + + } + + private Pair findTandemRepeatUnits(byte[] readBases, int offset) { + int maxBW = 0; + byte[] bestBWRepeatUnit = new byte[]{readBases[offset]}; + for (int str = 1; str <= MAX_STR_UNIT_LENGTH; str++) { + // fix repeat unit length + //edge case: if candidate tandem repeat unit falls beyond edge of read, skip + if (offset+1-str < 0) + break; + + // get backward repeat unit and # repeats + byte[] backwardRepeatUnit = Arrays.copyOfRange(readBases, offset - str+1, offset+1); + maxBW = VariantContextUtils.findNumberofRepetitions(backwardRepeatUnit,Arrays.copyOfRange(readBases, 0, offset+1), false); + if (maxBW > 1) { + bestBWRepeatUnit = backwardRepeatUnit.clone(); + break; + } + } + byte[] bestRepeatUnit = bestBWRepeatUnit; + int maxRL = maxBW; + + if (offset < readBases.length-1) { + byte[] bestFWRepeatUnit = new byte[]{readBases[offset+1]}; + int maxFW = 0; + for (int str = 1; str <= MAX_STR_UNIT_LENGTH; str++) { + // fix repeat unit length + //edge case: if candidate tandem repeat unit falls beyond edge of read, skip + if (offset+str+1 > readBases.length) + break; + + // get forward repeat unit and # repeats + byte[] forwardRepeatUnit = Arrays.copyOfRange(readBases, offset +1, offset+str+1); + maxFW = VariantContextUtils.findNumberofRepetitions(forwardRepeatUnit,Arrays.copyOfRange(readBases, offset+1, readBases.length), true); + if (maxFW > 1) { + bestFWRepeatUnit = forwardRepeatUnit.clone(); + break; + } + } + // if FW repeat unit = BW repeat unit it means we're in the middle of a tandem repeat - add FW and BW components + if (Arrays.equals(bestFWRepeatUnit, bestBWRepeatUnit)) { + maxRL = maxBW + maxFW; + bestRepeatUnit = bestFWRepeatUnit; // arbitrary + } + else { + // tandem repeat starting forward from current offset + maxRL = maxFW; + bestRepeatUnit = bestFWRepeatUnit; + + } +/* if (maxFW > maxBW) { + // tandem repeat starting forward from current offset + maxRL = maxFW; + bestRepeatUnit = bestFWRepeatUnit; + } + else if (maxFW < maxBW) { + maxRL = maxBW; + bestRepeatUnit = bestBWRepeatUnit; + } */ + /* else { + // maxFW = maxBW but repeat units different: not in a tandem repeat. + maxRL = 1; + bestRepeatUnit = bestBWRepeatUnit; // arbitrary + } */ + + } + + + + if(maxRL > MAX_REPEAT_LENGTH) { maxRL = MAX_REPEAT_LENGTH; } + return new Pair(bestRepeatUnit, maxRL); + + } + @Override + public final Object getValue(final String str) { + return str; + } + + @Override + public synchronized String formatKey(final int key) { + // This method is synchronized so that we don't attempt to do a get() + // from the reverse lookup table while that table is being updated + return repeatReverseLookupTable.get(key); + } + + @Override + public int keyFromValue(final Object value) { + return keyForRepeat((String) value); + } + + /** + * Get the mapping from read group names to integer key values for all read groups in this covariate + * @return a set of mappings from read group names -> integer key values + */ + public Set> getKeyMap() { + return repeatLookupTable.entrySet(); + } + + @Requires({"repeatLength>=0", "repeatFromUnitAndLength != null"}) + @Ensures("result != null") + private String repeatFromUnitAndLength(final byte[] repeatFromUnitAndLength, final int repeatLength) { + if (RECORD_REPUNIT_WITH_REPLENGTH) + return new String(repeatFromUnitAndLength) + String.format("%d",repeatLength); + else + return String.format("%d",repeatLength); + } + + private int keyForRepeat(final String repeatID) { + // Rather than synchronize this entire method (which would be VERY expensive for walkers like the BQSR), + // synchronize only the table updates. + + // Before entering the synchronized block, check to see if this read group is not in our tables. + // If it's not, either we will have to insert it, OR another