diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java index 2787689b5..52c13d124 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java @@ -533,27 +533,18 @@ public class GenotypingEngine { final int elementLength = ce.getLength(); switch( ce.getOperator() ) { case I: - final byte[] insertionBases = Arrays.copyOfRange( alignment, alignmentPos - 1, alignmentPos + elementLength ); // add padding base - boolean allN = true; - for( int i = 1; i < insertionBases.length; i++ ) { // check all bases except for the padding base - if( insertionBases[i] != (byte) 'N' ) { - allN = false; - break; - } - } - if( !allN ) { - final ArrayList insertionAlleles = new ArrayList(); - final int insertionStart = refLoc.getStart() + refPos - 1; - insertionAlleles.add( Allele.create(ref[refPos-1], true) ); - if( haplotype != null && (haplotype.leftBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() - 1 == insertionStart + elementLength + 1 || haplotype.rightBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() - 1 == insertionStart + elementLength + 1) ) { - insertionAlleles.add( SYMBOLIC_UNASSEMBLED_EVENT_ALLELE ); - vcs.put(insertionStart, new VariantContextBuilder(sourceNameToAdd, refLoc.getContig(), insertionStart, insertionStart, insertionAlleles).make()); - } else { - insertionAlleles.add( Allele.create(insertionBases, false) ); - vcs.put(insertionStart, new VariantContextBuilder(sourceNameToAdd, refLoc.getContig(), insertionStart, insertionStart, insertionAlleles).make()); - } - + final ArrayList insertionAlleles = new ArrayList(); + final int insertionStart = refLoc.getStart() + refPos - 1; + insertionAlleles.add( Allele.create(ref[refPos-1], true) ); + if( haplotype != null && (haplotype.leftBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() - 1 == insertionStart + elementLength + 1 || haplotype.rightBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() - 1 == insertionStart + elementLength + 1) ) { + insertionAlleles.add( SYMBOLIC_UNASSEMBLED_EVENT_ALLELE ); + } else { + byte[] insertionBases = new byte[]{}; + insertionBases = ArrayUtils.add(insertionBases, ref[refPos-1]); // add the padding base + insertionBases = ArrayUtils.addAll(insertionBases, Arrays.copyOfRange( alignment, alignmentPos, alignmentPos + elementLength )); + insertionAlleles.add( Allele.create(insertionBases, false) ); } + vcs.put(insertionStart, new VariantContextBuilder(sourceNameToAdd, refLoc.getContig(), insertionStart, insertionStart, insertionAlleles).make()); alignmentPos += elementLength; break; case S: diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssembler.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssembler.java index e2bc7a10f..be6c4a51f 100755 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssembler.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssembler.java @@ -281,7 +281,7 @@ public class SimpleDeBruijnAssembler extends LocalAssemblyEngine { final Haplotype h = new Haplotype( path.getBases( graph ), path.getScore() ); if( addHaplotype( h, fullReferenceWithPadding, returnHaplotypes, activeRegionStart, activeRegionStop ) ) { if( !activeAllelesToGenotype.isEmpty() ) { // for GGA mode, add the desired allele into the haplotype if it isn't already present - final HashMap eventMap = GenotypingEngine.generateVCsFromAlignment( h.getAlignmentStartHapwrtRef(), h.getCigar(), fullReferenceWithPadding, h.getBases(), refLoc, "HCassembly", 0 ); // BUGBUG: need to put this function in a shared place + final HashMap eventMap = GenotypingEngine.generateVCsFromAlignment( h, h.getAlignmentStartHapwrtRef(), h.getCigar(), fullReferenceWithPadding, h.getBases(), refLoc, "HCassembly", 0 ); // BUGBUG: need to put this function in a shared place for( final VariantContext compVC : activeAllelesToGenotype ) { // for GGA mode, add the desired allele into the haplotype if it isn't already present final VariantContext vcOnHaplotype = eventMap.get(compVC.getStart()); if( vcOnHaplotype == null || !vcOnHaplotype.hasSameAllelesAs(compVC) ) { @@ -311,7 +311,8 @@ public class SimpleDeBruijnAssembler extends LocalAssemblyEngine { } private boolean addHaplotype( final Haplotype haplotype, final byte[] ref, final ArrayList haplotypeList, final int activeRegionStart, final int activeRegionStop ) { - //final int