Critical bugfix for CommonSuffixSplitter to avoid infinite loops

-- The previous version would enter into an infinite loop in the case where we have a graph that looks like:

X -> A -> B
Y -> A -> B

So that the incoming vertices of B all have the same sequence.  This would cause us to remodel the graph endless by extracting the common sequence A and rebuilding exactly the same graph.  Fixed and unit tested

-- Additionally add a max to the number of simplification cycles that are run (100), which will throw an error and write out the graph for future debugging.  So the GATK will always error out, rather than just go on forever
-- After 5 rounds of simplification we start keeping a copy of the previous graph, and then check if the current graph is actually different from the previous graph.  Equals here means that all vertices have equivalents in both graphs, as do all edges.  If the two graphs are equal we stop simplifying.  It can be a bit expensive but it only happens when we end up cycling due to the structure of the graph.
-- Added a unittest that goes into an infinite loop (found empirically in running the CEU trio) and confirmed that the new approach aborts out correctly
-- #resolves GSA-924
-- See https://jira.broadinstitute.org/browse/GSA-924 for more details
-- Update MD5s due to change in assembly graph construction
This commit is contained in:
Mark DePristo 2013-04-08 14:00:51 -04:00
parent 0194c9492d
commit b115e5c582
6 changed files with 134 additions and 38 deletions

View File

@ -90,21 +90,23 @@ public class CommonSuffixSplitter {
if ( v == null ) throw new IllegalArgumentException("v cannot be null"); if ( v == null ) throw new IllegalArgumentException("v cannot be null");
if ( ! graph.vertexSet().contains(v) ) throw new IllegalArgumentException("graph doesn't contain vertex v " + v); if ( ! graph.vertexSet().contains(v) ) throw new IllegalArgumentException("graph doesn't contain vertex v " + v);
final Collection<SeqVertex> toMerge = graph.incomingVerticesOf(v); final Collection<SeqVertex> toSplit = graph.incomingVerticesOf(v);
if ( toMerge.size() < 2 ) if ( toSplit.size() < 2 )
// Can only split at least 2 vertices // Can only split at least 2 vertices
return false; return false;
else if ( ! safeToSplit(graph, v, toMerge) ) { else if ( ! safeToSplit(graph, v, toSplit) ) {
return false; return false;
} else { } else {
final SeqVertex suffixVTemplate = commonSuffix(toMerge); final SeqVertex suffixVTemplate = commonSuffix(toSplit);
if ( suffixVTemplate.isEmpty() ) { if ( suffixVTemplate.isEmpty() ) {
return false; return false;
} else if ( allVerticesAreTheCommonSuffix(suffixVTemplate, toSplit) ) {
return false;
} else { } else {
final List<BaseEdge> edgesToRemove = new LinkedList<BaseEdge>(); final List<BaseEdge> edgesToRemove = new LinkedList<BaseEdge>();
// graph.printGraph(new File("split.pre_" + v.getSequenceString() + "." + counter + ".dot"), 0); // graph.printGraph(new File("split.pre_" + v.getSequenceString() + "." + counter + ".dot"), 0);
for ( final SeqVertex mid : toMerge ) { for ( final SeqVertex mid : toSplit ) {
// create my own copy of the suffix // create my own copy of the suffix
final SeqVertex suffixV = new SeqVertex(suffixVTemplate.getSequence()); final SeqVertex suffixV = new SeqVertex(suffixVTemplate.getSequence());
graph.addVertex(suffixV); graph.addVertex(suffixV);
@ -130,7 +132,7 @@ public class CommonSuffixSplitter {
} }
} }
graph.removeAllVertices(toMerge); graph.removeAllVertices(toSplit);
graph.removeAllEdges(edgesToRemove); graph.removeAllEdges(edgesToRemove);
// graph.printGraph(new File("split.post_" + v.getSequenceString() + "." + counter++ + ".dot"), 0); // graph.printGraph(new File("split.post_" + v.getSequenceString() + "." + counter++ + ".dot"), 0);
@ -141,6 +143,25 @@ public class CommonSuffixSplitter {
// private static int counter = 0; // private static int counter = 0;
/**
* Would all vertices that we'd split just result in the common suffix?
*
* That is, suppose we have prefix nodes ABC and ABC. After splitting all of the vertices would
* just be ABC again, and we'd enter into an infinite loop.
*
* @param commonSuffix the common suffix of all vertices in toSplits
* @param toSplits the collection of vertices we want to split
* @return true if all of the vertices are equal to the common suffix
*/
private boolean allVerticesAreTheCommonSuffix(final SeqVertex commonSuffix, final Collection<SeqVertex> toSplits) {
for ( final SeqVertex toSplit : toSplits ) {
if ( toSplit.length() != commonSuffix.length() )
return false;
}
return true;
}
/** /**
* Can we safely split up the vertices in toMerge? * Can we safely split up the vertices in toMerge?
* *