thread will insert it first. + // This preliminary check avoids doing any synchronization most of the time. + if ( ! repeatLookupTable.containsKey(repeatID) ) { + + synchronized ( this ) { + + // Now we need to make sure the key is STILL not there, since another thread may have come along + // and inserted it while we were waiting to enter this synchronized block! + if ( ! repeatLookupTable.containsKey(repeatID) ) { + repeatLookupTable.put(repeatID, nextId); + repeatReverseLookupTable.put(nextId, repeatID); + nextId++; + } + } + } + + return repeatLookupTable.get(repeatID); + } + + + /** + * Splits repeat unit and num repetitions from covariate value. + * For example, if value if "ATG4" it returns (ATG,4) + * @param value Covariate value + * @return Split pair + */ + @Requires("value != null") + @Ensures({"result.first != null","result.second>=0"}) + public static Pair getRUandNRfromCovariate(final String value) { + + int k = 0; + for ( k=0; k < value.length(); k++ ) { + if (!BaseUtils.isRegularBase(value.getBytes()[k])) + break; + } + Integer nr = Integer.valueOf(value.substring(k,value.length())); // will throw NumberFormatException if format illegal + if (k == value.length() || nr <= 0) + throw new IllegalStateException("Covariate is not of form (Repeat Unit) + Integer"); + + return new Pair(value.substring(0,k), nr); + } + + /** + * Gets bases from tandem repeat representation (Repeat Unit),(Number of Repeats). + * For example, (AGC),3 returns AGCAGCAGC + * @param repeatUnit Tandem repeat unit + * @param numRepeats Number of repeats + * @return Expanded String + */ + @Requires({"numRepeats > 0","repeatUnit != null"}) + @Ensures("result != null") + public static String getBasesFromRUandNR(final String repeatUnit, final int numRepeats) { + final StringBuilder sb = new StringBuilder(); + + for (int i=0; i < numRepeats; i++) + sb.append(repeatUnit); + + return sb.toString(); + } + + // version given covariate key + public static String getBasesFromRUandNR(final String covariateValue) { + Pair pair = getRUandNRfromCovariate(covariateValue); + return getBasesFromRUandNR(pair.getFirst(), pair.getSecond()); + } + + @Override + public synchronized int maximumKeyValue() { + // Synchronized so that we don't query table size while the tables are being updated + //return repeatLookupTable.size() - 1; + // max possible values of covariate: for repeat unit, length is up to MAX_STR_UNIT_LENGTH, + // so we have 4^MAX_STR_UNIT_LENGTH * MAX_REPEAT_LENGTH possible values + if (RECORD_REPUNIT_WITH_REPLENGTH) + return (1<<(2*MAX_STR_UNIT_LENGTH)) * MAX_REPEAT_LENGTH +1; + else + return (1+MAX_REPEAT_LENGTH); + } + +} diff --git a/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatUnitCovariate.java b/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatUnitCovariate.java new file mode 100644 index 000000000..9e98e741e --- /dev/null +++ b/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatUnitCovariate.java @@ -0,0 +1,288 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.sting.utils.recalibration.covariates; + +import com.google.java.contract.Ensures; +import com.google.java.contract.Requires; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; +import org.broadinstitute.sting.utils.recalibration.ReadCovariates; +import org.broadinstitute.sting.utils.sam.GATKSAMRecord; +import org.broadinstitute.variant.utils.BaseUtils; +import org.broadinstitute.variant.utils.Pair; +import org.broadinstitute.variant.variantcontext.VariantContextUtils; + +import java.util.Arrays; +import java.util.HashMap; +import java.util.Map; +import java.util.Set; + +/** + * Created with IntelliJ IDEA. + * User: rpoplin + * Date: 11/3/12 + */ + +public class RepeatUnitCovariate implements ExperimentalCovariate { + final int