sizeOfActiveRegion = activeRegionStop - activeRegionStart; + if( haplotype == null ) { return false; } + final SWPairwiseAlignment swConsensus = new SWPairwiseAlignment( ref, haplotype.getBases(), SW_MATCH, SW_MISMATCH, SW_GAP, SW_GAP_EXTEND ); haplotype.setAlignmentStartHapwrtRef( swConsensus.getAlignmentStart2wrt1() ); haplotype.setCigar( AlignmentUtils.leftAlignIndel(swConsensus.getCigar(), ref, haplotype.getBases(), swConsensus.getAlignmentStart2wrt1(), 0) ); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrator.java index ab2ff6176..c670ad2fd 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrator.java @@ -331,7 +331,7 @@ public class VariantRecalibrator extends RodWalker= 0"}) - public Haplotype insertAllele( final Allele refAllele, final Allele altAllele, int refInsertLocation ) { - - if( refAllele.length() != altAllele.length() ) { refInsertLocation++; } + public Haplotype insertAllele( final Allele refAllele, final Allele altAllele, final int refInsertLocation ) { + // refInsertLocation is in ref haplotype offset coordinates NOT genomic coordinates final int haplotypeInsertLocation = ReadUtils.getReadCoordinateForReferenceCoordinate(alignmentStartHapwrtRef, cigar, refInsertLocation, ReadUtils.ClippingTail.RIGHT_TAIL, true); - if( haplotypeInsertLocation == -1 ) { // desired change falls inside deletion so don't bother creating a new haplotype - return new Haplotype(bases.clone()); + if( haplotypeInsertLocation == -1 || haplotypeInsertLocation + refAllele.length() >= bases.length ) { // desired change falls inside deletion so don't bother creating a new haplotype + return null; } - byte[] newHaplotype; - - try { - if( refAllele.length() == altAllele.length() ) { // SNP or MNP - newHaplotype = bases.clone(); - for( int iii = 0; iii < altAllele.length(); iii++ ) { - newHaplotype[haplotypeInsertLocation+iii] = altAllele.getBases()[iii]; - } - } else if( refAllele.length() < altAllele.length() ) { // insertion - final int altAlleleLength = altAllele.length() - 1; - newHaplotype = new byte[bases.length + altAlleleLength]; - for( int iii = 0; iii < bases.length; iii++ ) { - newHaplotype[iii] = bases[iii]; - } - for( int iii = newHaplotype.length - 1; iii > haplotypeInsertLocation + altAlleleLength - 1; iii-- ) { - newHaplotype[iii] = newHaplotype[iii-altAlleleLength]; - } - for( int iii = 0; iii < altAlleleLength; iii++ ) { - newHaplotype[haplotypeInsertLocation+iii] = altAllele.getBases()[iii+1]; - } - } else { // deletion - final int shift = refAllele.length() - altAllele.length(); - final int altAlleleLength = altAllele.length() - 1; - newHaplotype = new byte[bases.length - shift]; - for( int iii = 0; iii < haplotypeInsertLocation + altAlleleLength; iii++ ) { - newHaplotype[iii] = bases[iii]; - } - for( int iii = haplotypeInsertLocation + altAlleleLength; iii < newHaplotype.length; iii++ ) { - newHaplotype[iii] = bases[iii+shift]; - } - } - } catch (Exception e) { // event already on haplotype is too large/complex to insert another allele, most likely because of not enough reference padding - return new Haplotype(bases.clone()); - } - - return new Haplotype(newHaplotype); + byte[] newHaplotypeBases = new byte[]{}; + newHaplotypeBases = ArrayUtils.addAll(newHaplotypeBases, ArrayUtils.subarray(bases, 0, haplotypeInsertLocation)); // bases before the variant + newHaplotypeBases = ArrayUtils.addAll(newHaplotypeBases, altAllele.getBases()); // the alt allele of the variant + newHaplotypeBases = ArrayUtils.addAll(newHaplotypeBases, ArrayUtils.subarray(bases, haplotypeInsertLocation + refAllele.length(), bases.length)); // bases after the variant + return new Haplotype(newHaplotypeBases); } public static LinkedHashMap makeHaplotypeListFromAlleles(final List alleleList, diff --git a/public/java/test/org/broadinstitute/sting/utils/HaplotypeUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/HaplotypeUnitTest.java index 161eefa8f..ddffb6e4c 100644 --- a/public/java/test/org/broadinstitute/sting/utils/HaplotypeUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/HaplotypeUnitTest.java @@ -31,6 +31,8 @@ import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.utils.variantcontext.Allele; +import org.broadinstitute.sting.utils.variantcontext.VariantContext; +import