View File

@ -72,6 +72,12 @@ public final class SeqGraph extends BaseGraph<SeqVertex> {
*/ */
protected final static int MIN_COMMON_SEQUENCE_TO_MERGE_SOURCE_SINK_VERTICES = 10; protected final static int MIN_COMMON_SEQUENCE_TO_MERGE_SOURCE_SINK_VERTICES = 10;
/**
* How many cycles of the graph simplifications algorithms will we run before
* thinking something has gone wrong and throw an exception?
*/
private final static int MAX_REASONABLE_SIMPLIFICATION_CYCLES = 100;
/** /**
* Construct an empty SeqGraph * Construct an empty SeqGraph
*/ */
@ -101,29 +107,56 @@ public final class SeqGraph extends BaseGraph<SeqVertex> {
} }
protected void simplifyGraph(final int maxCycles) { protected void simplifyGraph(final int maxCycles) {
boolean didSomeWork;
int i = 0;
// start off with one round of zipping of chains for performance reasons // start off with one round of zipping of chains for performance reasons
zipLinearChains(); zipLinearChains();
do {
SeqGraph prevGraph = null;
for( int i = 0; i < maxCycles; i++ ) {
if ( i > MAX_REASONABLE_SIMPLIFICATION_CYCLES ) {
logger.warn("Infinite loop detected in simpliciation routines. Writing current graph to debugMeMark.dot");
printGraph(new File("debugMeMark.dot"), 0);
throw new IllegalStateException("Infinite loop detected in simplification routines for kmer graph " + getKmerSize());
}
final boolean didSomeWork = simplifyGraphOnce(i);
if ( ! didSomeWork )
// no simplification algorithm could run, so stop
break;
// we get five cycles before we start looking for changes in the graph
// by cloning ourselves and then checking for any changes
if ( i > 5 ) {
// the previous graph and this graph have the same structure, so the simplification
// algorithms are looping endless between states. Just break and consider ourselves done
if ( prevGraph != null && graphEquals(prevGraph, this) )
break;
prevGraph = (SeqGraph)clone();
}
}
}
/**
* Run one full cycle of the graph simplification algorithms
* @return true if any algorithms said they did some simplification
*/
private boolean simplifyGraphOnce(final int iteration) {
//logger.info("simplifyGraph iteration " + i); //logger.info("simplifyGraph iteration " + i);
// iterate until we haven't don't anything useful // iterate until we haven't don't anything useful
didSomeWork = false; boolean didSomeWork = false;
if ( PRINT_SIMPLIFY_GRAPHS ) printGraph(new File("simplifyGraph." + i + ".1.dot"), 0); if ( PRINT_SIMPLIFY_GRAPHS ) printGraph(new File("simplifyGraph." + iteration + ".1.dot"), 0);
didSomeWork |= new MergeDiamonds().transformUntilComplete(); didSomeWork |= new MergeDiamonds().transformUntilComplete();
didSomeWork |= new MergeTails().transformUntilComplete(); didSomeWork |= new MergeTails().transformUntilComplete();
if ( PRINT_SIMPLIFY_GRAPHS ) printGraph(new File("simplifyGraph." + i + ".2.diamonds_and_tails.dot"), 0); if ( PRINT_SIMPLIFY_GRAPHS ) printGraph(new File("simplifyGraph." + iteration + ".2.diamonds_and_tails.dot"), 0);
didSomeWork |= new SplitCommonSuffices().transformUntilComplete(); didSomeWork |= new SplitCommonSuffices().transformUntilComplete();
if ( PRINT_SIMPLIFY_GRAPHS ) printGraph(new File("simplifyGraph." + i + ".3.split_suffix.dot"), 0); if ( PRINT_SIMPLIFY_GRAPHS ) printGraph(new File("simplifyGraph." + iteration + ".3.split_suffix.dot"), 0);
didSomeWork |= new MergeCommonSuffices().transformUntilComplete(); didSomeWork |= new MergeCommonSuffices().transformUntilComplete();
if ( PRINT_SIMPLIFY_GRAPHS ) printGraph(new File("simplifyGraph." + i + ".4.merge_suffix.dot"), 0); if ( PRINT_SIMPLIFY_GRAPHS ) printGraph(new File("simplifyGraph." + iteration + ".4.merge_suffix.dot"), 0);
didSomeWork |= new MergeHeadlessIncomingSources().transformUntilComplete(); didSomeWork |= new MergeHeadlessIncomingSources().transformUntilComplete();
didSomeWork |= zipLinearChains(); didSomeWork |= zipLinearChains();
i++; return didSomeWork;
} while (didSomeWork && i < maxCycles);
} }
/** /**
@ -431,15 +464,13 @@ public final class SeqGraph extends BaseGraph<SeqVertex> {
* *
* Performs the transformation: * Performs the transformation:
* *
* { x + S_i + y -> Z } * { x + S_i -> y -> Z }
* *
* goes to: * goes to:
* *
* { x -> S_i -> y -> Z } * { x -> S_i -> y + Z }
* *
* for all nodes that match this configuration. * for all nodes that match this configuration.
*
* Differs from the diamond transform in that no top node is required
*/ */
protected class MergeCommonSuffices extends VertexBasedTransformer { protected class MergeCommonSuffices extends VertexBasedTransformer {
@Override @Override
@ -449,8 +480,6 @@ public final class SeqGraph extends BaseGraph<SeqVertex> {
} }
/** /**
* Merge headless configurations:
*
* Performs the transformation: * Performs the transformation:
* *
* { x + S_i + y -> Z } * { x + S_i + y -> Z }