MAX_REPEAT_LENGTH = 20; + final int MAX_STR_UNIT_LENGTH = 8; + private final HashMap repeatLookupTable = new HashMap(); + private final HashMap repeatReverseLookupTable = new HashMap(); + private int nextId = 0; + + // Initialize any member variables using the command-line arguments passed to the walkers + @Override + public void initialize(final RecalibrationArgumentCollection RAC) { + } + + @Override + public void recordValues(final GATKSAMRecord read, final ReadCovariates values) { + // store the original bases and then write Ns over low quality ones + final byte[] originalBases = read.getReadBases().clone(); + + final boolean negativeStrand = read.getReadNegativeStrandFlag(); + byte[] bases = read.getReadBases(); + if (negativeStrand) + bases = BaseUtils.simpleReverseComplement(bases); + + // don't record reads with N's + if (!BaseUtils.isAllRegularBases(bases)) + return; + + for (int i = 0; i < bases.length; i++) { + final Pair res = findTandemRepeatUnits(bases, i); + // to merge repeat unit and repeat length to get covariate value: + //final String repeatID = repeatFromUnitAndLength(res.first, res.second); + final String repeatID = new String(res.first); + final int key = keyForRepeat(repeatID); + + final int readOffset = (negativeStrand ? bases.length - i - 1 : i); + values.addCovariate(key, key, key, readOffset); + } + + // put the original bases back in + read.setReadBases(originalBases); + + } + + private Pair findTandemRepeatUnits(byte[] readBases, int offset) { + int maxBW = 0; + byte[] bestBWRepeatUnit = new byte[]{readBases[offset]}; + for (int str = 1; str <= MAX_STR_UNIT_LENGTH; str++) { + // fix repeat unit length + //edge case: if candidate tandem repeat unit falls beyond edge of read, skip + if (offset+1-str < 0) + break; + + // get backward repeat unit and # repeats + byte[] backwardRepeatUnit = Arrays.copyOfRange(readBases, offset - str+1, offset+1); + maxBW = VariantContextUtils.findNumberofRepetitions(backwardRepeatUnit,Arrays.copyOfRange(readBases, 0, offset+1), false); + if (maxBW > 1) { + bestBWRepeatUnit = backwardRepeatUnit.clone(); + break; + } + } + byte[] bestRepeatUnit = bestBWRepeatUnit; + int maxRL = maxBW; + + if (offset < readBases.length-1) { + byte[] bestFWRepeatUnit = new byte[]{readBases[offset+1]}; + int maxFW = 0; + for (int str = 1; str <= MAX_STR_UNIT_LENGTH; str++) { + // fix repeat unit length + //edge case: if candidate tandem repeat unit falls beyond edge of read, skip + if (offset+str+1 > readBases.length) + break; + + // get forward repeat unit and # repeats + byte[] forwardRepeatUnit = Arrays.copyOfRange(readBases, offset +1, offset+str+1); + maxFW = VariantContextUtils.findNumberofRepetitions(forwardRepeatUnit,Arrays.copyOfRange(readBases, offset+1, readBases.length), true); + if (maxFW > 1) { + bestFWRepeatUnit = forwardRepeatUnit.clone(); + break; + } + } + // if FW repeat unit = BW repeat unit it means we're in the middle of a tandem repeat - add FW and BW components + if (Arrays.equals(bestFWRepeatUnit, bestBWRepeatUnit)) { + maxRL = maxBW + maxFW; + bestRepeatUnit = bestFWRepeatUnit; // arbitrary + } + else { + // tandem repeat starting forward from current offset + maxRL = maxFW; + bestRepeatUnit = bestFWRepeatUnit; + + } +/* if (maxFW > maxBW) { + // tandem repeat starting forward from current offset + maxRL = maxFW; + bestRepeatUnit = bestFWRepeatUnit; + } + else if (maxFW < maxBW) { + maxRL = maxBW; + bestRepeatUnit = bestBWRepeatUnit; + } */ + /* else { + // maxFW = maxBW but repeat units different: not in a tandem repeat. + maxRL = 1; + bestRepeatUnit = bestBWRepeatUnit; // arbitrary + } */ + + } + + + + if(maxRL > MAX_REPEAT_LENGTH) { maxRL = MAX_REPEAT_LENGTH; } + return new Pair(bestRepeatUnit, maxRL); + + } + @Override + public final