org.broadinstitute.sting.utils.variantcontext.VariantContextBuilder; import org.testng.Assert; import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; @@ -53,11 +55,11 @@ public class HaplotypeUnitTest extends BaseTest { h1CigarList.add(new CigarElement(bases.length(), CigarOperator.M)); final Cigar h1Cigar = new Cigar(h1CigarList); String h1bases = "AACTTCTGGTCAACTGGTCAACTGGTCAACTGGTCA"; - basicInsertTest("A", "AACTT", 1, h1Cigar, bases, h1bases); - h1bases = "ACTGGTCACTTAACTGGTCAACTGGTCAACTGGTCA"; + basicInsertTest("A", "AACTT", 0, h1Cigar, bases, h1bases); + h1bases = "ACTGGTCAACTTACTGGTCAACTGGTCAACTGGTCA"; basicInsertTest("A", "AACTT", 7, h1Cigar, bases, h1bases); h1bases = "ACTGGTCAACTGGTCAAACTTCTGGTCAACTGGTCA"; - basicInsertTest("A", "AACTT", 17, h1Cigar, bases, h1bases); + basicInsertTest("A", "AACTT", 16, h1Cigar, bases, h1bases); } @Test @@ -68,11 +70,11 @@ public class HaplotypeUnitTest extends BaseTest { h1CigarList.add(new CigarElement(bases.length(), CigarOperator.M)); final Cigar h1Cigar = new Cigar(h1CigarList); String h1bases = "ATCAACTGGTCAACTGGTCAACTGGTCA"; - basicInsertTest("AACTT", "A", 1, h1Cigar, bases, h1bases); - h1bases = "ACTGGTCGGTCAACTGGTCAACTGGTCA"; - basicInsertTest("AACTT", "A", 7, h1Cigar, bases, h1bases); + basicInsertTest("ACTGG", "A", 0, h1Cigar, bases, h1bases); + h1bases = "ACTGGTCAGTCAACTGGTCAACTGGTCA"; + basicInsertTest("AACTG", "A", 7, h1Cigar, bases, h1bases); h1bases = "ACTGGTCAACTGGTCAATCAACTGGTCA"; - basicInsertTest("AACTT", "A", 17, h1Cigar, bases, h1bases); + basicInsertTest("ACTGG", "A", 16, h1Cigar, bases, h1bases); } @Test @@ -102,11 +104,11 @@ public class HaplotypeUnitTest extends BaseTest { h1CigarList.add(new CigarElement(7 + 4, CigarOperator.M)); final Cigar h1Cigar = new Cigar(h1CigarList); String h1bases = "AACTTTCG" + "CCGGCCGGCC" + "ATCGATCG" + "AGGGGGA" + "AGGC"; - basicInsertTest("A", "AACTT", 1, h1Cigar, bases, h1bases); + basicInsertTest("A", "AACTT", 0, h1Cigar, bases, h1bases); h1bases = "ATCG" + "CCGGCCGGCC" + "ATCACTTGATCG" + "AGGGGGA" + "AGGC"; - basicInsertTest("A", "AACTT", 7, h1Cigar, bases, h1bases); + basicInsertTest("C", "CACTT", 6, h1Cigar, bases, h1bases); h1bases = "ATCG" + "CCGGCCGGCC" + "ATCGATCG" + "AGACTTGGGGA" + "AGGC"; - basicInsertTest("A", "AACTT", 17, h1Cigar, bases, h1bases); + basicInsertTest("G", "GACTT", 16, h1Cigar, bases, h1bases); } @Test @@ -120,12 +122,12 @@ public class HaplotypeUnitTest extends BaseTest { h1CigarList.add(new CigarElement(3, CigarOperator.D)); h1CigarList.add(new CigarElement(7 + 4, CigarOperator.M)); final Cigar h1Cigar = new Cigar(h1CigarList); - String h1bases = "A" + "CGGCCGGCC" + "ATCGATCG" + "AGGGGGA" + "AGGC"; - basicInsertTest("AACTT", "A", 1, h1Cigar, bases, h1bases); - h1bases = "ATCG" + "CCGGCCGGCC" + "ATCG" + "AGGGGGA" + "AGGC"; - basicInsertTest("AACTT", "A", 7, h1Cigar, bases, h1bases); + String h1bases = "A" + "CCGGCCGGCC" + "ATCGATCG" + "AGGGGGA" + "AGGC"; + basicInsertTest("ATCG", "A", 0, h1Cigar, bases, h1bases); + h1bases = "ATCG" + "CCGGCCGGCC" + "ATAAAG" + "AGGGGGA" + "AGGC"; + basicInsertTest("CGATC", "AAA", 6, h1Cigar, bases, h1bases); h1bases = "ATCG" + "CCGGCCGGCC" + "ATCGATCG" + "AGA" + "AGGC"; - basicInsertTest("AACTT", "A", 17, h1Cigar, bases, h1bases); + basicInsertTest("GGGGG", "G", 16, h1Cigar, bases, h1bases); } @Test @@ -148,13 +150,16 @@ public class HaplotypeUnitTest extends BaseTest { } private void basicInsertTest(String ref, String alt, int loc, Cigar cigar, String hap, String newHap) { - final int INDEL_PADDING_BASE = (ref.length() == alt.length() ? 0 : 1); final Haplotype h = new Haplotype(hap.getBytes()); final Allele h1refAllele = Allele.create(ref, true); final Allele h1altAllele = Allele.create(alt, false); + final ArrayList alleles = new ArrayList(); + alleles.add(h1refAllele); + alleles.add(h1altAllele); + final VariantContext vc = new VariantContextBuilder().alleles(alleles).loc("1", loc, loc + h1refAllele.getBases().length - 1).make(); h.setAlignmentStartHapwrtRef(0); h.setCigar(cigar); - final Haplotype h1 = h.insertAllele(h1refAllele, h1altAllele, loc - INDEL_PADDING_BASE); + final Haplotype h1 = h.insertAllele(vc.getReference(), vc.getAlternateAllele(0), loc); final Haplotype h1expected = new Haplotype(newHap.getBytes()); Assert.assertEquals(h1, h1expected); }