View File

@ -63,8 +63,8 @@ public class HaplotypeCallerComplexAndSymbolicVariantsIntegrationTest extends Wa
} }
@Test @Test
public void testHaplotypeCallerMultiSampleComplex() { public void testHaplotypeCallerMultiSampleComplex1() {
HCTestComplexVariants(privateTestDir + "AFR.complex.variants.bam", "", "6b673efb6f12b5deebb3e63fe94c48ed"); HCTestComplexVariants(privateTestDir + "AFR.complex.variants.bam", "", "490ecf6619740c01c81a463392ef23cf");
} }
private void HCTestSymbolicVariants(String bam, String args, String md5) { private void HCTestSymbolicVariants(String bam, String args, String md5) {

View File

@ -166,7 +166,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest {
@Test @Test
public void HCTestStructuralIndels() { public void HCTestStructuralIndels() {
final String base = String.format("-T HaplotypeCaller -R %s -I %s", REF, privateTestDir + "AFR.structural.indels.bam") + " --no_cmdline_in_header -o %s -minPruning 6 -L 20:8187565-8187800 -L 20:18670537-18670730"; final String base = String.format("-T HaplotypeCaller -R %s -I %s", REF, privateTestDir + "AFR.structural.indels.bam") + " --no_cmdline_in_header -o %s -minPruning 6 -L 20:8187565-8187800 -L 20:18670537-18670730";
final WalkerTestSpec spec = new WalkerTestSpec(base, Arrays.asList("e8466846ca420bcbcd52b97f7a661aa3")); final WalkerTestSpec spec = new WalkerTestSpec(base, Arrays.asList("b6fd839641ee038048626fbd1154f173"));
executeTest("HCTestStructuralIndels: ", spec); executeTest("HCTestStructuralIndels: ", spec);
} }