Object getValue(final String str) { + return str; + } + + @Override + public synchronized String formatKey(final int key) { + // This method is synchronized so that we don't attempt to do a get() + // from the reverse lookup table while that table is being updated + return repeatReverseLookupTable.get(key); + } + + @Override + public int keyFromValue(final Object value) { + return keyForRepeat((String) value); + } + + /** + * Get the mapping from read group names to integer key values for all read groups in this covariate + * @return a set of mappings from read group names -> integer key values + */ + public Set> getKeyMap() { + return repeatLookupTable.entrySet(); + } + + private int keyForRepeat(final String repeatID) { + // Rather than synchronize this entire method (which would be VERY expensive for walkers like the BQSR), + // synchronize only the table updates. + + // Before entering the synchronized block, check to see if this read group is not in our tables. + // If it's not, either we will have to insert it, OR another thread will insert it first. + // This preliminary check avoids doing any synchronization most of the time. + if ( ! repeatLookupTable.containsKey(repeatID) ) { + + synchronized ( this ) { + + // Now we need to make sure the key is STILL not there, since another thread may have come along + // and inserted it while we were waiting to enter this synchronized block! + if ( ! repeatLookupTable.containsKey(repeatID) ) { + repeatLookupTable.put(repeatID, nextId); + repeatReverseLookupTable.put(nextId, repeatID); + nextId++; + } + } + } + + return repeatLookupTable.get(repeatID); + } + + + /** + * Splits repeat unit and num repetitions from covariate value. + * For example, if value if "ATG4" it returns (ATG,4) + * @param value Covariate value + * @return Split pair + */ + @Requires("value != null") + @Ensures({"result.first != null","result.second>=0"}) + public static Pair getRUandNRfromCovariate(final String value) { + + int k = 0; + for ( k=0; k < value.length(); k++ ) { + if (!BaseUtils.isRegularBase(value.getBytes()[k])) + break; + } + Integer nr = Integer.valueOf(value.substring(k,value.length())); // will throw NumberFormatException if format illegal + if (k == value.length() || nr <= 0) + throw new IllegalStateException("Covariate is not of form (Repeat Unit) + Integer"); + + return new Pair(value.substring(0,k), nr); + } + + /** + * Gets bases from tandem repeat representation (Repeat Unit),(Number of Repeats). + * For example, (AGC),3 returns AGCAGCAGC + * @param repeatUnit Tandem repeat unit + * @param numRepeats Number of repeats + * @return Expanded String + */ + @Requires({"numRepeats > 0","repeatUnit != null"}) + @Ensures("result != null") + public static String getBasesFromRUandNR(final String repeatUnit, final int numRepeats) { + final StringBuilder sb = new StringBuilder(); + + for (int i=0; i < numRepeats; i++) + sb.append(repeatUnit); + + return sb.toString(); + } + + // version given covariate key + public static String getBasesFromRUandNR(final String covariateValue) { + Pair pair = getRUandNRfromCovariate(covariateValue); + return getBasesFromRUandNR(pair.getFirst(), pair.getSecond()); + } + + @Override + public synchronized int maximumKeyValue() { + // Synchronized so that we don't query table size while the tables are being updated + //return repeatLookupTable.size() - 1; + // max possible values of covariate: for repeat unit, length is up to MAX_STR_UNIT_LENGTH, + // so we have 4^MAX_STR_UNIT_LENGTH * MAX_REPEAT_LENGTH possible values + return (1<<(2*MAX_STR_UNIT_LENGTH)) +1; + } + + +} diff --git a/protected/java/test/org/broadinstitute/sting/utils/recalibration/RepeatLengthCovariateUnitTest.java b/protected/java/test/org/broadinstitute/sting/utils/recalibration/RepeatLengthCovariateUnitTest.java new file mode 100644 index 000000000..d08276147 --- /dev/null +++ b/protected/java/test/org/broadinstitute/sting/utils/recalibration/RepeatLengthCovariateUnitTest.java @@ -0,0 +1,213 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.sting.utils.recalibration; + +import com.google.java.contract.Requires; +import net.sf.samtools.SAMFileHeader; +import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; +import org.broadinstitute.sting.utils.recalibration.covariates.RepeatLengthCovariate; +import org.broadinstitute.sting.utils.sam.ArtificialSAMUtils; +import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; +import org.broadinstitute.sting.utils.sam.GATKSAMRecord; +import org.broadinstitute.variant.utils.BaseUtils; +import org.broadinstitute.variant.utils.Pair; +import org.broadinstitute.variant.variantcontext.VariantContextUtils; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.Test; + +import java.io.File; +import java.util.ArrayList; +import java.util.Arrays; +import java.util.Random; + +public class RepeatLengthCovariateUnitTest { + + RepeatLengthCovariate covariate; + RecalibrationArgumentCollection RAC; + + + + @BeforeClass + public void init() { + RAC = new RecalibrationArgumentCollection(); + covariate = new RepeatLengthCovariate(); + covariate.initialize(RAC); + } + + + @Test(enabled = true) + public void testFindNumberOfRepetitions() { + // First, test logic to compute number of repetitions of a substring on a given string. + int result = VariantContextUtils.findNumberofRepetitions("AC".getBytes(), "ACAC".getBytes(), true); + Assert.assertEquals(2,result); + result = VariantContextUtils.findNumberofRepetitions("AC".getBytes(),"ACACACAC".getBytes(), true); + Assert.assertEquals(4,result); + result = VariantContextUtils.findNumberofRepetitions("AC".getBytes(),"ACACACACGT".getBytes(), true); + Assert.assertEquals(4,result); + result = VariantContextUtils.findNumberofRepetitions("AC".getBytes(),"GTACACACAC".getBytes(), true); + Assert.assertEquals(0,result); + result = VariantContextUtils.findNumberofRepetitions("GCA".getBytes(),"GTAGGGT".getBytes(), true); + Assert.assertEquals(0,result); + result = VariantContextUtils.findNumberofRepetitions("GCAGCA".getBytes(),"GCAGCAGTAGGGTGTACACACAC".getBytes(), true); + Assert.assertEquals(1,result); + result = VariantContextUtils.findNumberofRepetitions("GCAGCA".getBytes(),"GTAGGGTGTACACACACGCAGCAT".getBytes(), true); + Assert.assertEquals(0,result); + result = VariantContextUtils.findNumberofRepetitions("GCA".getBytes(),"GTAGGGTGTACACACACGCAGCAGCA".getBytes(), true); + Assert.assertEquals(0,result); + // Same tests but looking backward on string + result = VariantContextUtils.findNumberofRepetitions("AC".getBytes(),"ACAC".getBytes(), false); + Assert.assertEquals(2,result); + result = VariantContextUtils.findNumberofRepetitions("AC".getBytes(),"ACACACAC".getBytes(), false); + Assert.assertEquals(4,result); + result = VariantContextUtils.findNumberofRepetitions("AC".getBytes(),"ACACACACGT".getBytes(), false); + Assert.assertEquals(0,result); + result = VariantContextUtils.findNumberofRepetitions("AC".getBytes(),"GTACACACAC".getBytes(), false); + Assert.assertEquals(4,result); + result = VariantContextUtils.findNumberofRepetitions("GCA".getBytes(),"GTAGGGT".getBytes(), false); + Assert.assertEquals(0,result); + result = VariantContextUtils.findNumberofRepetitions("GCAGCA".getBytes(),"GCAGCAGTAGGGTGTACACACAC".getBytes(), false); + Assert.assertEquals(0,result); + result = VariantContextUtils.findNumberofRepetitions("GCAGCA".getBytes(),"GTAGGGTGTACACACACGCAGCAT".getBytes(), false); + Assert.assertEquals(0,result); + result = VariantContextUtils.findNumberofRepetitions("GCA".getBytes(),"GTAGGGTGTACACACACGCAGCAGCA".getBytes(), false); + Assert.assertEquals(3,result); + + // test