View File

@ -102,8 +102,8 @@ public class CommonSuffixSplitterUnitTest extends BaseTest {
public void testSplitNoCycles() { public void testSplitNoCycles() {
final SeqGraph original = new SeqGraph(); final SeqGraph original = new SeqGraph();
final SeqVertex v1 = new SeqVertex("A"); final SeqVertex v1 = new SeqVertex("A");
final SeqVertex v2 = new SeqVertex("C"); final SeqVertex v2 = new SeqVertex("AC");
final SeqVertex v3 = new SeqVertex("C"); final SeqVertex v3 = new SeqVertex("TC");
final SeqVertex v4 = new SeqVertex("G"); final SeqVertex v4 = new SeqVertex("G");
original.addVertices(v1, v2, v3, v4); original.addVertices(v1, v2, v3, v4);
@ -116,7 +116,7 @@ public class CommonSuffixSplitterUnitTest extends BaseTest {
Assert.assertFalse(new CommonSuffixSplitter().split(original, v4), "Cannot split graph with a cycle of the bottom list"); Assert.assertFalse(new CommonSuffixSplitter().split(original, v4), "Cannot split graph with a cycle of the bottom list");
} }
@Test(timeOut = 10000) @Test(timeOut = 10000, enabled = !DEBUG)
public void testSplitComplexCycle() { public void testSplitComplexCycle() {
final SeqGraph original = new SeqGraph(); final SeqGraph original = new SeqGraph();
final SeqVertex r1 = new SeqVertex("ACTG"); final SeqVertex r1 = new SeqVertex("ACTG");
@ -130,7 +130,7 @@ public class CommonSuffixSplitterUnitTest extends BaseTest {
original.addEdges(r1, cat1, c1, cat2, c1); original.addEdges(r1, cat1, c1, cat2, c1);
original.addEdges(r2, c2, cat2); original.addEdges(r2, c2, cat2);
original.printGraph(new File("testSplitComplexCycle.dot"), 0); //original.printGraph(new File("testSplitComplexCycle.dot"), 0);
for ( final SeqVertex v : Arrays.asList(cat2) ) { // original.vertexSet() ) { for ( final SeqVertex v : Arrays.asList(cat2) ) { // original.vertexSet() ) {
final SeqGraph graph = (SeqGraph)original.clone(); final SeqGraph graph = (SeqGraph)original.clone();
@ -139,4 +139,32 @@ public class CommonSuffixSplitterUnitTest extends BaseTest {
Assert.assertFalse(success, "Shouldn't be able to split any vertices but CommonSuffixSplitter says it could for " + v); Assert.assertFalse(success, "Shouldn't be able to split any vertices but CommonSuffixSplitter says it could for " + v);
} }
} }
@Test(timeOut = 10000)
public void testSplitInfiniteCycleFailure() {
final SeqGraph original = new SeqGraph();
final SeqVertex v1 = new SeqVertex("GC");
final SeqVertex v2 = new SeqVertex("X");
final SeqVertex v3 = new SeqVertex("N");
final SeqVertex v4 = new SeqVertex("C");
original.addVertices(v1, v2, v3, v4);
original.addEdge(v1, v2, new BaseEdge(false, 12));
original.addEdge(v2, v3, new BaseEdge(false, 23));
original.addEdge(v3, v4, new BaseEdge(false, 34));
original.addEdge(v4, v2, new BaseEdge(false, 42));
original.printGraph(new File("testSplitInfiniteCycleFailure.dot"), 0);
final SeqGraph graph = (SeqGraph)original.clone();
final boolean success = new CommonSuffixSplitter().split(graph, v2);
Assert.assertTrue(success);
for ( final SeqVertex v : graph.vertexSet() ) {
graph.printGraph(new File("testSplitInfiniteCycleFailure.first_split.dot"), 0);
final boolean success2 = new CommonSuffixSplitter().split((SeqGraph)graph.clone(), v);
if ( success2 ) graph.printGraph(new File("testSplitInfiniteCycleFailure.fail.dot"), 0);
Assert.assertFalse(success2, "Shouldn't be able to split any vertices but CommonSuffixSplitter says it could for " + v);
}
}
} }

View File

@ -521,4 +521,22 @@ public class SeqGraphUnitTest extends BaseTest {
throw e; throw e;
} }
} }
@Test(timeOut = 10000)
public void testInfiniteCycleFromEmpiricalRuns() {
final SeqVertex v1 = new SeqVertex("CCCT");
final SeqVertex v2 = new SeqVertex("CATCCTCCCTTCTAGACTTCTCCTCCTCCTCCACCATCCTCCCCTCTAGACTTCTCCTCCTCCTCCACCATCCTCCCCTCTAGACTTCTCCTCCTCCTCC");
final SeqVertex v3 = new SeqVertex("CTAGACTTCTCCTCCTCCTCC");
final SeqVertex v4 = new SeqVertex("ACCATC");
final SeqVertex v5 = new SeqVertex("CCTCCACCATCCTCCCCTCTAGGCTTCTCCTCCTCCTCCACCATCCTCCCCTCTAGACTTCTCCTCCTCCTCCACCATCCTCCCCTCTAGACTTCTCCTCCTCCTCCACCATC");
final SeqVertex v6 = new SeqVertex("CTCCCCT");
final SeqGraph graph = new SeqGraph();
graph.addVertices(v1, v2, v3, v4, v5, v6);
graph.addEdges(v1, v3, v4, v6, v3);
graph.addEdges(v2, v4);
graph.addEdges(v5, v6);
graph.simplifyGraph();
}
} }