logic to get repeat unit and number of repeats from covariate value + final String[] repUnits = new String[]{"AG","CCG","TCCA","T"}; + for (String ru : repUnits) { + for (int k=1; k < 10; k++) { + Pair pair = RepeatLengthCovariate.getRUandNRfromCovariate(String.format("%s%d",ru,k)); + Assert.assertEquals(pair.second.intValue(),k); + Assert.assertEquals(pair.first,ru); + } + } + + } + + /** + * Build synthetic reads with random content made up of tandem repeats, record computed Repeat Unit and # repeats and see if + * they match with read context + */ + @Test(enabled = true) + public void testManyObservations() { + final int NUM_UNITS = 10; + final int MAX_REPEAT_UNIT_LENGTH = 6; + final int MAX_NUM_REPETITIONS = 5; + final int NUM_TEST_CASES = 1; + + Random random = new Random(); + + for (int r = 0; r < NUM_TEST_CASES; r++) { + final StringBuilder sb = new StringBuilder(); + // for each unit, generate a repeat unit at random with given random length + final ArrayList repeatUnits = new ArrayList(); + final ArrayList numsRepetitions = new ArrayList(); + for (int n=0; n < NUM_UNITS; n++) { + final int repLength = 1+random.nextInt(MAX_REPEAT_UNIT_LENGTH); + final String repeatUnit = getRandomBases(repLength); + final int numRepetitions = 1+random.nextInt(MAX_NUM_REPETITIONS); + + // log for comparison with covariate + numsRepetitions.add(numRepetitions); + repeatUnits.add(repeatUnit); + + for (int k=0; k < numRepetitions; k++) + sb.append(repeatUnit); + + } + + // final String readBases = sb.toString(); + final String readBases = "TTTTTTTTAATGGGGGAGGGAGGGAGACTTACTTACTTACTTACTTATCGGAATCGGATATATAACGGCTTTCTTCTTCCCCCCA"; + System.out.println(readBases); + + final byte[] readQuals = new byte[readBases.length()]; + Arrays.fill(readQuals,(byte)30); + final GATKSAMRecord read = ArtificialSAMUtils.createArtificialRead(readBases.getBytes(),readQuals,readBases.length()+"M"); + + final ReadCovariates values = new ReadCovariates(read.getReadLength(),1); + covariate.recordValues( read, values); + final int fullReadKeySet[][] = values.getKeySet(EventType.BASE_SUBSTITUTION); + for (int offset = 0; offset < readBases.length(); offset++) { // recalibrate all bases in the read + final int[] keySet = fullReadKeySet[offset]; + final String val = covariate.formatKey(keySet[0]); + System.out.format("offset %d:%s\n", offset, val); +// final String repeatString = RepeatLengthCovariate.getBasesFromRUandNR(val); +// final String partialRead = readBases.substring(0,offset+1); + // Assert.assertTrue(partialRead.endsWith(repeatString)); + } + //values. + int k=0; + + + } + + + + + + + } + + /** + * Returns random bases of given length + * @param length required length + * @return given random string + */ + @Requires("length > 0") + String getRandomBases(final int length) { + byte[] bases = new byte[length]; + Random ran = new Random(); + for (int i=0; i < length; i++ ) { + int idx = ran.nextInt(4); + bases[i] = BaseUtils.baseIndexToSimpleBase(idx); + } + return new String(bases); + } + + +} diff --git a/public/java/src/org/broadinstitute/sting/utils/R/RScriptExecutor.java b/public/java/src/org/broadinstitute/sting/utils/R/RScriptExecutor.java index 0d6450c8f..04205350f 100644 --- a/public/java/src/org/broadinstitute/sting/utils/R/RScriptExecutor.java +++ b/public/java/src/org/broadinstitute/sting/utils/R/RScriptExecutor.java @@ -110,15 +110,17 @@ public class RScriptExecutor { List tempFiles = new ArrayList(); try { - File tempLibDir = IOUtils.tempDir("Rlib.", ""); - tempFiles.add(tempLibDir); + File tempLibSourceDir = IOUtils.tempDir("RlibSources.", ""); + File tempLibInstallationDir = IOUtils.tempDir("Rlib.", ""); + tempFiles.add(tempLibSourceDir); + tempFiles.add(tempLibInstallationDir); - StringBuilder expression = new StringBuilder("tempLibDir = '").append(tempLibDir).append("';"); + StringBuilder expression = new StringBuilder("tempLibDir = '").append(tempLibInstallationDir).append("';"); if (this.libraries.size() > 0) { List tempLibraryPaths = new ArrayList(); for (RScriptLibrary library: this.libraries) { - File tempLibrary = library.writeTemp(); + File tempLibrary = library.writeLibrary(tempLibSourceDir); tempFiles.add(tempLibrary); tempLibraryPaths.add(tempLibrary.getAbsolutePath()); } diff --git a/public/java/src/org/broadinstitute/sting/utils/R/RScriptLibrary.java b/public/java/src/org/broadinstitute/sting/utils/R/RScriptLibrary.java index 685979d83..93110ccdc 100644 --- a/public/java/src/org/broadinstitute/sting/utils/R/RScriptLibrary.java +++ b/public/java/src/org/broadinstitute/sting/utils/R/RScriptLibrary.java @@ -57,4 +57,10 @@ public enum RScriptLibrary { public File writeTemp() { return IOUtils.writeTempResource(new Resource(getResourcePath(), RScriptLibrary.class)); } + + public File writeLibrary(File tempDir) { + File libraryFile = new File(tempDir, getLibraryName()); + IOUtils.writeResource(new Resource(getResourcePath(), RScriptLibrary.class), libraryFile); + return libraryFile; + } } diff --git a/public/java/src/org/broadinstitute/sting/utils/SampleUtils.java b/public/java/src/org/broadinstitute/sting/utils/SampleUtils.java index 4e98897cf..f158308b4 100644 --- a/public/java/src/org/broadinstitute/sting/utils/SampleUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/SampleUtils.java @@ -143,8 +143,11 @@ public class SampleUtils { for ( Map.Entry val : VCF_Headers.entrySet() ) { VCFHeader header = val.getValue(); for ( String sample : header.getGenotypeSamples() ) { - if (samples.add(sample)) + if (samples.contains(sample)){ + return false; + } + samples.add(sample); } } diff --git a/public/java/src/org/broadinstitute/variant/variantcontext/VariantContextUtils.java b/public/java/src/org/broadinstitute/variant/variantcontext/VariantContextUtils.java index fb97d41ff..a6378951e 100644 --- a/public/java/src/org/broadinstitute/variant/variantcontext/VariantContextUtils.java +++ b/public/java/src/org/broadinstitute/variant/variantcontext/VariantContextUtils.java @@ -266,9 +266,9 @@ public class VariantContextUtils { return new Pair, byte[]>(lengths,repeatUnit); } - protected static Pair getNumTandemRepeatUnits(final byte[] refBases, final byte[] altBases, final byte[] remainingRefContext) { + public static Pair getNumTandemRepeatUnits(final byte[] refBases, final byte[] altBases, final byte[] remainingRefContext) { /* we can't exactly apply same logic as in basesAreRepeated() to compute tandem unit and number of repeated units. - Consider case where ref =ATATAT and we have an insertion of ATAT. Natural description is (AT)3 -> (AT)5. + Consider case where ref =ATATAT and we have an insertion of ATAT. Natural description is (AT)3 -> (AT)2. */ byte[] longB; @@ -284,11 +284,10 @@ public class VariantContextUtils { final byte[] repeatUnit = Arrays.copyOf(longB, repeatUnitLength); final int[] repetitionCount = new int[2]; -// repetitionCount[0] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(refBases, remainingRefContext)); -// repetitionCount[1] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(altBases, remainingRefContext)); - int repetitionsInRef = findNumberofRepetitions(repeatUnit,refBases); - repetitionCount[0] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(refBases, remainingRefContext))-repetitionsInRef; - repetitionCount[1] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(altBases, remainingRefContext))-repetitionsInRef; + // look for repetitions forward on the ref bases (i.e. starting at beginning of ref bases) + int repetitionsInRef = findNumberofRepetitions(repeatUnit,refBases, true); + repetitionCount[0] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(refBases, remainingRefContext), true)-repetitionsInRef; + repetitionCount[1] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(altBases, remainingRefContext), true)-repetitionsInRef; return new Pair(repetitionCount, repeatUnit); @@ -329,17 +328,33 @@ public class VariantContextUtils { * For example, for string ATAT and repeat unit AT, number of repetitions = 2 * @param repeatUnit Substring * @param testString String to test + * @oaram lookForward Look for repetitions forward (at beginning of string) or backward (at end of string) * @return Number of repetitions (0 if testString is not a concatenation of n repeatUnit's */ - public static int findNumberofRepetitions(byte[] repeatUnit, byte[] testString) { + public static int findNumberofRepetitions(byte[] repeatUnit, byte[] testString, boolean lookForward) { int numRepeats = 0; - for (int start = 0; start < testString.length; start += repeatUnit.length) { + if (lookForward) { + // look forward on the test string + for (int start = 0; start < testString.length; start += repeatUnit.length) { + int end = start + repeatUnit.length; + byte[] unit = Arrays.copyOfRange(testString,start, end); + if(Arrays.equals(unit,repeatUnit)) + numRepeats++; + else + break; + } + return numRepeats; + } + + // look backward. For example, if repeatUnit = AT and testString = GATAT, number of repeat units is still 2 + // look forward on the test string + for (int start = testString.length - repeatUnit.length; start >= 0; start -= repeatUnit.length) { int end = start + repeatUnit.length; byte[] unit = Arrays.copyOfRange(testString,start, end); if(Arrays.equals(unit,repeatUnit)) numRepeats++; else - return numRepeats; + break; } return numRepeats; } @@ -369,7 +384,7 @@ public class VariantContextUtils { final int start = i * potentialRepeat.length(); final int end = (i+1) * potentialRepeat.length(); if ( ref.length() < end ) - return false; // we ran out of bases to test + return false; // we ran out of bases to test final String refSub = ref.substring(start, end); if ( ! refSub.equals(potentialRepeat) ) return false; // repeat didn't match, fail diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUnitTest.java index d09800760..25e9878ae 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUnitTest.java @@ -499,11 +499,11 @@ public class VariantContextUnitTest extends VariantBaseTest { Pair,byte[]> result; byte[] refBytes = "TATCATCATCGGA".getBytes(); - Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("ATG".getBytes(), "ATGATGATGATG".getBytes()),4); - Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("G".getBytes(), "ATGATGATGATG".getBytes()),0); - Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("T".getBytes(), "T".getBytes()),1); - Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("AT".getBytes(), "ATGATGATCATG".getBytes()),1); - Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("CCC".getBytes(), "CCCCCCCC".getBytes()),2); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("ATG".getBytes(), "ATGATGATGATG".getBytes(), true),4); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("G".getBytes(), "ATGATGATGATG".getBytes(), true),0); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("T".getBytes(), "T".getBytes(), true),1); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("AT".getBytes(), "ATGATGATCATG".getBytes(), true),1); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("CCC".getBytes(), "CCCCCCCC".getBytes(), true),2); Assert.assertEquals(VariantContextUtils.findRepeatedSubstring("ATG".getBytes()),3); Assert.assertEquals(VariantContextUtils.findRepeatedSubstring("AAA".getBytes()),1);